chapter 17 - from gene to protein

Now that we know how the genetic design information that codes for all the RNA/proteins necessary to build/maintain organisms is replicated so that it can be passed from cell to cell, organism to organism or even virus to virus…what is the next question?

Chapter 17 - From Gene to Protein

The next question concerns how DNA…


1. …is replicated during S phase so that the information it encodes needed to build/maintain organisms can be passed to the next generation.

2. …stores this information that will be used to make all the RNA/polypeptides that will directly build/maintain the organism.

molecular biology- the study of biology at the molecular level (overlaps biochemistry and genetics in particular). Much of what we have done thus far is molecular biology – cell resp, photosyn, membrane transport, endomembrane system, central dogma, etc… Mendelian genetics is not because you never discuss the molecular level, but chromosomal genetics is.

Your cells need “workers”. We have discussed many of these workers in detail at this point: glycolysis enzymes, krebs enzymes, ETC transporters, cytoskeleton, antibodies, insulin, carbonic anhydrase, hemoglobin, glucose transporter, Calvin enzymes, Photosystems, kinesin, Various receptors, signal transduction proteins, tRNA, ribosomes, photosystems, and the list goes on… What determines the structure/function of a protein/RNA?The sequence.

The DNA (gene) sequence.

Your parents DNA sequence and the changes (mutations) that might have occurred between them and you…


What determines the sequence?

What determines your DNA sequence?

Fig. 10.6A

?

Chapter 17 - From Gene to ProteinNEW AIM: How is genetic information transmitted from DNA to protein?

How is the genetic information transmitted from DNA to protein?

Fig. 10.6A

?


What did we call this process?

Fig. 10.6A

?

Chapter 17 - From Gene to ProteinAIM: How is genetic information transmitted from DNA to protein?

The Central Dogma of Molecular Biology

What is the first step and what enzyme is involved?

Transcribe means to make a written copy. mRNA is a copy of a segment of DNA, a gene. They are the same language – nucleic acid language.



…and the second step?

By RNA polymerase

Translate means to convert between languages. In this case, nucleic acid language is translated into amino acid language by the ribosome and tRNA.



By the ribosome and tRNAs

Reminder (analogy):


Do bacteria have a library?They do not have a nucleus…transcription occurs in the semifluid (cytoplasm)


The nucleus is the library, the DNA/chromosomes are the reference books that cannot leave the library, and the mRNA is the transcription or copy of a small part of the DNA, a gene, that is slipped through the nuclear pore to a ribosome (rRNA + proteins) in the cytosol that will be involved in translating the nucleic acid language into amino acid language (a polypeptide) with the help of tRNA.

Fig. 10.7


Reminder:A single chromosome has thousands of genes…

Each gene codes for?

A complementary piece of RNA (mRNA, tRNA or rRNA)If the gene codes for mRNA, then the mRNA

will code for?A polypeptideIf the polypeptide is functional all by itself (no __________ structure), it is a…?

Quaternary

Protein

Fig. 10.8B

Chapter 17 - From Gene to ProteinAIM: How is genetic information transmitted from DNA to protein?1. TRANSCRIPTION (The Basics)

You be RNA polymerase and transcribe the above piece of DNA…

Fig. 10.8B


PROBLEM: DNA has two strands. RNA polymerase only transcribes one strand into RNA… Which one?- That depends on the gene. The same strand

will always be transcribed by RNA polymerase for a given gene.

Fig. 10.8B


In this example, it is the top strand that will be transcribed.Transcribe it…

5’ 3’

5’3’


RNA polymerase will bind to the DNA, open up the strands (using ATP of course) and random RNA nucleotides (triphosphates) will bounce in and out of the active site until the complementary one bounces in and sticks long enough for the condensation reaction to occur forming a phosphodiester linkage. Which DNA strand does the transcribed strand look like?

The RNA transcript will look like the non-transcribed strand with U substituted for T.

SEEING DOUBLE:

5’ 3’

5’3’

Fig. 10.8B


The transcribed strand is also called the:

The other DNA strand is called the:

1. Sense strand

1. Template Strand2. anti-sense strand

3. non-coding strand

The reason for number one is obvious, but the other two are not...these are named this way because:

2. Coding strandWhy?

Sense or coding strand

Template/antisense or non-coding strand

Why? Because the sequence of this strand matches the RNA with U for T of course. Therefore, this DNA strand makes sense because it matches the RNA. Also, the RNA carries the CODE and therefore the strand it looks like is the CODE-ing strand.


RNA polymerase is similar to DNA polymerase in that: Sense or coding strand

Template/antisense or non-coding strand

It can only synthesize RNA from the 5’ to 3’ end…

5’ 3’How would you label the DNA in this case?

5’ 3’

5’3’

You label the sense strand the same way the RNA transcript is labeled and the complementary strand that RNA polymerase used to make the transcript must be antiparallel…

Chapter 17 - From Gene to ProteinAIM: How is genetic information transmitted from DNA to protein?Question 1:

Write out the transcript of the following gene from 5’ to 3’ if the top strand is the sense strand.

ATAGCGGCTATTA5’

ANS: 5’ AUUAUCGGCGAUA 3’

TATCGCCGATAAT5’3’

3’

If the top strand is the sense strand then the template strand is the opposite strand or the bottom one. RNA polymerase can only make RNA 5’ to 3’ and therefore must start on the right and work toward the left looking at the bottom strand. You could also reason that the top is the sense and the transcript must read just like the sense from 5’ to 3’.


Write out the transcript of the following gene from 5’ to 3’ if the bottom strand is the antisense (non-coding) strand.

ATAGCGGCTATTA3’

ANS: 5’ AUAGCGGCUAUUA3’


5’

Since the bottom strand is the non-coding strand or antisense strand, this is the template. RNA polymerase looks at this one and adds the complementary bases starting at the 3’ end since it can only make RNA 5’ to 3’.


Write out the transcript of the following gene from 5’ to 3’ if the bottom strand is the sense (coding) strand.

ATAGCGGCTATTA3’

ANS: 5’ UAAUAGCCGCUAU 3’


5’

Since the bottom strand is the coding strand (sense strand), the top one is the template. RNA polymerase looks at the top strand and adds the complementary bases starting at the 3’ end since it can only make RNA 5’ to 3’.


RNA polymerase makes the following transcript:

3’

RNA Transcript: 5’ AUCGCGGUUACGG 3’

3’5’

5’

You are given the transcript. There are a few ways to do this. I prefer thinking from the perspective of RNA polymerase. Since this is what it made, it must have looked at the complementary DNA strand going from 3’ to 5’, which I wrote as the bottom strand here. I then filled in the complementary DNA strand above it to complete the double stranded DNA molecule.

Draw out the piece of DNA corresponding to this transcript:

ATCGCGGTTACGGTAGCGCCAATGCC

DNA is always written with the 5’ end of one strand on the top left.


RNA polymerase makes the following transcript:

3’

RNA Transcript: 3’ AUCCGGCGAUUUCG 5’

3’5’

5’I will always write out the RNA transcript from 5’ to 3’ because this is how it is made and that is what makes sense to me. Then you finish it the same way as the previous one…

Draw out the piece of DNA corresponding to this transcript:

GCTTTAGCGGCCTACGAAATCGCCGGAT

RNA Transcript (flipped over): 5’ GCUUUAGCGGCCUA 3’


You send in a segment of a gene to the DNA sequencing facility. They return the following sequence to you:

RNA Transcript: 5’ GCAACUUCGCCAUUAG 3’

3’5’

It would be the same as the sense strand with U substituted for T.

This is the sense strand. What would the RNA transcript be?

GCAACTTCGCCATTAG

AIM: How is genetic information transmitted from DNA to Protein?

1. TRANSCRIPTION (the details)Central Dogma (DNA to polypeptide)

What parts of your genome (DNA/chromosomes) do RNA polymerases transcribe? The 30,000+ Genes

How do the enzymes (RNA polymerases) “know” where the genes start and where they stop???


1. TRANSCRIPTION (some details)Central Dogma (DNA to polypeptide)

We only need to look at how this works at a single gene as the process is similar for all of them.

a single gene


Fig. 10.9B

1. TRANSCRIPTION (some details)Central Dogma (DNA to polypeptide)

Let’s put this into some realistic context. Let’s imagine we are in the nucleus of a beta cell of your pancreas, which are the ones that secrete insulin when your blood glucose levels get too high (>140mg/dl). They need to be ready at any moment in case you drink a soda… and thus the gene is typically active and insulin is being made and packed into vesicles via the endomembrane system. The vesicles sit and wait for glucose to bind a receptor on the membrane followed by signal transduction, which will trigger the vesicles to fuse with the membrane and thus release the insulin into the blood. Let’s watch the mRNA being transcribed for the insulin gene…


Fig. 10.9B

1. TRANSCRIPTIONCentral Dogma (DNA to polypeptide)

Basic Anatomy of a Gene:

1. The Promoter – a sequence of DNA that RNA polymerase will bind (“stick”) to indirectly with the help of other proteins called transcription factors in order to begin transcription (see video). 2. The Transcription Unit – the part that is transcribed into RNA (promoter and terminator are not transcribed)3. The Terminator – sequence of DNA that will cause RNA polymerase to stop and fall off the DNA

(Transcription Unit)

a. In prokaryotes the consensus sequence is TATAAT and is called the Pribnow boxb. In eukaryotes the consensus sequence is TATAAA and is called the TATA box



Let’s watch a video to see how these parts of the gene, RNA polymerase, a bunch of special protein called transcription factors and of course…ATP, come together to make transcription possible.


Fig. 10.9B

1. TRANSCRIPTION of the gene has 3 general stages:

Central Dogma (DNA to polypeptide)

A. Initiationi. RNA polymerase and general TFs bind to promoter region

ii. DNA unwinds and transcription begins (requires ATP)iii. The Promoter sequence “tells” RNA polymerase which strand of DNA to transcribe

5’

3’

3’

5’


Fig. 10.9B



A. Initiationiv. Transcription factors

- Additional proteins required for RNA polymerase to start transcription.- We have spoken many times about such factors being phosphorylated in the cytoplasm via signal transduction resulting in their export into the nucleus.

ASIDE: ATP does NOT REDUCE anything, it phosphorylates.


Fig. 10.9B



A. InitiationMore Detail:

Don’t memorize this level of detail unless you have nothing else to do. First email me though and I will find you something else to do.


Fig. 10.9B

1. TRANSCRIPTION (3 stages)Central Dogma (DNA to polypeptide)

B. Elongationi. RNA polymerase polymerizes complementary RNA nucleotides across from the template/anti-sense/non-coding strand., which is always the same in a gene and is determined by the promoter.

anti-sense strandnon-coding strand

sense strandcoding strand

5’

3’

3’

5’

5’

5’


Fig. 10.9B


B. Elongationii. Just like DNA polymerase, where does RNA polymerase get the energy to link together RNA nucleotides?A. From the nucleotides themselves: they are all triphosphates (ATP, GTP, UTP, CTP) and have a higher affinity for each other than for the diphosphate they are attached to…

5’

iii. Rate:

~60 nucleotides per second


Fig. 10.9B


i. RNA polymerase reaches a sequence in the gene that causes it to fall off, releasing the completed RNA transcript.

C. Termination

NEW AIM: How is genetic information transmitted from DNA to Protein?

RNA polymerase making RNA (the red strand)


What might be the evolutionary advantage of having a nucleus? After all, bacteria do not have nuclei and they make RNA and polypeptides from their chromosome similar to eukaryotes…

Part of the answer might lie in RNA PROCESSING

By separating the initial RNA transcript from the ribosomes in the cytoplasm, “workers” are able to modify the RNA in various ways…it is all about compartmentalization…


RNA PROCESSING (eukaryotes ONLY)

By separating the initial RNA transcript from the ribosomes in the cytoplasm, “workers” are able to modify the RNA in various ways…it is all about compartmentalization…

1. Adding the 5’ cap and the poly A (adenosine) tail


RNA Processing (eukaryotes) – the 5’ cap and poly A tail


7-methyl-guanosine CAP


RNA PROCESSING (eukaryotes ONLY)

1. Adding the 5’ cap and the poly A (adenosine) tailFUNCTION?

2. RNA Splicing

C. The cap and tail assist the ribosome to bind

B. Both protect the mRNA from hydrolysis in the cytoplasm by nucleases known as RNAses.

A. Both appear to be required for nuclear export.


Fig. 10.10

More detailed Anatomy of a Eukaryotic Gene:

i. - Transcription unit of eukaryotes is broken into exons and introns.

2. RNA Splicing

- Both the exons and introns are transcribed as shown, but…

- The introns are named because they are “intervening” sequences.


Fig. 10.10

ii. Introns are removed from the mRNA and the exons are SPLICED together by the spliceosome.

iii. Spliceosomes are RNA and protein complexes…(what other complex is composed of RNA and protein, and is active between DNA and protein in the central dogma also supporting the RNA world hypothesis?)

The ribosome

-some = body

2. RNA Splicing

Why do splicing???


What is the spliceosome composed of?

SnRNPs (“snurps”)

2. RNA Splicing

1. SnRNP = Small nuclear ribonucleoproteins

2. Composed of a core snRNA molecule of ~150 nucleotides with associated proteins3. Assorted SnRNPs combine to form the spliceosome

(Small RNA/protein complexes in the nucleus)

Aside: RibozymesAside: Ribozymes are true RNA enzymes. Certain species have introns that splice themselves out (catalyze their own removal without help from a spliceosome). These are ribozymes.

Chapter 18 - Genetics of Viruses and Bacteria

Questions1. RNA polymerase binds to __________________, which in turn bind to each other and the promoter in order to begin transcription.2. The eukaryotic promotor is known as the _____________, while the prokaryotic promotor is the _______________.3. Transcribe the following gene segment and write out the corresponding RNA sequence from 5’ to 3’:

ATGGCCGGCTATTAAGCGAC4. Identify the three general components of any gene.5. One function of the 5’cap and 3’ tail is to protect the mRNA from _____________ in the cytosol.


Beadle and Tatum (1941)In 1941, American geneticists Beadle and Tatum proposed the “one gene, one enzyme” hypothesis, which states that each gene codes for an enzyme (experiment is in your book…know it)…

Let’s look at a little history first…


Beadle and Tatum (1941)


The hypothesis was later modified to the “one gene, one protein” hypothesis…

It was again modified to the “one gene, one polypeptide” hypothesis… (you should know why)Getting closer and closer to the truth, but even this hypothesis is not always correct…

because of ALTERNATIVE SPLICING

Let’s look at a little history first…


ALTERNATIVE SPLICINGExons can be spliced together in different ways leading to different proteins/polypeptides being formed from the same gene…This may be one reason why splicing evolved – you can get more than one polypeptide per gene (not all genes do this).


Exon Shuffling


RNA Splicing


The Final Mature mRNA:

UTR – untranslated region (guess why it is called this?)


Transcription and RNA Processing Summary

1. RNA pol binds near promoter with help of transcription factors. ATP required to start transcription. 2. Transcription of the transcriptional unit begins. RNA pol moves along and puts complementary RNA nucleotides across from bases of the template/anti-sense/non-coding strand building the transcript from 5’ to 3’. Energy comes from the nucleotides themselves (they are NTPs – nucleotide triphosphates = ATP, CTP, GTP, UTP)3. RNA pol reaches the terminator DNA sequence and falls off.4. A 5’ cap and poly A tail is added if it is mRNA (as opposed to tRNA or rRNA)5. Introns are spliced out and exons spliced together by the spliceosome resulting in the mature mRNA.

6. mRNA leaves nucleus through nuclear pore

Reminder: Transcription is similar for prokaryotes and eukaryotes with the exception of where it happens (in the nucleus in eukaryotes), but RNA processing happens in eukaryotes only


Fig. 10.6A


(Translating DNA/RNA Language into amino acid language)

Cracking the Genetic Code

Genetic Code:The rules by which information is encoded in DNA/mRNA and translated into polypeptide sequences.

RNA =

What does the “sentence” say?

The chromosomes are books, which would make a gene just one sentence in these books…Chromosomes = Books

Gene = Sentence in the Book A copy of the sentence

5’ 3’



All English books are written using 26 letters arranged into different combinations to make words, which are combined to make sentences... RNA Nucleic Acid Language is MUCH simpler…




RNA Nucleic Acid Language is MUCH simpler…1. There are only 4 letters (A,U,G,C)


2. These letters combine to make “words”, called codons, which are only 3 letters long.

5’ 3’



How many different codons can be made from the four letters?

RNA Nucleic Acid Language is MUCH simpler…1. There are only 4 letters (A,U,G,C)

4 x 4 x4 = 64*Only 64 words in the entire language!!(It could not be any simpler and still work)


2. These letters combine to make “words”, called codons, which are only 3 letters long.

5’ 3’


(Deciphering DNA/RNA Language)

Cracking the Genetic CodeWhat do these 64 codons code for?

1. Sixty-One of the codons code for an amino acid

5’ 3’




1. Sixty-One of the codons code for an amino acidExample: The codon AUG codes for the amino acid Methionine (Met) – this is typically the first or starting codon, which makes __________ the first amino acid of most proteins

5’ 3’Methionine




1. Sixty-One of the codons code for an amino acidExample: The codon AUG codes for the amino acid Methionine (Met) – this is typically the first or starting codon, which makes __________ the first amino acid of most proteins

2. Three of the codons tell the ribosome to stop – UAG, UAA, UGA

5’ 3’

This is not the actual start of the mRNA, just the start of the transcription unit (TU)

This is not the actual end of the mRNA, just the end of the TU

Methionine

N CIn reality, genes are thousands of bases pairs long as are mature mRNA’s leading to polypeptides that range from 50 to 1000’s of amino acids long…NOT 3 amino acids.

Label the two ends of this polypeptide:


The Genetic CodeFig. 10.8A

The genetic code was cracked in the

1960’s, just after the structure of DNA

was elucidated.

The chart to the right is used to look up any RNA codon and determine the amino acid it codes for…


The Genetic CodeFig. 10.8A

There are Sixty-One codons coding for amino acids, but there are only how many amino acids?20

What does that mean?Some amino acids are coded for by more than one codon like Leu, which is coded for by 6 codons (built in redundancy)!

Translate the mRNA sequence below -

5’ GCGGGCAUAAUCGCAUGCCAUUUACGGGCAACUACUUUAAGCGGUAGUUUAUCCCCAAAAAAAAAAA 3’

Met-Pro-Phe-Thr-Gly-Asn-Tyr-Phe-Lys-Arg

Chapter 17 - From Gene to ProteinAIM: How is genetic information transmitted from DNA to protein?Question:

5’ GCGGGCAUAAUCGCAUGCCAUUUACGGGCAACUACUUUAAGCGGUAGUUUAUCCCCAAAAAAAAAAA 3’

STEP1: Find the first AUG (start codon). This is LIKELY the start of the coding region…

STEP2: Break it into codons if you like after the AUG…

5’ GCGGGCAUAAUCGC-AUG-CCA-UUU-ACG-GGC-AAC-UAC-UUU-AAG-CGG-UAG-UUU-AUC-CCC-AAAAAAAAAAA 3’

STEP3: Use the genetic code and translate it…

What is the mRNA sequence for the following polypeptide?

Met-Pro-Leu-Leu-Gly-Asn-Asp-Gly-Gly


You cannot know for sure since many of these amino acids can be coded for by more than one codon…

A protein is 100 amino acids long. What would be the number of nucleotides in a mRNA coding region needed to code for all these amino acids? 303 base pairs


(3 per amino acid and 3 for a stop)


Translation (mRNA to polypeptide) – the details


1. tRNA carries amino acids to the ribosome

Fig. 10.11B

Let’s start with tRNA

2. Each of the 20 amino acids is carried by a DIFFERENT tRNA3. The anticodon of the tRNA complementary basepairs with the codon of the mRNA

5’

3’


Aminoacyl-tRNA synthetases (blue)

2. Requires ATP (endergonic)

1. Enzymes that load the correct amino acid on the correct tRNA

tRNA’s are loaded like loading a gun. The amino acid wants to “shoot off” the tRNA (similar to the phosphate of ATP wanting to shoot off).Where will it be allowed to “shoot off” to?

To an amino acid in a growing polypeptide chain within the ribosome.

How are the amino acids added to tRNA molecules?

Let’s see how this works…


Aminoacyl-tRNA synthetases (blue)

2. ATP loses pyrophosphate and binds to amino acid as AMP – known as adenylation (amino acid now has energy – wants to jump off).

1. Specific amino acid like methionine, and ATP bind active site.

How are the amino acids added to tRNA molecules?

3. Appropriate tRNA enters active site –anticodon specifically binds to enzyme.4. Amino acid transfers from AMP to tRNA forming aa-tRNA (aminoacyl-tRNA). It still has energy as the tRNA

has a low affinity for the amino acid, just higher than AMP.


20, one type for each amino acid…

These enzymes have evolved to be able to bind more than one type of tRNA…

How many different aa-tRNA synthetases are there?

(With confused look on face): Hold up, there are 61 amino acid coding codons though and therefore 61 different tRNA’s!! How are there only 20 synthetases?

Let me really blow your mind…There are only ~45 different tRNA’s.

Some can recognize more than one codon…the wobble base pair as proposed by Crick in 1966.

I thought only weebles wabble!


Inosine??? What’s an inosine???


And you thought there were only 4 different bases in RNA…lol!!

Inosine (a purine)


?Which amino acid will be added to this tRNA?ALWAYS Alanine (Ala)


Identify the amino acid found on a tRNA with the anticodon 3’-GCC-5’.

1. The codon on the mRNA would be 5’-CGG-3’


2. Look this codon up

3. The amino acid attached to this tRNA if Arginine (Arg)

The amino acid proline is bound to a tRNA. What could the anticodon of this tRNA be?

The codons for proline (5’ to 3’) are: CCU, CCC, CCA and CCGThe anticodon (3’ to 5’) could then be: GGA, GGG, GGU or GGC


AUC

3’

Which amino acid will be added to this tRNA (careful)?

5’

3’

5’

Aspartate (Asp)

Remember that the mRNA is read 5’ to 3’ by the ribosomes. Therefore the tRNA will bind antiparallel 3’ CUA 5’ and the codon will be 5’ GAU 3’.


Fig. 10.13A

It all begins when the mRNA leaves the nucleus and is in the cytoplasm…

Translation (the details):Broken up into 3 stages just like transcription1. Initiation

2. Elongation3. Termination


1. The small subunit of the ribosome binds to a specific nucleotide sequence in the mRNA upstream of the start codon with the help of the cap. It will make its way to the start codon (AUG). The initiator tRNA (the first or starting tRNA) carrying methionine.

3. The large subunit of the ribosome then binds placing the initiator tRNA in the P site (you can think of P for polypeptide site).

STAGE 1: Initiation

2. The initiator tRNA (the first or starting tRNA) carrying methionine then binds via complementary base pairing rules.

Other proteins known as initiator factors are required along with GTP for initiation to occur, but not shown here…coming soon.


Fig. 10.14

1. Codon Recognition: The next tRNA enters the A site. A stands for amino acid as this is the site where amino acids attached to tRNA’s enter the ribosome.

STAGE 2: Elongation

2. Peptide bond formation: The ribosome catalyzes the transfer of the polypeptide (or amino acid if this is the second codon) to the amino acid in the A site resulting in the formation of a peptide.

N

N

N

N

3. Translocation: The RIBOSOME ONLY moves to the right (translocates) one codon. The P site tRNA enters the E (exit) site and falls out. The A site tRNA enters the P site. The A site is now open and ready for the next amino acid and the P site has the polypeptide.

2

1

3

Fig. 10.12C


QUESTION:

The ribosome is translocating along the mRNA. What is the next step?The polypeptide will be transferred to the amino acid in the A-site resulting in the formation of a peptide bond.

Fig. 10.12A


A more realistic view of what elongation looks like:


- When the ribosome arrives at a stop codon, a protein called release factor (NOT a tRNA) binds to it and causes the ribosome to break off, releasing the polypeptide.

STAGE 3: Termination


Translation (mRNA to protein)


Fig. 10.15

OVERVIEW

This is it! This is how every RNA/polypeptide in all of your cells is made starting from the gene!!The ribosome does not translate the mRNA, what does?tRNA, the ribosome allows for

stable tRNA binding and catalyzes the subsequent dehydration reaction leading to peptide bond formation.


DNA to mRNA to polypeptide (the entire dogma)


Fig. 10.15

Polyribosomes

Observed in both prokaryotes and eukaryotes

Many ribosomes can ride along a single piece of mRNA at the same time as shown to the right.


Write out the polypeptide sequence for the following gene fragment if the top strand is the sense strand (assume no splicing). CCGCGATTTAGCGGCTATTACGCTTGTACG5’

The mRNA: 5’ GCAUGUUCGCAUUAUCGGCGAUUUAGCGCC 3’

GGCGCTAAATCGCCGATAATGCGAACATGC

5’3’

3’

The polypeptide: (N) Met-Ala-Ala-Leu-Ser-Ala-Ile (C)

The mRNA: 5’ GC-AUG-UUC-GCA-UUA-UCG-GCG-AUU-UAG-CGC-C 3’

Find the reading frame:


How are proteins targeted to specific locations like outside the cell or into the ER, Golgi, Lysosome, etc…?(Endomembrane system revisited)

This figures shows the how a polypeptide destined to one of the places mentioned above gets access to the ER by having a signal peptide (ER localization signal), with the help of an SRP (a protein + RNA complex) and SRP receptor on the ER. Make sure you know the rest of the story for the upcoming essay question.


RNA Review

Review

Chapter 17 - From Gene to ProteinAIM: How is genetic information transmitted from DNA to protein?Comparing prokaryotic and eukaryotic gene transcription:

Unlike in eukaryotes because of the nucleus, prokaryotes can translate while the RNA polymerase is still transcribing the gene!!

Chapter 18 - Genetics of Viruses and Bacteria

Questions1. A point mutation that changes one codon to another, but the amino acid being coded for remains the same.2. A chemical compound that could potentially cause cancer.3. Give an example of a spontaneous mutation.4. Example of a virus that can potentially cause cancer.5. A mutation that leads to the formation of a stop codon.6. Describe a specific mutation that would result in a reading frame shift.

Mutagenesis


NEW AIM: How are genes altered and what is the result?

Therefore, mutagenesis means to “Produce a mutation” or to produce any change in the DNA sequence of an organism.

Muta- = mutation = any change in the sequence of DNA-genesis = origin or production of

What causes mutations?


AIM: How are genes altered and what is the result?

Spontaneous vs

Induced Mutations



Spontaneous mutations

1. Copying errors by DNA polymerase during cell cycle or meiosis2. Errors in DNA repair

3. Errors in recombination (crossing over)



- Those that occur as a result of natural cell processes like:

Induced mutations 1. Mutations caused by the

interactions of DNA with an an outside agent or mutagen

a.High energy radiation

b. chemical

c. virus



Mutagens can be:

-electromagnetic -gamma rays, X-rays, UV rays

-Nuclear radiation-Ex. Alpha particles

Carcinogen



**Therefore, almost all mutagens are also carcinogens since mutagens cause mutations, which can potentially cause cancer.

- Prefix carcino- = cancerEx. Carcinoma – cancer starting from epithelial cells

Recall: How does cancer arise?Cancer results from mutations in specific genes that are involved in controlling the cell cycle (G1 checkpoints).

- A carcinogen is a cancer causing agent

1. High energy radiationA. Mutagens (carcinogens)



a. 80 % from natural sources (called background radiation)- UV light from the sun causing thymine dimers, etc…- gamma rays from outside Earth (ex. Distant supernova)- Soil and certain rocks in the Earth’s crust contain radioactive radon gas

Induced mutations

This can be problematic in the basements of homes as the radon gas seeps into the basement and is inhaled by the occupants. Living on Long Island, we rarely have this problem as the island was deposited by a glacier.

Electromagneticradiation(light; photons)

Nuclear Radiation(unstable ratio ofProtons to neutrons)

1. High energy radiation



-color TV, smoke detectors, computer monitors, X-ray machines, nuclear plants, etc…

b. 20% from man-made sources

A. Mutagens (carcinogens)Induced mutations

1. High energy radiation






A. Industrial chemicals

Ex. Acrylamide

2. ChemicalsA. Mutagens (carcinogens)

Induced mutations

-used to make plastics, but…-occurs in many cooked starchy foods. -discovered in starchy foods, such as potato chips, French fries and bread that had been heated.



B. Pollutants 2. Chemicals

Ex. Cigarette Smoke




AcetaldehydeAcetamideAcrylamideAcrylonitrile2-Amino-3,4-dimethyl-3H-imidazo[4,5-f]quinoline (MeIQ)3-Amino-1,4-dimethyl-5H-pyrido [4,3-b]indole (Trp-P-1)2-Amino-l-methyl-6-phenyl-1H-imidazo [4,5-b]pyridine (PhlP)2-Amino-6-methyldipyrido[1,2-a:3',2'-d]imidazole (Glu-P-1)3-Amino-l-methyl-5H-pyrido {4,3-b]indole (Trp-P-22-Amino-3-methyl-9H-pyrido[2,3-b]indole (MeAaC)2-Amino-9H-pyrido[2,3-b]indole (AaC)4-Aminobiphenyl2-Aminodipyrido[1,2-a:3',2'-d]imidazole (Glu-P-2)0-AnisidineArsenicBenz[a]anthraceneBenzeneBenzo[a]pyreneBenzo[b]fluorantheneBenzo[j]fluorantheneBenzo[k]fluorantheneBenzo[b]furanBeryllium1,3-Butadiene

CadmiumCatechol (1,2-benzenediol)p-ChloroanilineChloroformCobaltp,p'-DDTDibenz[a,h]acridineDibenz[a,j]acridineDibenz(a,h)anthracene7H-Dibenzo[c,g]carbazoleDibenzo(a,e)pyreneDibenzo(a,i)pyreneDibenzo(a,h)pyreneDibenzo(a,i)pyreneDibenzo(a,l)pyrene3,4-Dihydroxycinnamic acid (caffeic acid)EthylbenzeneEthylene oxideFormaldehydeFuranGlycidolHeptachlorHydrazineIndeno[1,2,3-cd]pyrene

IQ 92-Amino-3-methyl-3H-imidazo[4,5-f]quinoline)IsopreneLead5-Methyl-chrysene2-NaphthylamineNitrobenzeneNitrogen mustardNitromethane2-NitropropaneN-Nitrosodi-n-butylamine (NDBA)N-Nitrosodi-n-propylamine (NDPA)N-Nitrosodiethanolamine (NDELA)N-Nitrosodiethylamine (DEN)N-Nitrosodimethylamine (DMN)N-Nitrosoethylmethylamine (NEMA, MEN)4-(N-Nitrosomethylamino)-1-(3-pyridinyl)-1-butanone (NNK)N'-Nitrosonornicotine (NNN)N-Nitrosopiperidine (NPIP, NPP)N-Nitrosopyrrolidine (NPYR, NPY)Polonium-210 (Radon 222)Propylene oxideSafroleStyreneTetrachloroethyleneo-Toluidine (2-methylaniline)

TrichloroethyleneUrethane (carbamic acid, ethyl ester)Vinyl acetateVinyl chloride4-Vinylcyclohexene2,6-Xylidine (2,6-dimethylaniline)

A List of known carcinogens in cigarette smoke

Benzo[a]pyrene DNA adduct



Benzo[a]pyrene

This is what happens to the DNA in your lungs when you suck in benzo[a]pyrene. Then when the cell divides and DNA polymerase tries to copy this DNA, a random base will be inserted causing a mutation.



i. Acesulfame K

ii. Artificial coloring (blue-1, blue-2, red-3, yellow-6)iii. BHA and BHTiv. Nitrite and Nitratev. Olestravi. Potassium Bromate

D. Food Additives

2. Chemicals




5. Certain drugs

6. Viruses (Oncoviruses)

a. HPV (Human Papilloma Virus)b. EBV (Epstein Barr Virus)c. Hepatitis C virus

Ex. Chemotherapy drugs


Types of Mutations that can occur.



Fig. 10.16A


AIM: How are genes altered and what is the result?1. Point (substitution) mutations:

Missense point mutation (amino acid changes to a different amino acid)

Nonsense point mutation(amino acid codon changes to a stop codon)

Silent point mutation (amino acid remains same)

Wild type

A U G A A G U U U G G C U A AmRNA

5Protein Met Lys Phe Gly

Stop

Carboxyl endAmino end

3

A U G A A G U U U G G U U A A

Met Lys Phe Gly

Base-pair substitution

No effect on amino acid sequenceU instead of C

Stop

A U G A A G U U U A G U U A A

Met Lys Phe Ser Stop

A U G U A G U U U G G C U A A

MetStop

Missense A instead of G

NonsenseU instead of A

Fig. 10.16A



Sickle cell anemia is caused by a point mutation in the hemoglobin gene creating the sickle cell allele.

1. Point (substitution) mutations:

Fig. 10.16B



Reading Frames

-All mRNAs have three possible reading frames as shown above.-The actual reading frame is determined by the promoter and start codon of the mRNA.- A mutation can cause a change in the reading frame…see previous slide.


AIM: How are genes altered and what is the result?2. Insertions and deletions

mRNA

Protein

Wild type

A U G A A G U U U G G C U A A5

Met Lys Phe Gly

Amino end Carboxyl end

Stop

Base-pair insertion or deletion

Frameshift causing immediate nonsense

A U G U A A G U U U G G C U A

A U G A A G U U G G C U A A

A U G U U U G G C U A A

MetStop

U

Met Lys Leu Ala

Met Phe GlyStop

MissingA A G

Missing

Extra U

Frameshift causing extensive missense

Insertion or deletion of 3 nucleotides:no frameshift but extra or missing amino acid

3

Inserting/deleting nucleotides can shift the reading frame (every codon from the insertion/deletion onward will change) changing every amino acid and possible create a stop codon (very severe mutation)…

Deleting or inserting triplets IN FRAME (no frame shift results) will simply remove or add amino acids to the polypeptide (not as severe a mutation as one that causes a frame shift obviously).



Cause of Tay Sach’s



Types of Mutations1. Point mutants or substitutions

2. Deletion3. Insertion4. Duplication5. Inversion6. Translocation

Somatic

Germline mutationsvs



Somatic mutations



Mutations occurring in body cells that can lead to cancer, but are not heritable (can be passed to offspring).Cancer is NOT heritable, but the predisposition to get cancer IS!

Ex. You can inherit mutations in genes that code for DNA repair proteins causing these proteins not to work. Therefore, when you get mutations in life, you are not able to fix them as well as someone without the mutations and you are more likely to get cancer sooner…

-The famous case are the BRCA1 and BRCA2 alleles which code for DNA repair enzymes. (BRCA = breast cancer) Women with either of these mutated alleles are more likely to get breast cancer.

Is cancer itself heritable?

Germline mutations



Germline cells

Mutations that occur in these cells can be inherited by the offspring. These are the critical ones in terms of evolution.

How are these mutations different?

- gametes and the cells that will become gametes after meiosis.

Are mutations positive Negative for the organism

or?



The majority of mutations tend to be negative (~70% of the time), the remainder are typically neutral (no effect) and in rare cases beneficial.

Positive/Negative/Neutral- If it is a somatic mutation and causes cancer then obviously it is negative (reduces one’s ability to survive/reproduce).



Somatic cells – negative mutations:

- Random mutations (second law of thermodynamics) in your 1 trillion somatic cells accumulate over time causing proteins to most likely function less efficiently. This can lead to further mutations as well as the characteristics of aging.

Positive/Negative/Neutral



Can a somatic mutation cause a disease like Huntington’s?No, because the mutation happens in only one

cell and is not inherited. It would need to be in all cells and that is highly unlikely to ever happen…

Can a person with Huntington’s get mutations such that the diseased allele is mutated back to the normal allele and be cured?Is it possible?…I guess it is, but every cell

affected by the mutation (tens of millions) would all need to mutate back to the normal allele…I don’t think so…

Somatic cells – negative mutations:



A good number of mutations are neutral – they have no effect on the organism like the silent mutation or mutations in “junk” DNA or mutations that change amino acids that do not change the function of the protein…

Somatic cells – neutral mutations:




It is rare to observe a positive mutation in a somatic cell since it is only one cell out of 1 trillion. You will likely never see it.

Somatic cells – positive mutations:

However, cancerous cells, which are your somatic cells gone rogue, can have positive mutations allowing them to move more easily and divide more readily. Although this is not positive for the organism, it is temporarily positive for the cancer cells in terms of reproduction…




1. The mutation is Negative if the offspring has a reduced ability to survive and reproduce in the current environment.

Ex. Mutation that generated the Huntington’s disease allele, mutations in DNA repair genes that predispose the individual to cancer (BRCA-1 allele), or perhaps a mutation that reduced the efficiency of ATP production…

Germline cells – negative mutations:

A. Why do I say “current environment”?

i. Because a mutation can be negative in one environment, but positive in another like the sickle cell allele (negative in US, but positive in Africa).




Neutral mutations, similar to somatic neutral mutations, have no positive or negative effect on the organism that is obvious.

Germline cells:

Ex. Silent Mutations, mutations in “junk” DNA, mutation that changes your fingerprint, etc…




Positive if the offspring has a ENHANCED ability to survive/reproduce in the current environment.

Germline cells – positive mutations:

Ex. Mutation in hemoglobin resulting in the sickle cell allele in Africa, mutation that resulting in the generation of the blue eye allele in northern Europe (advantage may be better vision in the lower light conditions), mutation that generated the allele in certain humans that confers resistance to HIV…


What do all these germline mutations have in common whether positive or negative?



Mutations Randomly Create New Alleles

Without mutation, there would be no new alleles, organisms would never change (no evolution!). Why would this not be good?Because the environment changes over time, and if organisms cannot change to keep up with it there will be no organisms.



Mutations are the Creative Force behind evolution!! The creative force behind evolution is mutation!!Creative Force behind evolution = mutation. Mutation = Creative Force behind evolution



Mutations are the Creative Force behind evolution!!

Nature is a selective force, an allele “filter” only letting some of these randomly generated alleles survive and make it to the next generation!

Mutations can be a tool for scientists…



Ex. You have determined the structure of an enzyme and you now want to know which amino acids are important for catalyzing the reaction. How could you determine this?1. Mutate the gene to change the amino acid to glycine, which doesn’t have a side chain.2. Test the enzyme.

3. If it still works then the side chain is not important. If it doesn’t work, the side chain is important…

chapter 17 - from gene to protein

Documents

dna gene sequence

genetic information

segment of dna

genetic design information

parents dna sequence

proteinnew aim

molecular biology cell

language nucleic acid