chapter 2 - sling components · *safety factor 4:1 2:22 all dimensions in mm offshore components. 2...
TRANSCRIPT
2:22 All dimensions in mm*Safety factor 4:1
Offshore Components
2
2:23 All dimensions in mm*Safety factor 4:1 2:22:22:22:22:22:22:22:22:22:22:22:22:22:22:22:22:22:22:22:22:2333333333333333333333333333 AllAllAllAllAllAllAll di di di di di di di di dimenmenmenmenmenmenmenmenmenmensiosiosiosiosiosiosiosiosiosiosiosiosiosiosiosions ns ns ns ns ns ns ns in in in in in in in in in in mmmmmmmmmmmm*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Sa*Safetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfetfety fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy fy factactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactactor or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or or 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4: 4:1111111111111111111111
Innovation and Quality With a PurposeWe have developed products to meet the stringent requirements of the offshore oil & gas industry for many years. The working conditions are tough and products have to be able to sustain extreme conditions. Our double latch hook, BKD, was developed with the aerospace industry as a role model; if one system fails another one is ready to save the situation. The extra latch on the BKD will retain the load in case an unintended opening of the first latch should occur. Read more about the BKD on page 7.
Our lifting systems have been valued for their long durability and quality. Regardless of the environmental conditions, our systems have provided lifting operations with high safety. Our quality systems give us the tools to work with continuous improvements and we will always put our great efforts into our mission to create the best available in the market. Our quality is there with a purpose
DNV 2.7-1 certificate We are type-approved by DNV to manufacture master links and shackles in accordance with DNV 2.7.1 specification. The approval verifies that Gunnebo Lifting has a high consistent level of production stability in the entire process, from raw material to the finished product.
2:24 All dimensions in mm*Safety factor 4:1
Master Link M Offshore DNV 2.7-1 Type Approved
D
L
E
lde
Master Link with Sublinks, MT DNV 2.7-1 Type Approved Designed for use with chain or wire rope. For 3- and 4-leg slings.
Safety Hook BK Offshore Requirements acc. to DNV 2.7-1�
Container Lifting OperationsWhen lifting offshore containers, the lifting sets (chain- or wire sling and shackles and master links) must be especially designed for use on them. One of the main differences compared to an onshore standard or specification for lifting gear is that it allows for the dynamic forces at sea, by adding an extra enhancement factor to increase the level of safety. Another difference is that the requirements and testing of materials that will be used in cold environments, are generally more extensive.
Our specific product range designed for offshore lifting, including master links, shackles and hooks. These are type approved by DNV to fulfil the requirements of DNV Standard of Certification 2.7-1.
Art. no. CodeWLL
tonnes*L E D
Weight kg
Z101222 M-1310-10 OS 7.8 160 95 22 1.5
Z101224 M-281-10 OS 10.6 270 140 28 3.8
Z101225 M-19-10 OS 11.9 200 120 30 3.5
Z101226 M-321-10 OS 14.1 270 140 32 5.0
Z101227 M-381-10 OS 20.9 270 140 40 7.5
Z101228 M-32-10 OS 33 300 180 45 11.7
Z101234 M-3226-10 OS 44 300 200 50 14.8
Z101236 M-3632-10 OS 55 350 200 55 20.7
Art. no. CodeWLL
tonnes*L1 L E D l e d
Weight kg
Z101229 MT-9-10 OS 7.8 340 190 110 28 150 90 19 4.3
Z101230 MT-281-10 OS 10.6 430 270 140 28 160 95 22 6.8
Z101231 MT-321-10 OS 14.1 460 270 140 32 190 110 28 10.6
Z101232 MT-381-10 OS 20.9 470 270 140 40 200 120 32 16.4
Z101237 MT-20-10 OS 33 540 300 200 55 250 150 40 33.0
Art. no. CodeWLL
tonnes 4:1
WLLtonnes
5:1L B E F G H
Weight kgs
Z101355 BK-26-10 OS 27 21.8 342 100 80 25 50 68 14.6
Z101364 BK-32-8 OS 32.8 26.2 400 120 90 30 62 86 23.6
2
2:25 All dimensions in mm*Safety factor 4:1
Offshore
Swivel Safety Hook BKLK Offshore Requirements acc. to DNV 2.7-1
Can be supplied with double latch
Safety Hook BKD The double latch BK-hook with recessed trigger.
Due to the motion of the sea when loading and unloading offshore, direct impact on the hook could cause the latch to unintentionally open when not being under load, risking the load to unhitch. The double latch safety hook has an extra latch retaining the load in this case, keeping both load and personnel safe.
Double LatchShould the hook latch accidentally open, either through direct impact or excessive wear on the trigger, the extra latch is there to retain the load safely. The latch does not cause inconvenience for the operator and may save their lives if something goes wrong
Recessed TriggerTo avoid the trigger from being hit or damaged it has been recessed into the hook. This prevents the latch further from accidentally opening.
All BK-type hooks can be supplied with double latch
Arctic Shackle No 856 ROV Shackle No 860Super Shackle No 858Standard Shackle No 855
See our offshore shackles in Chapter 3
Art. no. CodeWLL
tonnes 4:1
WLLtonnes
5:1L B C E A G H
Weight kgs
Z700928 BKLK-13-8 W OS 5.4 4.3 307 55 72 61 25 30 40 4.7
Z100174 BKLK-16-10 W OS 10 8 366 62 88 82 26 37 50 7.4
RS1422 BKLK-18/20-8 OS 12.5 10 368 73 60 72 31 44 65 12.3
Z101294 BKLK-22-10 OS 20 12 436 79 80 80 35 50 62 16.8
Z101295 BKLK-26-10 OS 27 21.6 468 100 110 102 35 54 68 22.8
Z101344 BKLK-32-8 OS 32.8 26.2 533 120 110 102 45 62 86 32.3
Art. no. CodeWLL
tonnes*A L B E F G H
Weight kgs
Z101154 BKD-13-10 6.7 20 207 44 45 16 30 40 3.2
Z101155 BKD-16-10 10 26 254 48 56 20 37 50 5.8
Z101156 BKD-18/20-10 16 30 290 52 60 22 44 62 9.1
Z101373 BKD-26-10 OS 27 35 345 72 80 25 54 69 14.5