CHAPTER 4 RESULTS AND DISCUSSION

The white root rot caused by the fungus Rosellinia necatrix Prill. (anamorph: Demathophora

necatrix Hartig), is destructive to many fruit tree species including almond, peach, plum, apple,

pear, olive, cherry and avocado (Schena et al., 2002). A list of 437 reports of fungus–host

combinations with specific references are available at http://nt.ars-

grin.gov/fungaldatabases/index.cfm, many of which are of economic interest. These include

tropical (avocado, coffee, citrus and mango) and temperate (almond, apple, fig, kiwi, grape,

olive, pear, peach, persimmon, sweet cherry and tea) fruit trees, nut tree crops (chestnut,

pistachio and walnut), small fruits, such as the strawberry, narrow leaf (cedar, fir, pine, sequoia

and yew) and wide leaf (holly, oak, poplar and elm) forest trees, herbaceous (daffodil and

paeony) and woody (azalea, camellia and rose) ornamental plants and field crops (alfalfa and

potato) (Pliego et al., 2012).

Reports on the isolation and identification from apple orchards of Himachal Pradesh were scanty

and scattered. Only very few reports were identified (Agarwala and Sharma, 1966; Gupta, V.K.,

1977; Gupta, V.K., and S.K. Gupta, 1995; Gupta, V.K., P.K.Gupta and S.K. Gupta,1995, Gupta

and Sharma 1999). Therefore the present investigation were planned to isolate and identify R.

necatrix causing white root rot disease on Apple in various regions of Himachal Pradesh and the

current scenario of R. necatrix in Himachal Pradesh. We also intend to identify the genes

responsible for pathogenicity of R. necatrix on apple.

4.1 Sample collection

As apple is commercially cultivated as a cash crop in north-western Himalayan states of Jammu

and Kashmir, Himachal Pradesh, Uttaranchal, and northeastern states comprising Sikkim,

Arunachal Pradesh, Meghalaya, Manipur, Nagaland and Assam, we selected the apple crop for

the isolation of this devastating fungus.

The samples for the isolation of R. necatrix were collected from the orchards of three different

apple growing regions of Himachal Pradesh, including

• Kullu (Seobag, Meha, Raghunathpur)

• Shimla (Chaupal)

• KotKhai (Chundi)

The samples were collected in the peak season of infection i.e. during the month of June and

July. The infection was not very prevalent in the entire orchard, but was restricted to few zones.

The infection was intense in the region of Chundi (Shimla District) and Kullu (Kullu District) as

shown in the figure 4.1(c,d). However, leaf defoliation was observed in the trees at Chaupal

region of Shimla District (Fig. 4.1 b).

Fig 4.1: a.Healthy Apple tree in the apple orchard b. Tree showing necrosis and

defoliation of leaves in Chaupal (Shimla) c. Infected Tree at Chundi

(Kotkhai) d. Infected trees at Kullu Valley.

(a) Healthy Apple Tree

(b)Tree showing necrosis and

defoliation of of leaves at Chaupal

(c) Infected Tree at Chundi (d) Infected trees at Kullu

Kullu

The infected root samples were collected from apple orchards. The infected samples exhibited

the characteristic cottony growth of pathogenic fungus. These samples were then brought to the

lab for further processing. Figure 4.2 depicts the infected apple roots obtained from different

regions of Himachal Pradesh.

Fig 4.2: Infected Apple roots showing white powdery substance on the bark

impling the presence of white root rot disease on them, a,b : roots

obtained from orchards in Kullu Valley, c,d: Roots obtained from

Chaupal (Shimla), e,f : Roots obtained from orchards in Chundi

(Kotkhai).

4.2 Isolation and confirmation of the isolates on the basis of morphology

Rosellinia necatrix was successfully isolated from infected apple roots as per the protocol given

in the section 3.1.2. The infected root pieces were further processed by placing on PDA plates.

These plates were then incubated at 25°C for 3-4 days. This resulted in development of white

and cottony fungal mycelium on the culture plates (Fig 4.3a). Further incubation for another 15-

20 days changed the white fungal mycelium to brown-blackish in colour (Fig 4.3 b).

Various different methods are available for the isolation of this fungus. According to Promputha

et al., (2005) isolation of endophytic fungi could be done by using leaf and twig samples for

a b

..

c

.

d

e f

Magnolia liliifera. However, Lee et al., (2003) collected samples of diseased roots (1.5-5.0cm

diameter, 5-30 cm long) and successfully isolated R. necatrix from Japanese pear and

Chloranthus glaber in Chiba and from Japanese pear and grapevine in Hiroshima. Similarly

Ikeda et al., 2005 have collected R. necatrix isolates from diseased roots and from soil by baiting

methods with bunches of mulberry twigs.

The developed fungal mycelium was then subjected to microscopic examination. These isolated

mycelia samples exhibited pear shaped swelling (Fig.4.4.b) which is a characteristic feature of R.

necatrix. Khan (1959) and Makambila (1978) have reported that the optimum incubation

temperature for R. necatrix is 25°C. They had also observed that in the initial incubation period

white and cottony growth of mycelium was obtained which subsequently turned to brownish

black on prolonged incubation. Microscopic observation of the pear-shaped swelling near the

septum has been previously used as a characteristic identifying feature of R. necatrix (Lee et al.,

2005, Ikeda et al., 2005).

Fig 4.3: Growth of Rosellinia necatrix on potato dextrose agar. a). Young white

and cottony mycelium of R. necatrix after 10 days of growth b). Old and

pigmented mycelium of R. necatrix after incubation of 30 days at room

temperature.

Further confirmation of the isolated samples was performed by comparing the isolated samples

with the standard strain of R. necatrix which was obtained from IARI. The standard was grown

a. b.

and maintained on PDA plates. All these investigations based on morphological and microscopic

features eventually led to authentication that the isolated fungus was R. necatrix.

Fig 4.4: a A representative picture of isolates from the apple roots obtained from

different regions of Himachal Pradesh showing the morphological

similarity with the standard isolate of R. necatrix. b. The microscopic

observation of the pyriform swelling in the collected sample.

4.3 Confirmation of the isolates by PCR based methods

Samples which were showing the morphological similarity with that of the standard were further

confirmed by PCR based methods using two set of primers specific for ITS region of R. necatrix.

The DNA of R. necatrix was isolated by the method of Choi et al., (1992). Two sets of primers

were used i.e. UPR2 and DNR8 and UPR1 and DNR7 which corresponds to ITS region of R.

necatrix. Among these two sets of primers only one set showed reproducible amplification with

standard i.e. UPR2 and DNR8.

PCR amplification using UPR2 and DNR8 primer set resulted in desired amplification of 500bp

in standard strain as well as isolated strain (Fig. 4.5 b). Amplified fragment was then excised

from the gel and digested with Bam HI . The digested amplified fragment was then ligated to

a. b.

Bam HI predigested vector pUC19 and transformed to competent E.coli GM 2163 cells. Colony

PCR was performed to confirm the bacterial colony containing the cloned fragment.

Fig 4.5: Figure showing a. isolated DNA samples of standard strain of R.

necatrix (Lane 3) and isolated samples from Kullu valley (Lane 1 and

2), Lane 4. b. PCR amplification of ITS region of R. necatrix. Lane 1:

Standard DNA Marker; Lane 2: Buffer Control; Lane 3: Fusarium

DNA as negative control; Lane 4: ~ 500 bp amplification from R.

necatrix standard strain; Lane 5: ~ 500 bp amplification from isolated

R. necatrix strain from Kullu valley.

The isolation of DNA from endophytic fungi, from leaf and twigs samples of Magnolia liliifera

has been performed by Jeewon et al., (2003) and Lacop et al., (2003). Rapid identification and

detection is necessary in order to prevent further propagation of disease. The polymerase chain

reaction (PCR) provides a reliable alternative for the identification and detection of fungal

pathogens. Internal transcribed spacer (ITS1 and ITS2) regions within ribosomal gene clusters

have been widely utilized in designing species-specific PCR primers (White et al., 1990). Several

PCR based methods like Real-time PCR have been extensively used for the diagnosis of viral

and bacterial infections (Machida et al., 2000; Reischl et al., 2000) and there is an increasing

trend in the application of PCR based methods in plant pathology (Ippolito et al., 2000; Weller et

al., 2000; Bates et al., 2001; Cullen et al., 2001; Schena et al., 2002). Several attempts have been

made to generate amplification systems in which the amplicon detection was based on

fluorescence resonance energy transfer (FRET) such as Taq-Man (Lee et al., 1993) and

Molecular Beacons (Tyagi and Kramer, 1996). Scorpion-PCR (Whitecombe et al., 1999) has

1 2 3 4 5 6 7 8 9

a.

.

b.

500b

p

75bp

been used to detect antagonistic (Schena et al., 2002) or pathogenic fungi (Ippolito et al., 2000)

and viruses (Finetti et al., 2000). A number of specific and sensitive PCR-based methods have

been employed for detection of R. necatrix. In this context the most commonly used primer pairs

are R10-R7 and R2-R8 which were specific for R. necatrix. These two set of primers were

reported to be very specific to carry out the amplification with Rosellinia infected tissues from a

large number of isolates from different hosts and geographic areas but not from other fungal

species. Similarly in our case also, we have observed that excellent and reproducible

amplification was obtained using primer R2 and R8. The sensitivity was improved to 10fgµl/1

(conventional PCR) and 1fgµl/1 (Scorpion- PCR) in the nested-PCR, thus enabling the detection

of R. necatrix in artificially inoculated soils. On the basis of these results, it appears that these

primers could be used to detect R. necatrix in naturally infected soils and/or plant tissues (Schena

et al., 2002).

4.4 Sequencing

As reported in the previous section that plasmid was isolated from a transformed colony which

showed around 500bp amplification in colony PCR using UPR2 and DNR8 primer set. Purified

plasmid was sent for sequencing to Europhins, where the sequencing was performed using

forward (M13 F) and reverse (M 13 R) primers. This experiment was performed thrice and the

three consensus were combined and best is represented here. The sequence thus obtained was

corrected and 484bp sequence corresponding to ITS region of R. necatrix was obtained (Fig.

4.6). The sequence was then analysed in BLASTn to identify the homologous sequences. It was

observed that the sequence showed 99% similarity with ITS region of various R. necatrix isolates

reported from different parts of the world. Alignment with first Blast hit was a Japanese isolate

of R. necatrix was shown in the figure 4.7. Similarly all the R. necatrix isolates were confirmed

as R. necatrix.

TTTGGTATAGGGGGGGGGTGTTTTACGGCAGGGGACCGGCACAACCA

TAGGCGAGATGAGAAATCTACTACGTCTAGAGTGTGTGACCGACTCCG

CCACTGACTTCGAGGGGCTGCAGCAGGCGCTGCAGGCCCCCAACACT

AAGCAACAGGGGCTTAAGGGTTGAAATGACGCTCGAACAGGCATGCC

CACTAGAATACTAATGGGCGCAATGTGCGTTCAAAGATTCGATGATTC

ACTGAATTCTGCAATTCACATTACTTATCGCATTTCGCTGCGTTCTTCA

TCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTAACTTATTTA

GTTATGTGTTCAGAATTCAATGCTAAACAGAGTTTCGTGGGCCGCCGG

CAGGTTGGCCCGCGCCCACCGGGTAGGCCCTAACAGGGTAGGGCACT

TCGGGGTAGGACGCGACCTGCCGAGGCAACGCGTGGTATGTTCACAT

GGGTTTTG

Fig 4.6: Sequence of ITS region of R. necatrix (484 bp) obtained from Europhin

Fig 4.7: BLASTn results revealed that the sequence obtained showed 99%

homology with R. necatrix obtained from IARI.

Table 4.1: Comparison of the similarity profile between standard strain of

R. necatrix and isolated samples

S. No Strain Percentage similarity Closest Match

1 Standard 99% R. necatrix

AB426494.1

2 Shimla (S1) 99% R. necatrix

HG964402.1

3 Shimla (S2) 99% R. necatrix

KF719201.1

4 Kullu (K1) 99% R. necatrix

AB430459.1

4.5 Generation of random mutants of R. necatrix

Protoplasts were prepared from mycelial culture of standard Rosellinia necatrix using restriction

enzyme mediated integration (REMI) method as per Vaillancourt Lab Method (Venard). Sal I

digested plasmid (pCSN 43) was used for protoplast transformation. We have used a

combination of dresilase, chitinase and lysing enzyme for the first time to efficiently generate R.

necatrix protoplasts. As a result 2- 4 x 107

protoplasts were generated. Earlier reports for the

generation of R. necatrix protoplasts used other digesting enzyme like Zymolase 100T 0.4% and

lysing enzyme 1.5% (Kanematsu et al., 2004). The use of chitinase, dresilase and lysing

enzymes in defined concentration is being reported for the first time for efficient protoplast

production using plasmid pCSN43 (Fig. 4.8). A number of colonies developed on the

regeneration medium containing 100µg/ml hygromycin (Fig. 4.9).

Fig 4.8: Figure showing the diagrammatic representation of the plasmid

pCSN43 and the gel image of the isolated plasmid (Lane 2) and

marker (Lane 1).

Fig 4.9: Transformed colonies of R. necatrix appeared after third day of

incubation at 25ºC on regeneration medium containing hygromycin

(100µg/ml)

However, Pliego-Prieto et al., 2007 used osmotic solution 0.6M, enzyme-osmoticum mixture

contained Zymolase 100T 0.4% for protoplast production. The plasmid used was pPK2

containing a Hyg R

gene fused to gfp gene. Roger et al., (2004) also performed the protoplast

1 2

500bp

production using modified version of the protocol developed by Jones et al., (1999). They

harvested mycelia and resuspended (1-2 g) in 10 ml of filter-sterilised lytic mix; OM buffer (1.2

M MgSO4, 10mM Na2PO4, pH 5.8), containing 10mg/ml β-D-glucanase, 1mg/ml chitinase and

20mg/ml cellulase. They used 2µg plasmid pAN 7-1 to 100µl protoplast along with the

restriction endonuclease Hind III. They reported 25% viable protoplast cells. Riggle et al.,

(1998) have used a variety of restriction enzymes (Bam HI, Eco RI or Pst I) for protoplast

generation.

According to Thon et al., (2000) restriction enzyme-mediated insertional mutagenesis REMI-

based mutagenesis approach is an efficient tool to identify novel pathogenicity genes. According

to their report, use of REMI increased transformation efficiency by as much as 27-fold over

transformations with linearized plasmid. Ninety- nine transformants were examined by Southern

analysis, and 51% contained simple integrations consisting of one copy of the vector integrated

at a single site in the genome. All transformants contained a plasmid integration at a unique site.

In light of these reports REMI-based mutagenesis has been adopted for R. necatrix.

Kano et al., (2011) carried out Agrobacterium tumefaciens mediated transformation of plant

pathogenic fungus R. necatrix, the causal agent of white rot root disease. The plasmids used in

this study were pAN 26, pBI121 and p cambia1300. The plasmids pAN26-BI121 and pAN26-

CB1300 contained hygromycin B resistance cassette. The presence of hph gene was detected by

PCR and single copy integrations were demonstrated by Southern Blot analysis.

In addition to REMI various other methods were utilized by different scientific communities

globally for the generation of mutants. Firon et al., (2003) performed transposon mutagenesis in

parasitic fungus Aspergillus fumigatus which causes invasive pulmonary aspergillosis in humans.

In this work an artificial diploid strain of A. fumigatus was constructed. This involved

integration of an engineered impala 160 transposon from Fusarium oxysporum. The diploid A.

fumigatus was subjected to Benomyl induced haploidisation. This resulted in random loss of

chromosomes and as a result two subpopulations of colored haploid conidia were obtained. The

first population designated as ‘A’ contained transposon inactivated allele and the second

population called ‘B’ had the wild type allele. The use of transposable element resulted in

generation of a large population of mutants. A total of 2386 mutants were screened which led to

identification of 20 essential genes in A. fumigatus. A few of these genes were similar to the

ones previously characterized in Saccharomyces cerevisiae.

Seong et al., (2005) performed random insertional mutagenesis in Fusarium graminearum which

is the causal agent of scab in wheat plants. The plasmids used for REMI in this study were

pCB1003 (digested with Bam HI) and pK437 (digested with EcoRI). Screening of 6500

hygromycin resistant transformants was undertaken. Primary screening involved use of corn silk

infection assay which was followed by three additional corn silk infection assays. Finally 11

mutants were isolated. This work helped in concluding that methionine synthesis is an important

virulence factor in F. graminearum.

Talhinhas et al., (2008) investigated the pathogenicity of Colletotrichum acutatum. The fungal

genome was subjected to T-DNA integrations and a total of 156 transformants per 104 conidia

were obtained. Binary vector construction followed by green fluorescence was carried out. High

throughput screening using apple fruit bioassay was done. These experiments yielded high

levels (>70%) of single intergration events.

Wang et al., (2013) transformed Valsa mali isolate LXS240101 using ATMT (Agrobacterium

tumefaciens- mediated transformation) method. The co-cultivation temperature used was 22°C.

They obtained approximately 1000 transformants per 106 conidia. Positive results were obtained

for 30 transformants. T-DNA insertion was confirmed by PCR using hph up and hph down

primers. In comparison with wild type strain six transformants showed abnormal morphology.

In addition 30% of transformants showed reduced growth rates. Approximately 15

transformants showed deviations in pathogenicity i.e. 14 transformants had reduced

pathogenicity while only one transformant exhibited enhanced pathogenicity.

Kanematsu et al., 2004 isolated R. necatrix from roots of Japanese pear in Yamota. They used 50

ml isolated fungal culture for protoplast production and yielded 1 to 3.0 x 107 protoplast with

0.01 to 0.03% regeneration capacity.

Huser et al., (2009) reported Agrobacterium tumefaciens- mediated transformation in

Colletotrichum higginsianum. This fungus is pathogenic on a variety of cruciferous plants. The

susceptible host plants used in this study were Arabidopsis thaliana and Brassica napus biennis.

Fungal transformation was performed using a modified method of Tsugi et al., (2003) and

Takahara et al., (2004). The mutants were subjected to pathogenicity assays and invasive growth

assays. Further DNA extraction and Southern Hybridization was done using DIG-luminescence

detection kit. T-DNA flanking sequences were determined by tail PCR and inverse PCR. A

total of 100 transformants per 106 spores were achieved. 58% transformants showed single copy

T-DNA insertions. Further sequencing led to identification of 14 putative pathogenicity genes

in C. higginsianum.

4.6 Hyphal Tip Culture Preparation

A total of 110 transformants were screened. Amongst them a total of 47 isolates were further

purified by hyphal tip culture on fresh PDA plates containing (100µg/ml) hygromycin. The

plates were incubated for about 1-2 weeks (Fig. 4.10). The glycerol stocks were prepared and

maintained on -80ºC for future use. Periodic subculturing of 47 strains was done on PDA plates

containing 100µg/ml hygromycin. Previous work on similar lines was reported by Kanematsu et

al., 2004 for hyphal tip purification of R. necatrix isolate W370 obtained from the roots of

Japanese pear in Yamato.

Fig. 4.10: Plates showing the purified hyphal tips of the transformed individual

colonies on the PDA plates having hygromycin (100µg/ml).

4.7 Confirmation of mutants by ITS region specific primers and hph gene primers

For the firm confirmation that these 47 strains screened were not any other fungal contaminants

but the mutants generated by REMI; PCR in two different stages were performed. For the

purpose of PCR; the DNA was isolated as per the method of Choi et al., 1992 as explained in the

section 3.2. In the first stage of confirmation PCR with the R. necatrix ITS region specific

primers was performed. All the mutants showed desired amplification (Fig. 4.11). According to

Weld et al., (2006) a wide range of genes have been found to be suitable as selectable marker for

fungi. The hph gene is most commonly used selectable system. Since all the mutants generated

by REMI (restriction enzyme mediated integration) must contain hph gene cassette in them.

Therefore, PCR reaction with the hph gene specific primers was carried out for all the mutants.

Identification and presence of the hph gene insertion in the mutants was thus confirmed after

visualizing the amplification. Desired amplification corresponding to ITS region of R. necatrix of

500bp and hph gene of 450 bp were obtained with all the 47 mutants selected after REMI (Fig

4.11 and Fig. 4.12). The amplifications were compared and confirmed that 33 mutants contained

hpg gene cassette. These 33 mutants produced a desired amplification of ˷450 bp corresponding

to a portion of hph gene (Table 4.1 and 4.2).

500bp

a.

4 3 2 1

Fig. 4.11: Gel image showing amplification with ITS region specific primers with the

mutants generated by REMI, Fig a. is depicting Marker((Lane 1)),-ve Control

(Lane 2), +ve Control(pCSN 43) (Lane 3),Mutant strain no. 20(Lane 4) And Fig b.

is illustrating Marker(Lane 1),-ve Control (Lane 2), -ve Control(Lane 3), Mutant

strain no. 1(11) (Lane 4), 2(2) (Lane 5), 1(5) (Lane 6), 2(12) (Lane 7), 2(6) (Lane

8), 3(III) (Lane 9), 7(III) (Lane 10), 1(10) (Lane 11), 9(III) (Lane 12), 2(3) (Lane 13)

, 2(2) (Lane 14). Gel images showing amplification with hph gene specific primers with the mutants generated by REMI

1 2 3

4 5 6 7 8 9 10 11

12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29

a. b.

c. d.

Fig. 4.12: Gel images showing amplification with hph gene specific primers with the mutants

generated by REMI. In Fig. a Marker (Lane1) is run against amplified plasmid pCSN43

(Lane 2) and amplified R. necatrix (Lane 3) which is control for the mutants generated by

REMI. Fig.b illustration of amplification of mutants with hph gene specific primers with the

mutant strain no. 17(II) (Lane 4), 1(10) (Lane 5), 1(6) (Lane 6), 18(Lane 7), 19(II) (Lane 8),

14(II) (Lane 9). Fig. c. illustration of amplification of mutants with hph gene specific primers

with the mutant strain no.2(6) (Lane 10), 2(12) (Lane 11), 7(III) (Lane 12), 9(III) (Lane 13),

2(7) (Lane 14), 4(III) (Lane 15), 2(9) (Lane 16), 1(3) (Lane 17), 1(8) (Lane 18), 3(2) (Lane 19),

3(5) (Lane 20).Fig d. illustration of amplification of mutants with hph gene specific primers

with the mutant strain no.13(II) (Lane 21),10(II) (Lane 22),8(III) (Lane 23), 5(III) (Lane 24),

11(III) (Lane 25), 3(II) (Lane 26), 12(II) (Lane 27), 20(III) (Lane 28), 2(5) (Lane 29).

1 2 3 4 5 6 7 8 9 10 11 12 13 14

500bp

b.

Table 4.1: Table showing the amplification with ITS region specific primers and

hph gene specific primers.

S.No. Mutants strain no. Amplification with ITS

Amplification with hph

1 Control - Yes

2 1(10) Yes Yes

3 1(2) Yes -

4 1 (6) Yes Yes

5 17 Yes Yes

6 18 Yes Yes

7 19 Yes Yes

8 20 Yes Yes

9 19(II) Yes Yes

10 14 (II) Yes Yes

11 2(6) Yes Yes

12 2(12) Yes Yes

13 7(III) Yes Yes

14 9(III) Yes Yes

15 2(7) Yes Yes

16 7(II) Yes -

17 4(III) Yes Yes

18 2(9) Yes Yes

19 2(3) Yes -

20 1(3) Yes Yes

21 1(8) Yes Yes

22 5(II) Yes -

23 1(11) Yes Yes

Table 4.2: Table showing the amplification with ITS region specific primers and hph

gene specific primers.

S.No. Mutants strain no. Amplification with ITS

Amplification with hph

24 13(II) Yes Yes

25 8(III) Yes Yes

26 5(III) Yes Yes

27 3(II) Yes Yes

28 12 (II) Yes Yes

29 4 (II) Yes -

30 2 (II) Yes -

31 20(III) Yes Yes

32 6 (II) Yes -

33 2(5) Yes Yes

34 1(6) Yes Yes

35 2(2) Yes -

36 2(9) Yes Yes

37 1 (5) Yes -

38 9(II) Yes Yes

39 20(II) Yes -

40 6(III) Yes Yes

41 2(III) Yes Yes

42 4(III) Yes Yes

43 1(III) Yes Yes

44 17(II) Yes -

45 10(II) Yes -

46 18 (1) Yes -

47 11 (III) Yes -

48 2(1) Yes Yes

4.8 Sequencing

In order to further confirm the integrity and identity of products obtained from R. necatrix

mutants with hygromycin gene specific primers. One of the PCR product obtained from mutant

strain 1(10) was gel purified and sent for sequencing. ˷500bp sequence obtained was corrected

and analysed using Blastn tool (Fig. 4.13). Blastn analysis revealed that the obtained sequence

was 99% homologous to the sequence of hygromycin resistance gene reported from several parts

of the world. A representative was shown in the figure 4.14.

GGGGGCTATATCGCGAGCGCGGGTTTTCACTATCGGCGAGTACTTCTACA

CAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGATTTGTGTACGCCC

GACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCGCCC

AAGCTGCATCATCGAAATTGCCGTCAACCAAGCTCTGATAGAGTTGGTCA

AGACCAATGCGGAGCATATACGCCCGGAGCCGCGGCGATCCTGCAAGCTC

CGGATGCCTCCGCTCGAAGTAGCGCGTCTGCTGCTCCATACAAGCCAACC

ACGGCCTCCAGAAGAAGATGTTGGCGACCTCGTATTGGGAATCCCCGAAC

ATCGCCTCGCTCCAGTCAATGACCCTGTTATGCGGCCATTGTCCGTCAGG

ACATTGTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGGGGCA

GTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCTGCGCGACGGACGCAC

TGACGGTGTCGTCCATCACAGTTTGCCAGTGATACACATGGGGATCAGCA

ATCGCGCATATGAAAAATCACGA

Fig. 4.13: The sequence showing the hygromycin insert cassette in mutant strain 1(10).

Fig. 4.14: The BLASTn analysis was performed by using sequence obtained

from Eurofin of mutant 1(10) showing 99% sequence similarity with

one of the plasmid pBSVirHygGW with hygromycin insert.

4.9 Morphological comparison of the mutant strain with the standard strain

Morphological comparison was obtained by growing the mutants and the standard strain of R.

necatrix on the PDA plates as well as plates containing PDA along with 100µg/ml hygromycin

(Fig. 4.15 a. and b.). The standard strain was able to grow on normal PDA plate and could not

grown on the plates containing 100µg/ml hygromycin. Morphological comparison was carried

out to determine whether random insertion created any type of phenotypic variation in the

mutants as compared to wild type.

Fig.4.15: a. PDA plate showing fan like mycelium of R.necatrix b. Plate showing

no growth of the standard strain on PDA + Hygromycin

Similarly all the mutants generated were inoculated in two different conditions and their growth

profile was monitored. Figure 4.16 b,c,d are the representative pictures showing that the mutated

strains were growing in both the conditions with the similar growth profile. Certain variations in

the growth pattern of mutants were recorded in comparison with the standard strain of R.

necatrix.

b. a.

b.a.

c.d.

Fig. 4.16: a. PDA plate showing fan like mycelium of R.necatrix b.,c., d. Mutated

strains showing growth in both plain PDA plate and on plates

containing PDA + Hygromycin

After phenotypic studies it was concluded that there is considerable difference in the morphology

of standard strain of R. necatrix and the mutants thus produced. As a result of the treatment with

the enzyme cocktail and insertion of hygromycin cassette the standard strain had lost its peculiar

feature of fan like growth. It was also observed that there was a huge difference between the

pigments of the mutants and the standard strain. Though the mutants were growing in both the

conditions i.e. they are showing similar growth profile in plain PDA plates as well as the PDA

plates which were having 100µg/ml hygromycin.

Similar results were obtained by Wang et al.,(2013) on Valsa mali a causal agent of apple and

pear tree canker. They successfully transformed the V. mali by ATMT method. They

successfully yielded 1000 transformants. The transformants obtained were analysed by growing

for morphological comparison by incorporating the hygromycin in PDA plates. They also

performed PCR based methods for confirmation of mutants generated by ATMT by using hph

gene primers. hph gene amplified from pBIG3C was used as probe. The hybridization yielded

only single band for 6 transformants.

Park and Lee (2013) proposed a Bidirectional genetic platform (BiG), which combines both

forward and reverse genetics strategies by recycling ectopic transformants derived from TGR as

a source for random insertional mutants. They used M. oryzae as model. In this method also hph

gene cassette was used for producing gene knockouts.

4.10 Southern Hybridization

4.10.1 Quantification of DNA

In order to further confirm the single integration events, southern analysis of all the strains was

done. Therefore DNA of all the 33 strains of the mutants were isolated and spectrophotometrical

analysis was done as per the section 3.12.1 for DNA quantification. The samples were run on an

agarose gel which confirmed the quality of DNA. Figure 4.17 showed the DNA loaded in equal

amount before digestion reaction was proceeded with EcoRI.

Fig.4.17: Gel image showing quantification of the DNA before digestion of selected

mutant strain no. (Lane 1 represents mutant strain no.18, Lane 1 represents

mutant strain no 19, Lane 1 represents mutant strain no. 7(III), Lane 1

represents mutant strain no. 2(12), Lane 1 represents mutant strain no. 2(2),

Lane 1 represents mutant strain no. 1(10), Lane 1 represents mutant strain

no. 14(II), Lane 1 represents mutant strain no. 1(11), Lane 1 represents

mutant strain no.1(8) showing amplification with hph gene specific primers.

4.10.2 Digestion of mutant DNA

The DNA of all the 33 strains were digested with Eco RI in three different consequent

experiments. After overnight incubation at 37ºC followed by subsequent precipitation entire

amount of the DNA was loaded on the gel as already explained in the section 3.12.3. The gel

18 19 7(III) 2(12) 2(2) 1(10) 14(II) 1(11) 1(5)

1 2 3 4 5 6 7 8 9

picture (Fig. 4.18) showed the digested DNA of 14 mutant strains as a representative of digested

DNA.

Fig. 4.18: Gel image showing digested DNA a. Lane 1 represents mutant strain no. 8,

Lane 2 represents mutant strain no. 19, Lane 3 represents mutant strain no. 7(III),

Lane 4 represents mutant strain no. 2(12), Lane 5 represents mutant strain no.

2(2), Lane 6 represents mutant strain no. 1(10), Lane 7 represents mutant strain

no. 14(II), Lane 8 represents mutant strain no. 1(11), Lane 9 represents mutant

strain no. 1(5), Lane 10 represents mutant strain no. 2(3), Lane 11 represents

mutant strain no. 1(8) Lane 12 represents mutant strain no. 7(II) Lane 13

represents mutant strain no. 5(II) Lane 14 represents Marker and Fig. b. Showing

the digested DNA , Lane 1 represents mutant strain no. 7(II) Lane 2 represents

mutant strain no. 4(III), Lane 3 represents mutant strain no. 2(9), Lane 4

represents mutant strain no. 20, Lane 5 represents mutant strain no. 19, Lane 6

represents mutant strain no. 2(7), Lane 7 represents mutant strain no. 19(II), Lane

8 represents control.

1 2 3 4 5 6 7 8 9 10 11 12 13 14

a.

b.

1 2 3 4 5 6 7 8

4.10.3 Transfer of digested DNA to nylon membrane

After successful digestion, DNA in the gel was depurinated, denatured and finally neutralised.

After the treatment the DNA was transferred to nylon membrane (Amersham Pharmacia Biotech,

Buckinghamshire, U.K) by capillary action (Fig 4.19 b.). Successful transfer was finally

observed when the gel was restained after overnight transfer and no DNA bands were seen (Fig

4.19 a.). The DNA was finally crosslinked to the membrane by UV crosslinking and

subsequently used for hybridisation.

4.10.4 Southern Hybridization

A 400 bp fragment was generated as a result of amplification by primer pair hph1 and hph4

from plasmid pCSN 43 was used as probe. About 50µl probe containing ˷1µg of DNA was

used as probe in three subsequent experiments for all 33 strains. All the 33 strains which

exhibited positive amplification by hph1 and hph4 primers were analysed by Southern

Hybridisation to analyse the number of hph cassette integration in the respective strains. This

hybridized DNA was then detected by using Thermo Scientific Biotin Chromogenic Detection

Kit as mentioned in the section 3.14. After stopping the enzymatic reaction the membrane was

washed with Milli-Q water for few seconds. The water was discarded and the membrane was

allowed to air-dry to document the results. Strain number 18, 1(10), 14 (II) are showing multiple

integrations wheresas stains 7(III), 2(2) are showing single integration events. However, rest

strain number 19, 2(12), 1(11),1(5) and 2(3) were not producing any bands (Fig. 4.20a). Fig.

4.20 b. depicts 18(I) has multiple bands, strain number 6(III), 2(3), 7(III) also showed single

bands. No bands were observed for the remaining strands.

a. b.

.

Fig. 4.19: Nylon membrane after southern hybridization with biotin probe Fig a.

Lane 1 represents mutant strain no. 18 , Lane 2 represents mutant strain

no. 19, Lane 3 represents mutant strain no. 7(III) , Lane 4 represents

mutant strain no. 2(12), Lane 5 represents mutant strain no. 2(2) , Lane 6

represents mutant strain no. 1(10), Lane 7 represents mutant strain no.

14(II), Lane 8 represents mutant strain no. 1(11), Lane 9 represents mutant

strain no. 1(5) Lane 10 represents mutant strain no.2(3) , Lane represents

mutant strain no.1(3). Fig b. Lane 1 represents mutant strain no. 1(3),

Lane 2 represents mutant strain no. 1(8), Lane 3 represents mutant strain

no. 20(III) , Lane 4 represents mutant strain no. 2(II), Lane 5 represents

mutant strain no. 5(II), Lane 6 represents mutant strain no. 4 (II), Lane 7

represents mutant strain no. 2(3) , Lane 8 represents mutant strain no.

7(II), Lane 9 represents mutant strain no. 4(III), Lane 10 represents

mutant strain no. 6(III), Lane 11 represents mutant strain no. 18 (I), Lane

12 represents mutant strain no.5(II), Lane 13 represents mutant strain

no.2(III), Lane 14 represents mutant strain no.18(1), Lane 15 represents

mutant strain no.20 (III).

Since the labelling with ThermoScientific Biotin Decalabelled DNA labelling Kit produced

some noise in results even after stripping and rehybridization and the results were not so clear.

In order to obtain more reliable results all the 33 samples were then proceeded with

chemilluminicent method of labelling and detection. The membrane showed single and multiple

bands with good clarity. As shown in Fig. 4.21 strain number 18, 19, 7(III), 2(12), 2(2), 14 (II),

1(11), 1(5), 2(3), 1(10), were having single integration events. In case of strain number 1(6) and

1 2 3 4 5 6 7 8 9 10 11 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

a. b.

7(II) multiple bands were seen and strain number 4(III) was not giving any kind of result in a

form of band. Thus out of 47 samples 20 of them were giving single integration event having an

overall efficiency of 42%.

Fig.4.20: Nylon membrane after southern hybridization with radiolabel probe

Lane 1 represents mutant strain no. 18, Lane 2 represents mutant strain

no. 19 , Lane 3 represents mutant strain no. 7(III) , Lane 4 represents

mutant strain no. 2(12), Lane 5 represents mutant strain no. 2(2), Lane 6

represents mutant strain no. 1(6), Lane 7 represents mutant strain no.

4(III) , Lane 8 represents mutant strain no. 14(II), Lane 9 represents

mutant strain no. 1(11), Lane 10 represents mutant strain no. 1(5), Lane

11 represents mutant strain no. 2(3) , Lane 12 represents mutant strain no.

1(10 ), Lane 13 represents mutant strain no. 7(II). Lane 14 represents

control pCSN43.

Brown et al., (1998) used the technique of restriction enzyme-mediated integration, plasmid

pDBV53 was used for transformation, in the presence of Bam HI enzyme, into strain SGY-243.

The presence of Bam HI stimulated the generation of Ura+ transformants 14 to 18-fold, giving an

average of 230 ± 29 colonies per electroporation. Roger et al., (2004) carried out southern

analysis of randomly selected transformants produced by REMI. Only 8% of the REMI

transformants harbor single copy integration events.

Cia et al., (2013) identified pathogenicity genes in Colletotrichum gloeosporoides. A total of

4128 mutants were generated. Southern Hybridization studies revealed that 60% transformants

had single T-DNA integrations.

1 2 3 4 5 6 7 8 9 10 11 12 13 14

The present investigations revealed 42% single gene integrations among the transformed

colonies which can be considered as excellent transformation efficiency, because R. necatrix

transformation is quite complex and cumbersome and such a transformation efficiency was not

recorded previously.

Table 4.3: Showing single integration in 2(7), 1(11), 2(12), 7(III), 14

(II), 18, 19, 2(2), 1(8), 5(II), 8(III), 2(3),7(II),4 (II), 1(5), 6(II), 1(11), 2(II),

2(2) mutants

S.No. Mutants strain no. Single Integration

Multiple Integration

1 1(10) Yes -

2 1(2) - Yes

3 1 (6) - Yes

4 17 - Yes

5 18 Yes -

6 19 Yes -

7 20 - Yes

8 19(II) - Yes

9 14 (II) Yes -

10 2(6) - Yes

11 2(12) Yes -

12 7(III) Yes -

13 9(III) - Yes

14 2(7) Yes -

15 7(II) Yes -

16 4(III) - Yes

17 2(9) - Yes

18 2(3) Yes -

19 1(3) - Yes

20 1(8) Yes -

21 5(II) Yes -

22 1(11) Yes -

Cont table …….

S.No. Mutants strain no. Single Integration

Multiple Integration

23 13(II) - Yes

24 8(III) Yes -

25 5(III) - Yes

26 3(II) - Yes

27 12 (II) - Yes

28 4 (II) Yes -

29 2 (II) Yes -

30 20(III) Yes Yes

31 6 (II) Yes -

32 2(5) - Yes

33 1(6) - Yes

34 2(2) Yes -

35 2(9) - Yes

36 1 (5) Yes -

37 9(II) - Yes

38 20(II) - -

39 6(III) - Yes

40 2(III) Yes Yes

41 4(III) - Yes

42 1(III) - Yes

43 17(II) - Yes

44 10(II) - Yes

45 18 (1) - Yes

46 11 (III) - -

47 2(1) - Yes

4.11 Pathogenesis assay of mutants on apple seedlings

4.11.1 Planting apple seedlings

After stratification for three months as explained in the section 3.16.1 the seeds were rinsed with

water and observed under hand lens for the sprouting (Fig.4.22). Those seeds showing the

sprouting were sown in presterilised soil, irrigated periodically and kept under observation for

any kind of fungal or bacterial infection during their juvenile stage.

Fig. 4.21: Apple seedlings showing sprouting after three months of

stratification period

To avoid any false conclusion the seedings were allowed to grow for 1 year. During this one year

all the plants were kept in net house conditions to avoid any kind of extraneous inoculation by

natural means. These apple seedlings were then kept in two different environments (Fig 23 a and

b) i.e. natural environment viz net house and another anthropogenic environment i.e. growth

chamber. All these 22 pots in their respective environment were infected with standard (R.

necatrix) and the 9 mutant strains [14(II), 2(12), 7(III), 1(10), 2(2), 1(5), 18, 19, 1(11)] showing

the single gene integration in Southern Hybridization along with a negative control. All the pots

were marked with the respective strain numbers. The inoculation with these strains was

performed on wheat as explained in the section 3.17 (Fig 4.24 and 4.25). Each of the pot was

given the infection with their respective strain number implanted on the pot with apple seedlings.

All the pots were photographed and any kind of symptoms recorded before inoculation. 1-2gms

of inocula was taken and was added to the sterilized soil with the apple seedlings. Periodic

irrigation under constant monitoring was carried out to avoid any kind of false or noisy infection.

Fig4.22: (a) Apple seedlings sown in presterilized soil in anthropogenic conditions

(b) Apple seedlings sown in presterilized soil in natural conditions.

Fig.4.23: Flasks containing sterilised wheat, sand and sucrose before inoculation

a. b.

Fig.4.24: Flasks containing sterilised wheat, sand and sucrose after 15 days of

inoculation

4.11.2 pH of soil in anthropogenic and natural environment

Rosellinia necatrix grows well in vitro at pH 5–8, and can even develop at pH 4 or 9. Under

natural conditions, attack occurs in soils between pH 6 and 8 (Abe and Kono, 1953; Araki, 1967;

Makambila et al., 1976; Anselmi and Giorcelli, 1990; Pe´ rez-Jime´ nez, 1997). Therefore, there

was a need to determine the pH of soil in both of the conditions. Hence the optimum pH was

determined as explained in the section 3.19. The most favorable pH of soil in anthropogenic

environment was found to be pH 8.25 and the pH of the soil in natural environment was 7.96.

This indicated that the soil favored the growth of our host organism as well as the mutants

produced by REMI.

4.11.3 Moisture content of the Soil

According to Anselmi and Giorcelli (1990) under controlled environmental conditions the soil

moisture is the most important factor influencing growth of the fungus. In a sandy-silt soil,

growth was optimal at field capacity (moisture content at 21%) and was insignificant at

maximum water capacity (45% moisture) in anaerobic conditions. In general, the optimum

growth was attained when the soil moisture was in the range of 100% and 70% field capacity and

growth decreases if the soil water content was reduced (Araki, 1967; Mantell and Wheeler,

1973). Therefore, the moisture content was observed in both the conditions. Moisture content of

the soil in anthropogenic conditions was recorded at 19.27% and the moisture content of the soil

in natural conditions was 20.1%. It can therefore be concluded that in both the conditions the

moisture was favorable for the host and mutated fungus.

4.12 Results of pathogenesis assay

4.12.1 Pathogenesis assay of wild type and mutants on apple seedlings in anthropogenic

condition

Plants infected by R. necatrix normally manifest two types of symptoms. According to Guillaumin et al., (1982) there are two types of symptoms of infected apple plants viz symptoms

on the aerial system and symptoms on the root system. We observed symptoms on both aerial

and root system of inoculated seedlings. On the aerial system the tree suddenly declines in

vigour. The leaves wilt and dry although they may remain attached to the tree for months, it

eventually dies. Sparse foliage may be observed, with wilting of leaves, chlorosis and death of

twigs, branches and leaves. These symptoms worsen every year and when moisture and

temperature are favourable the tree eventually dies.

The first symptom, which can be observed on infected root surfaces, is the occurrence of white

cottony mycelium and mycelia strands coloured either white or black. The fungus progresses by

penetrating and rotting the tissue. On woody plants, in its final state, the fungus is located

between the bark and the wood, developing the very typical white mycelial fans, which invade

the whole root system causing a general rotting

Consequently the initial symptoms of aerial part of the apple plants inoculated with control i.e

wild type R. necatrix and all the other nine mutants along with the negative control was

observed. After 15 days of inoculation the first symptom was necrosis of leaves in the pot

inoculated with wild type R. necatrix under anthropogenic conditions was observed. Fig 4.26

showed the healthy apple pots and the pot showing the necrosis in the leaves after a fortnight.

Fig. 4.25: Pathogenesis assay of wild on apple seedlings showing the aerial

symptoms in anthropogenic condition after 15 days of inoculation.

Fig a. Showing the healthy Apple plants before inoculation b.

After 15 days of inoculation pot inoculated with control (R.

necatrix) started showing necrosis in leaves c. A closure view of the

leaves showing necrosis in the control after 15 days

a

.

b

.

a

a

a

c

.

Fig.4.26: Pathogenesis assay of wild on apple seedlings showing characteristic

aerial symptoms in anthropogenic condition after 25 days and one

month respectively.d. After 25 days of inoculation e. A closure view

after 25 days of inoculation f. After 1 month of inoculation complete

death of the plants in the pot inoculated with control was observed

d e

f

All the apple plants were given the infection of their respective strain number as indicated on the

pots prior to the infection on the plants. 1-2 gm of the infected wheat inocula was added to the

respective pots and these were then kept under close observations. The results start appearing

after 15 days of inoculation in the aerial system of plants. The necrosis and blackening (Fig 4.26

b., c. and Fig.4.27 d, e) of leaves was observed in the pot infected with standard strain of

R.necatrix after 15 days of infection. However, complete death of the plants inoculated with wild

type R. necatrix was observed after one month.

4.13 Pathogenesis assay of Mutants on apple seedlings in anthropogenic conditions

Similarly all the plants infected with mutant strains grown in the controlled conditions were

observed. They were observed from the day of inoculation till one month of infection. The 9

mutants were individually photographed and the results were documented and recorded. Out of

the nine different mutant strains only the strain number 14(II) was showing the similar

morphological symptoms as those of plants inoculated with wild type R. necatrix. The leaves

were initially showing some necrosis and eventually three plants out of four were completely

dead as shown in the figure 4.28.

a. Before inoculation b. -ve control

c. M 7(III) e. M 2(2)

f. M1(11) g. M 19

h. M 14 (II) i. M18

j. M 1(5) k. M 1 (10 )

l. M 2 (12)

Fig.4.27: The characteristic aerial syptoms in the healthy apple plants

inoculated with mutant strain as marked on their respect pots. All

the eight pots ( b. pot with negative control, c. Mutant strain no.

7(III), e. Mutant strain no. 2(2) f. M 1(11), g. M 19, h. i. M 18 , M

1(5), M 1(10), M 2(12)) were showing no characteristic aerial

symptoms even after 1 month of inoculation. However strain no M

14 (II), was showing three dead plants.

4.14 Pathogenesis assay of wild type strain of R necatrix on apple seedlings in

anthropogenic condition with symptoms on the root system

Effect of R. necatrix on the root of the infected plants were also observed after one month of

inoculation. It has been observed that the wild type R. necatrix infection to apple leads to

significant reduction in root number and density in comparison to mock inoculated pots. In

addition white fan like mycelium was also observed on roots of the infected plant which confine

the colonisation of roots by R. necatrix. The white powdery mycelia of fungus on roots of one

year old apple plant were visible as shown in Fig 4.29 b and c..

a.) -ve control b.)+ ve control C.) Closer view of +ve control

d.) M 14 (II)

Fig.4.28: a. –ve control showing no sign of infection after one month b. +ve

control of four apple seedlings showing white powdery mycelium

grown on the stem and root system c. a closer view of the affected

root system d. mutant strain number 14 (II) showing no sign of

infection prevailing root systenm though the aerial system was

completely vanished.

4.15 Pathogenesis assay of wild type strain of R. necatrix on apple seedlings in aerial system

under natural conditions

In the case of pathogenesis under natural conditions in net house the plants reproduced the

similar results to the anthropogenic system, but in this pathosystem, it took about 40 days to

reproduce the similar results. As environment was showing the variation in its biotic and abiotic

factors. Although, in this case the necrosis of the leaves started after 25 days in comparison to 15

days under anthropogenic conditions. However, both plants infected by control i.e wild type

strain of R. necatrix died after 40 days of inoculation. Both the plants were showing defoliation

and intense necrosis of aerial system (Fig 4.30).

a. Zero time point after inoculation on healthy plants b. After 25 days of inoculation

c. After 40 days of inoculation d. Closer view

Fig.4.29: a.Zero time point after inoculation of standards strain of R. necatrix on

healthy plants b. After 25 days of inoculation symptoms start

appearing on the leaf c. After 40 days of inoculation the fungus started

prevailing in other stem and leaf part of plant d. Closer view

4.15.1 Pathogenesis assay of R. necatrix mutants on apple seedlings in aerial system under

natural conditions

Similarly the pathogenesis of mutants was also closely observed for approximately 40 days.

None of the plants infected by the mutated strain were showing any kind of infection in their due

course of observation. All of them were as healthy as they were; when they were subjected to the

infection. The strain number 14 (II) in which three plants were dead in the case of anthropogenic

conditions, was healthy under natural condition (Fig 4.31).

a. Zero time point after inoculation b. -ve Control

c. M 18 d. M 7 (III)

e. M 19 f. M 2(2)

g. M 1(10) h.M 1(5)

i. M 1(10) j. M 2 (12)

k. M 14 (II)

Fig.4.30: All the plants infected by their respective mutant strains generated in

this case by REMI i.e. a,b,c,d,e,f,g,h, i, j, k were standing healthy till

the last day of observation.

4.16 Pathogenesis assay of wild and mutants on apple seedlings in root system under

natural conditions

The pathogenesis of apple plant under net house conditions showed the same results as obtained

previously with the anthropogenic system. These results were obtained after 40 days, but leaf

necrosos was visible after 25 days. However, both plants infected by control i.e wild type strain

of R. necatrix died after 40 days of inoculation. After digging out the plant from the pot; the root

system was observed. The roots were showing clear penetration of the fungus into the host plants

before and after washing( Fig 4.32 ). It has been observed that wild type R. necatrix infection to

apple leads to significant reduction in root number and density in comparison to mock inoculated

pots. In addition white fan like mycelium was also observed on the root of the infected plant

which confirms the colonisation of roots by R. necatrix. The mutated fungus under natural

conditions was not able not to produce disease symptoms.

a. -ve controlb. + ve control c. Closer view

Fig.4.31: a. –ve control showing no sign of infection after 40 days of infection b.

+ve control showing complete invasion of the fungus R. necatrix on the

host plant c. closer view of the roots showing the infection on them.

4.17 Identification of tagged gene in mutants deficient in causing infection to apple

seedlings

For the identification of the tagged gene genomic DNA of the mutants which were showing

single integeration event after southern analysis were again isolated as by the method of Choi et

al., 1992 as already explained in the section 3.2. The isolated DNA was then subjected to the

treatment of restriction endonuclease Eco RI (Fig. 4.33). The digested DNA was diluted, ligated

and purified as per section 3.21.1 and 3.21.2.

Digestion of mutant genomic DNA was done by EcoRI enzyme

DNA- 7µl

Buffer-2µl

Enzyme-1µl

Water- 10µl

Incubate overnight at 37 C overnight and then purified the digestion

Digestion and purification of mutant genomic DNA

M 1 (5) 1 (11) 19 1(10) 2(2) 2(12) 18 7 (III) 14 (II)

Fig.4.32: Digestion of mutant genomic DNA was done by EcoRI enzyme

Three different sets of primers were used to perform the amplification as already discussed in

the section 3.21.3. However out of the three only second set of the primer produced the desired

results in the form of amplified band of 2000bp with the strain number 2(12) (Fig 4.34). This

amplified product was then replicated, purified and sent for sequencing to xcelris. But after

sequencing reliable results were not obtained.

M 2(12) 2(12) 2(12) 14(II) 14(II) 14(II)

5000bp

1500bp

500bp

Here two type of PCR conditions were used as follows:

With Normal Taq:

95 C-3 min

95 C- 45 sec

50 C- 45 sec 10 Cycles

72 C- 4 min

95 C- 45 sec

50 C- 45 sec 25 cycles

72 C- 4 min+8 sec auto extension

72 C- 10 min

4 C- 15 min

With Long Taq:

94 C-3 min

94 C- 30 sec 10 cycles

50 C- 30 sec

68 C- 7 min

94 C- 30 sec

50 C- 30 sec 25 cycles

68 C- 7 min+5 sec autoextension

68 C- 10 min

8 C- 10 min

Fig. 4.33: a.Conditions used for inverse PCR with normal Taq DNA polymerase

and long Taq DNA polymerase. Fig.b. Result of PCR amplification of

the DNA segment Taq DNA polymerase.

a. b.

However similar work was carried out by Park and Lee (2013), they generated 100-200

transformants of M. oryzae , they were able to identify the individual etopic transformant sites

by inverse PCR, after southern analysis. Shuster and Connelley (1999), performed PT-REMI

(promoter tagged restriction enzyme mediated insertion) on A. niger and recovered the genomic

sequences flanking the REMI integration by inverse PCR. After analysis, plasmid integration

was demonstrated to have occurred at a site 200bp upstream of an ATG codon. Insertion of the

plasmid resulted in the enhanced expression of the COX5 RNA, demonstrating that the

combination of REMI, with a promoter containing insert can be used to activate gene

transcription.

4.18 To access the ability of a nonpathogenic R. necatrix strain to induce resistance against

pathogenic R. necatrix in apple

White root rot is a devastating disease, its control includes several culture practice methods and

chemical methods like use of fungicides. These methods are labor intensive and have certain

environmental issues. Therefore, biocontrol of this fungus by the phenomenon of induced

resistance was explored.

Resistance is defined as the ability of an organism to overcome the effect of a pathogen. Induced

resistance is the resistance developed in the host plant in response to an appropriate stimulus.

Various factors including biotic and abiotic factors are known to activate induced resistance in

plants.

4.19 Preparation of wheat inoculum

For assessing induced resistance the inocula of standard strain of R. necatrix was prepared on

sterilised wheat containing sand and sucrose as per the section 3.17. After 15 days of inoculation

the inocula was ready for inoculation (Fig. 4.35).

Fig.4.34: Flasks containing wheat , sand and sucrose with inoculum after 15

days of inoculation

4.20 Assay of induced resistance on apple seedlings in anthropogenic conditions

The plants which were previously inoculated with the mutant strains were observed for 3 months

after inoculation with their respective strains. After the completion of three months the plants

which were kept under anthropogenic conditions were photographed and documented (Fig.4.36

a, b,c,d,c,f,g,h) for any type of infectious symptoms on the aerial system.

a. M 1 (5) b. M 1(11)

c. M 19 d. M 1(10)

e. M 2 (2) f. M 2 (12)

g. M 18 h. M 7 (III)

Fig 4.35: a,b,c,d.e.f Healthy apple plants even after three months of infection with

mutant strains

4.21 Assay of induced resistance on apple seedlings in anthropogenic conditions after one

month of infection with the standard strain of R. necatrix

All the plants previously infected by the mutant strains were healthy. Thus, each one of them was

then given the infection of the standard strain of R.necatrix inoculum prepared on the wheat; in

order to assess the phenomenon of induced resistance. Since the previous infection with the

standard strain was observed for one complete month. Therefore, this time also the plants were

kept under close observation for one complete month. A close eye was kept on each of the pot.

After the completion of one month each of the pot inoculated was photographed. The results

were documented and recorded (Fig4.37 a,b,c,d,,e,f,g,h). It was observed that all the pots which

were previously infected by mutated strain of R. necatrix were when given the infecton with that

of the standard strain were standing as healthy as they were before any inoculation. Therefore it

was concluded that the mutants generated by the method of REMI was inducing resistance in the

apple plants against the standard strain of R. necatrix responsible for white root rot disease.

a. M 1 (5) b.M 1(11)

c. M 19 d. M 1(10)

e. M 2 (2) f. M 2 (12)

g. M 18 h. M 7 (III)

Fig 4.36: All the plants a,b, c, d, e, f, g, h were standing healthy after one month

of infection with the standard strain of R.necatrix after previous

infection with the mutant strains generated by REMI clearly indicating

the presence of induced resistance in all the pots.

Santorelli et al., (2013) produced a new social gene in Dictyostelium discoideum, chtB with the

help of REMI. This new gene in D. discoideum, chtB, which when knocked out inhibits the

parental strain from producing spores. To do so, chtB cells inhibit wild type cells from becoming

spores, as indicated by counts and by the wild type cells’ reduced expression of the prespore

gene, cotB.

Similar work was carried out by Bakker et al., (2007). In their work Pseudomonas bacteria were

remained spatially separated from the pathogen that was inoculated on the above ground plant

parts, either into the stem or on the leaf surface. When they used this strategy under commercial

green house conditions, the ISR trggering P. fluorescens strain WCS374 significantly protected

radish from Fusarium wilt, leading to average yield increase of 40%.

Benhamou et al., (2002) has led to the concept that manipulating the rhizosphere in such a way

that beneficial microorganisms with antagonistic or eliciting properties are favoured would

protect roots from the deleterious effect of soil borne pathogens. Their observation provides the

first convincing evidence that Fo47 exerts a direct inhibitory effect on P. ultimum through a

combination of antibiosis and mycoparasitis, in addition to being a strong inducer of plant

defence reactions.

Fuchs et al., (1997) demonstrated that the nonpathogenic strain Fusarium oxysporum Fo47

induce resistance to Fusarium wilt in tomato plant.