chapter 4. techniques of circuit analysis - kntu …wp.kntu.ac.ir/faradji/ec1/ec1_ch4.pdf ·...
TRANSCRIPT
![Page 1: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/1.jpg)
Chapter 4. Techniques of Circuit Analysis
By: FARHAD FARADJI, Ph.D.Assistant Professor,
Electrical Engineering,K.N. Toosi University of Technology
http://wp.kntu.ac.ir/faradji/ElectricCircuits1.htm
Reference: ELECTRIC CIRCUITS, J.W. Nilsson, S.A. Riedel, 10th edition, 2015.
![Page 2: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/2.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 2
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 2
![Page 3: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/3.jpg)
4.1. Terminologyo To discuss the more involved methods of circuit analysis,
we must define a few basic terms.
o Planar circuits can be drawnon a plane with no crossing branches.
o A circuit that is drawn with crossing branches still is considered planar ifit can be redrawn with no crossover branches.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 3
o To discuss the more involved methods of circuit analysis,we must define a few basic terms.
o Planar circuits can be drawnon a plane with no crossingggg bbbbbbbbrrrrrraaaannnncccchhhhhheeeeeesssssss.....
o A circuit that is drawn with crossssiiinnnnnnnggggggggggggg bbbbbbbbbrrrrrraaaaannnncches still is considered planar ifit can be redrawn wwwwwwwiiiiiitttttthhhhhhhhhhh nnnnnnnnnnnoooooooooooo cccccccccccccrrrrrrrrrrooooooooosssssssssssssssooooooovvvvvvvvvvveeeeeeeeeerrrrrrrrr bbbbbbbbbbrrrrrrrraaaaaaaaannnnnnnnccccccccchhhhhhhhhhheeeeeeeeessssssss..
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 3
![Page 4: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/4.jpg)
4.1. Terminologyo Nonplanar circuits cannot be redrawn in such a way that
all the node connections are maintained andno branches overlap.
o The node-voltage method is applicable toboth planar and nonplanar circuits.
o The mesh-current method is limited toplanar circuits.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 4
o Nonplanar circuits cannot be redrawn in such a way thatall the node connections are maintained andno branches overlap.
o The node-voltage method is apppppppppppppllllliiiiiiccccaaaabbbblllleeee tttttttooooooboth planar and nonplanar cccciiiirrrrrrcccccccuuuuuuuiiiiiiittttttttssssss....
o The mesh-current mettthhhhhhhhhhhhooooooooooddddddddddd iiiiiiisssssssssss llllllllliiiiiiimmmmmmmmmmmmmmiiiiiiiitttttttteeeeeeeeeeddddddd tttttttttttoooooooooplanar circccuuuuuuuuuuuuuiiiiiiiitttsssssssssss.....
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 4
![Page 5: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/5.jpg)
4.1. Terminology
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 5Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 5
![Page 6: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/6.jpg)
4.1. Terminology
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 6Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 6
![Page 7: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/7.jpg)
4.1. Terminology
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 7Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 7
![Page 8: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/8.jpg)
4.1. TerminologySimultaneous Equations—How Many?
o The number of unknown currents in a circuit equalsthe number of branches, b,
where the current is not known.
o We must have b independent equationsto solve a circuit with b unknown currents.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 8
Simultaneous Equations—How Many?
o The number of unknown currents inn aa circuit equalsthe number of branches, b,,,,
where the current is not kkkkkkkknnnnnnoooowwwwnnnn....
o We must have b independent eeqqquuuuuaaaaaaaaaattttttttiiiiiioooooooonnnnnssssto solve a circuit wiiittttttthhhhhhh bbbbbbbbbbbb uuuuuuuuuunnnnnnnnnnnkkkkkkkkkkkknnnnnnnnnnnooooooooowwwwwwwwwwnnnnnnn cccccccccccuuuuuuuuuurrrrrrrrrrrrrrrrrrrrrrreeeeeeeeeennnnnnnnntttttttssssssss......
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 8
![Page 9: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/9.jpg)
4.1. TerminologySimultaneous Equations—How Many?
o If n is the number of nodes in the circuit,we can derive n-1 independent equations
by applying KCL to any set of n-1 nodes.
o Application of KCL to the nth nodedoes not generate an independent equation, because
this equation can be derived from the previous n-1 equations.
o Becausewe need b equations to describe a given circuit andwe can obtain n-1 of these equations from KCL,
we must apply KVL to loops or meshesto obtain the remaining b-(n-1) equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 9
Simultaneous Equations—How Many?
o If n is the number of nodes in the cirrcuuit,we can derive n-1 independdddeeeeennnnnnntttttttt eeeeeeqqqqqqquuuuuuaaaaattttions
by applying KCL to any seeeettttttt oooooofffff nnnn---11111 nnnnnnnoooooodes.
o Application of KCL to the nth nooddddeeeedoes not generate aaaannnnnnn iiiiiiiiinnnnnnnnnnnndddddddddddeeeeeeeeeeepppppppppppppeeeeeeeeeeennnnnnnnnddddddddddeeeeeeennnnnnnnnnnttttttttt eeeeeeeeeeeeeqqqqqqqqqqqqquuuuuuuuuuuaaaaaaaaattttttiiiiiioooooooooooonnnnnnnn,,,,,,, bbbbecause
this equuuaaaaaaaaaaaaatttttttttttiioooooooooooonnnnnnnnnn ccccaaaaaaaaaaannnnnnnnnnn bbbbbbbbbbbbbbeeeeeeeeee dddddeeeeeeeeerrrrrrriiiiiiiivvvvvvvvveeeeeeeeeeeeeeeddddddddddd fffffffffrrrrrrrooooooooooommmmmmmmmmmmmm ttttthhhhhhhhhheeeeeeeeeee ppppppppppprrrrrreeeeeeeeeeeevvvvvvvvvviiiiiioooooooooooooouuuuuuuuuuuuusssssssss nnnnnnnnnnnnnn---11111111111 eeeeeqqquations.
o Becausewe need b equationssssssssss ttttttttttttoooooooooooooo dddddddddddddeeeeeeeeeessssssssssccccccccccrrrrrrrrrriiiiiiiibbbbbbbbbbbbbbeeee aaaaaaa gggggggggggggiiiiiiiivvvvvvvvveeeeeeeeeeeennnnnnnnnn cccccccccccciiiiiiiirrrrrrrrrrccccccccuuuit andwe can obtain n-1 of these equations from KCL,
we must apply KVL to loops or meshesto obtain the remaining b-(n-1) equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 9
![Page 10: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/10.jpg)
4.1. TerminologySimultaneous Equations—How Many?
o Thus by countingnodes,meshes, andbranches with unknown currents,
we have establisheda systematic method for
writing the necessary number of equations to solve a circuit.
o We apply:KCL to n-1 nodes andKVL to b-(n-1) loops (or meshes).
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 10
Simultaneous Equations—How Many?
o Thus by countingnodes,meshes, andbranches with unknown currrrrrrreeeeeeennnnnnnttttttsssssss,,,
we have establishhhhhhhheeeeeedddddda syssstttteeeeeeeeeeemmmmmmmmmmmaaaaaaattttiiccccccccc mmmmmmmeeeetttthhhhhhhhhhoooooooodddddddddd ffffooooooooorrrr
wriitttiing ttthhhhhhhheeeeeeeeeee nnnneeeeccccccccceeeeessssssssssaaaaaaaaaaarrrryyyyyyyyyy nnnnnnuuuuuuuuummmmmbbbbeeeeerrrr ooooooooofffffffff eeeeqqqqqqqqqqqqquuuuuuuaaaattttttttttiiiiiiooooonnnss tttto solve a circuit.
o We apply:KCL to n-1 nodes andKVL to b-(n-1) loops (or meshes).
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 10
![Page 11: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/11.jpg)
4.1. TerminologySimultaneous Equations—How Many?
o These observations also are valid in terms ofessential nodes andessential branches.
o Ifne is the number of essential nodes andbe is the number of essential branches with unknown currents,
we can apply:KCL at ne-1 nodes andKVL around be-(ne-1) loops or meshes.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 11
Simultaneous Equations—How Many?
o These observations also are valid in tterrms ofessential nodes andessential branches.
o Ifne is the number offf eeeeeeeessssssssssssssssssssseeeeeeeeeeeennnnnnnnnnnnttttttttttiiiiiiiaaaaaaaaaaaaalllllll nnnnnnnnnnooooddddddddeeeeeeeeeeeesssssssss aaaaaaaaaaaaannnnnnnnnnddddddddddbe is the nnuuuuuummmmmmmmmmmmmmmbbbbbbbbbbbeeeeeeeeeerrr ooooooooooooffffffffff eeeeeeeeeeesssssssssssssssssseeeeeeeeeeennnnnnnnnttttttttttttiiiiiiiaaaaaaaaaalllllllllll bbbbbbbbbbbbrrrrrrrrrrraaaaaaaaaannnnnnnnnnncccccccccccccchhhhhhhhhhheeeeesssssssssss wwwwwwwwwwwwiiiiiiitttttttttthhhhhhhhhhh uuuuuuuuuunnnnnnnnnnnnnnkkkkkkkkkkkknnnnnnnnnoooooooooowwwwwwwwwwwwwwnnnnnnnnnnn cccccuuuurrents,
we can apply:KCL at ne-1 nodes annnnddddddddddddKVL around be-(ne-1) loops or meshes.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 11
![Page 12: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/12.jpg)
4.1. TerminologySimultaneous Equations—How Many?
o The number of essential nodes isless than or equal to the number of nodes.
o The number of essential branches isless than or equal to the number of branches.
o Thus it is often convenientto use essential nodes and essential branches,
because they produce fewer independent equations to solve.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 12
Simultaneous Equations—How Many?
o The number of essential nodes isless than or equal to the nuummmmmmbbbbbbbbeeeeeeerrrrr ooooooofffffff nnnnnoooodes.
o The number of essential branchhhhhhheeeeeessssss iiiissssssless than or equal to the nuummmbbbbbbbbbeeeeeeeeeerrrrrrrr oooooooofffff bbbbrranches.
o Thus it is often convenniieeeeeeeeeeennnnnnnnnnntttttttttttttto use esssseeeeeeennnnnnnnnnnnttttttttttttiiiiiiiiiaaaaaaaaaaalllllll nnnnoooooooooooodddddddddddddeeeeeeeeeeeeeessssssssssss aaaaaaaannnnnnnnnnndddddddddddd eeeeeeeeeeeessssssssssssssssssssssssssssseeeeeeeeeeennnnnnnnnnntttttttttttttiiiiiiiiiiaaaaaaaaaaaaaallllllll bbbbbbbbbbbrrrrrrrrrrrraaaaaaaaaannnnccccccccccccchhhhhhhhhhheeeeeeeeeeesssssssssss,,,,,,,
because they pppppppppprrrrrrrrrrrrroooooooooooooodddddddduuuuuuuccccccceeeeeeeeeeee ffffffffffeeeeeeeeeeeewwwwwwwwwwwwwweeeeeeeerrrr iiiinnnnnnnnnnndddddddddddeeeeeeeeeppppppppppppppeeeeeeeeeeeeennnnnnnnnnnndddddddddeeeeeeeeeeennnnnnnntttttttttttttt eeeeeeeeeeqqqqqqqqqqqqqquuuuuuuations to solve.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 12
![Page 13: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/13.jpg)
4.1. TerminologyThe Systematic Approach
o We write the equations on the basis of essential nodes and branches.
o The circuit has4 essential nodes and6 essential branches, denoted i1 - i6,
for which the current is unknown.
o We derive 3 of 6 simultaneous equationsby applying KCL to any 3 of 4 essential nodes.
o Using nodes b, c, and e:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 13
The Systematic Approach
o We write the equations on the basis off essential nodes and branchheeeesssss...
o The circuit has4 essential nodes and6 essential brancheeesssssssssss,,,,, dddddddddddeeeeeeeeeeeennnnnnnnnnnnooooooooooottttttttttttteeeeeeeeeeeddddddddd iiii111111 --- iiiiiiii666666666,,,,,,,,,,,
for whicccchhhhhhhhhhhhhh ttthhhhhhhhheeeeeeeee ccccccuuuuuuuuuuuuurrrrrrrrrrrrrrrrrrreeeeeeeeeeeeeennnnnnnnnnttttttttttt iiiiisssss uuuuuuuuuunnnnnnnnnnnnnnnkkkkkkkkkknnnnnnnnnnnooooooooowwwwwwwwwwwwwnnnnnnnnnnnn....
o We derive 3 of 6 simuuuuuuuuuulllllllltttttttttttttaaaaaaaannnneeeeeeeoooooooooooouuuuuuuussssssssss eeeeeeeeeeeeeeqqqqqqqqqquuuuaaaaaaaaaatttttttttttiiiiiiiiiooooooooooonnnnnnnnnssssssssssssssby applying KCL to annnnnnnnnyyyyyyyyyyyyy 3333333333333 ooooooooooooffffffffff 44444444444 eeeeeeeeesssssssssssssssssssseeeeeennnnnnntttttttttiiiiiiiiiaaaaaaaaaaaaalllllll nnnnnnnnnnnooooooooooooddddddddddddeeeeeeeeeeeessssssss.
o Using nodes b, c, and e:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 13
![Page 14: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/14.jpg)
4.1. TerminologyThe Systematic Approach
o We derive the remaining 3 equationsby applying KVL around 3 meshes.
o Because the circuit has 4 meshes,we need to dismiss one mesh.
o We choose R7 — I,because we don't know the voltage across I.
o Using the other 3 meshes:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 14
The Systematic Approach
o We derive the remaining 3 equationssby applying KVL around 3 mmmeeeesssssshhhhhhhheeeeeeessssss...
o Because the circuit has 4 mesheeeeeeessssss,,,,we need to dismiss one messhhhh....
o We choose R7 — I,Ibecause wwwweeeeeeeeeeee ddddddddddddooooooooooonnnnnnnnnnnn'''tttt kkkkkkkkkknnnnnnnnnnnoooooooooooooowwwwwwwwwwww tttthhhhhhhhhhheeeeeeeeeee vvvvvvvvvvvvvvoooooooooooooollllllllttttttttttaaaaaaaaagggggggggggggeeeeeeeeeeeeee aaaaaaaaaaaccccccccccrrrrrrrrrrrrooooooooooosssssssssssss IIIIIIIIII....
o Using the other 3 meeeeeeessssssshhhhhhhhhhhheeeeeesssss:::::
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 14
![Page 15: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/15.jpg)
4.1. TerminologyThe Systematic Approach
o By introducing new variables, we can describe a circuit with justn-1 equations orb-(n-1) equations.
o These new variables allow us to obtain a solutionby manipulating fewer equations.
o The new variables are known asnode voltages and mesh currents.
o Node-voltage method enables us to describe a circuit in terms ofne-1 equations.
o Mesh-current method enables us to describe a circuit in terms ofbe-(ne-1) equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 15
The Systematic Approach
o By introducing new variables, we cann ddescribe a circuit with justn-1 equations orb-(n-1) equations.
o These new variables allow us too oooobbbbbbbbtttttttttaaaaaaaaaaiiiiiinnnnnn aaaa ssolutionby manipulating feewwwwwwwwwwweeeeeeeeeerrrrrrrrrrr eeeeeeeeeeeeqqqqqqqqqqqqquuuuuuuuuuuaaaaaaaaaaaaaattttttttiiiiiiioooooooooonnnnssssss......
o The new variaaaabbbbbbbbbbbbbbllllleeeeeeeeeeeeessssssssss aaaaaaaaarrrreeeeeeeeeee kkkkkkkkkknnnnnnnnnnnnnnooooooooooooowwwwwwwwnnnnnnnnnnnn aaaaaaaaaaaaasssssssssnode voltages annnnnnndddddddddddddd mmmmmmmmmmeeeeeeessssssshhhhhhhhhhhhh ccccccccccuuuuuuuuuuuuurrrrrrrrrrrrrrrrrrrrrrreeeeeennnnnnnnnnntttttttsssssssssssss....
o Node-voltage method eeennnnnnnnnnaaaaaaaaaaabbbbbbbbbbbllllllllleeeeeeeesssss uuuuuuuusssssssss ttttttttttttooooo dddddeeeeesssssscccccccccrrrrrrrriiiiibbbbbbbbbeeeeeeeee aaaaaaa cccircuit in terms ofne-1 equations.
o Mesh-current method enables us to describe a circuit in terms ofbe-(ne-1) equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 15
![Page 16: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/16.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 16
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 16
![Page 17: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/17.jpg)
4.2. Introduction to Node-Voltage Methodo We introduce node-voltage method by
using essential nodes of circuit.
o The first step isto make a neat layout of circuit so that
no branches cross over andto mark clearly essential nodes on circuit diagram.
o This circuit hasne = 3 essential nodes.
o We need2 or (ne-1) node-voltage equations
to describe the circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 17
o We introduce node-voltage method byusing essential nodes of circuit.
o The first step isto make a neat layout of cirrrcccccccuuuuuuiiiiiitttt ssssoooo ttttthhhhhhhaaaaaaatttt
no branches cross over aannnnddddddto mark clearly esseeeeeennnnntttttttttiiiaaaalll nnnnnooooooooooddddeeeesssssss ooooooonnnnn cccciiiiiirrrrccccuuuiittt dddddddiiiaaaaggggrrram.
o This circuit haaassssssne = 3 essential nnnnoooooooooooooodddddddddddeeeeeeeessss.....
o We need2 or (ne-1) node-voltage equations
to describe the circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 17
![Page 18: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/18.jpg)
4.2. Introduction to Node-Voltage Methodo The next step is
to select one of 3 essential nodes as a reference node.
o Although theoretically the choice is arbitrary,practically the choice for the reference node often is obvious.
o For example,the node with the most branches is usually a good choice.
o We flag the chosen reference node with the symbol .
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 18
o The next step isto select one of 3 essential nodes as a reference node.
o Although theoretically the choiicccceeeee iiiiiisssssss aaaaaarrrrrrrbbbbbbbiiiiittttrrrrary,practically the choice for theeeeeee rrrrrreeeeffffeeeerrrreeeennnnnnccccccceeeeee node often is obvious.
o For example,the node with the mmmmmmmmmmmoooooooooosssssssssssttttttttttt bbbbbbbbbbbrrrrrrrrrraaaaaaaaaaaaannnnnnnnnnncccccccchhhhhhhhhheeeeeeesssss iiiiiiisssssssss uuuuuuuuuuuuuuussssssssssuuuuuuuuuuaaaaaaaaalllllllllllyyyyyyyyyyyyy aaaaaaaa ggggggooood choice.
o We flag the chhhhooooooooooooossssssssssseeeeeeeeeeennnnnnnnnnnnnn rrrreeeeeeeffffffffeeeeeeeeeeeerrrrrrrrrrrrreeeeeeeeeeeeeennnnnnnnnccccceeeeeeeeeeee nnnnnnnnnnnnnooooooooooooodddddddddddddddeeeeeeeeeeee wwwwwwwwwwwwwiiiiiiiittttttttttttthhhhhhhhhhh ttttttthhhhhhhhhhhhheeeeeeeeee ssssyyyyyyyyyyyyymmmmmmmmmmmmmbbbbbbbbbbbooooooooooooolllllllll ...
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 18
![Page 19: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/19.jpg)
4.2. Introduction to Node-Voltage Methodo After selecting reference node,
we define node voltages on circuit diagram,i.e., the voltage rise
from the reference node to a non-reference node.
o We are now ready to generate node-voltage equations.
o We do so by firstwriting the current leaving each branch
connected to a non-reference nodeas a function of the node voltages and then
summing these currents to zeroin accordance with KCL.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 19
o After selecting reference node,we define node voltages on circuit diagram,
i.e., the voltage risefrom the reference noodddddddeeeeeee ttttttoooo aaaa nnnnnnnooooooonnnn-reference node.
o We are now ready to generate nnnnooooooodddddddeeeeeee----vvvvvvvoooooolllllltttttaaage equations.
o We do so by firstwriting theeee cccccccccccccuuuuuuuuurrrrrrrrrrrrrrrrreeeennnnnnnnnttttttttttt lllllleeeeeeeeeeeeaaaaaaaaaavvvvvvvvvvviiinnnnnnnnngggggggggggg eeeeeeeeeaaaaaaaaaaaaaaaccccccccccchhhhhhhhhhhh bbbbbbbbbbbrrrrrrrrrrrraaaaaaaaaaaannnnnnnnnnnccccccccccchhhhhhhhhhhh
connected to aaaaaaaaaaa nnnnnnnnnnnoooooooonnnn------rrrrrrrrreeeeeeeeeeeffffffffeeeeeeeeeeerrrrrrrrreeeeeeeeeeeeennnnnnnnnnnnncccceeeeeeeee nnnnnnnnnnnooooooooddddddddddddeeeeeeeeeeeas a function offff tttttttttttthhhhhhhhhhhheeeeeeeeeee nnnnnnnnnnnnooooooooooooodddddddddddddeeeeeeeeeeee vvvvvvvvoooooolllllllllllltttttttttttaaaaaaaaaaaaaggggggggggggggeeeeeeeeeeessssssssss aaaaaaaaannnnnnnnnnnnddddddddddddd ttthen
summing these currents to zeroin accordance with KCL.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 19
![Page 20: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/20.jpg)
4.2. Introduction to Node-Voltage Methodo Node-voltage equation at node 1 is:
o Node-voltage equation at node 2 is:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 20
o Node-voltage equation at node 1 is:
o Node-voltage equation at nodeee 222222 iiiiiisssss:::::
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 20
![Page 21: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/21.jpg)
4.2. Introduction to Node-Voltage Methodo Once the node voltages are known,
all branch currents can be calculated.
o Once these are known,the branch voltages and powers can be calculated.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 21
o Once the node voltages are known,all branch currents can be calculated.
o Once these are known,the branch voltages and pooowwwwwwweeeeeerrrrssss ccccaaaannnnnn bbbbbbbeee calculated.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 21
![Page 22: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/22.jpg)
4.2. Introduction to Node-Voltage Method
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 22Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 22
![Page 23: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/23.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 23
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 23
![Page 24: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/24.jpg)
4.3. NVM and Dependent Sourceso If the circuit contains dependent sources,
the node-voltage equations must be supplemented withthe constraint equations imposed by
the presence of the dependent sources.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 24
o If the circuit contains dependent sources,the node-voltage equations must be supplemented with
the constraint equations immmmmmmppppppppoooooosssssseeeeeeddddddd bbbbythe presence of the deeeeeppppppppeeeeeennnnnnddddeeeeennnnnnnttttttt sssssoources.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 24
![Page 25: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/25.jpg)
4.3. NVM and Dependent Sources
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 25Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 25
![Page 26: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/26.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 26
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 26
![Page 27: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/27.jpg)
4.4. NVM: Some Special Caseso When a voltage source is
the only element between 2 essential nodes,the node-voltage method is simplified.
o There are 3 essential nodes.
o 2 simultaneous equations are needed.
o A reference node has been chosen.
o Two other nodes have been labeled.
o The 100 V source constrainsthe voltage between node 1 and the reference node
to 100 V.
o There is only one unknown node voltage (v2).
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 27
o When a voltage source isthe only element between 2 essential nodes,
the node-voltage method iiiiiiissssss ssssssssiiiiimmmmmmmpppppppllllliiiiffffiiied.
o There are 3 essential nodes.
o 2 simultaneous equations are nneeeeeeedddddddddeeeeeeeeeeddddddddd....
o A reference node has bbbbeeeeeeeeeeeeeeeeeeeeeennnnnnnnnnnn cccccccccccchhhhhhhhhhhhhoooooooooooossssssssssseeeeeeeeeeeennnnnnnnnnn..
o Two other nooodddddeeeeeeeeeeessssssssssss hhhhhhhhhhhaaaaaaaaaavvvveeeeeeeee bbbbbbbbbbeeeeeeeeeeeeeeeennnnnnn llllllllllaaaaaaabbbbbbbbbbbbbeeeeeeeeeeellllllleeeeeeeeeeeeddddddddddd...
o The 100 V source connsssssssttttttrrraaaiiiiinnnnssssthe voltage betweenn nnnnoooddddee 1111 aannnndddd ttthhhheee rrreeefffeerrreeeennncce node
to 100 V.
o There is only one unknown node voltage (v2).
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 27
![Page 28: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/28.jpg)
4.4. NVM: Some Special Cases
o Knowing v2,we can calculate the current in every branch.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 28
o Knowing v2,we can calculate the current in every branch.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 28
![Page 29: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/29.jpg)
4.4. NVM: Some Special Caseso When you use NVM to solve circuits
that have voltage sources connected directly between essential nodes,the number of unknown node voltages is reduced.
Because the difference between the node voltages at these nodes equals the voltage of the source.
o The circuit contains 4 essential nodes.
o We anticipate writing3 node-voltage equations.
o 2 essential nodes are connected by an independent voltage source.
o 2 other essential nodes are connected by a dependent voltage source.
o There is only 1 unknown node voltage.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 29
o When you use NVM to solve circuitsthat have voltage sources connected directly between essential nodes,
the number of unknown nooooooodddddddeeeeee vvvvvvooooooollllllttttaaaages is reduced.Because the differenceeeeeee bbbbbbbeeeeeettttwwwweeeeeeeeeeeeennnnnnn the node voltages at these nodesequals the voltage of ttthhhheeeeee ssssssoooooouuuuuuurrrrrrrccccccceeeee...
o The circuit connnntttttttttttaaaaaaaaaiiiinnnnnnnssssss 4444444 eeeeeeessssssseeeennnnnnnnnntttiiiiiiiiaaaaaaaaaallll nnnnnnnnnooooddddeeeessss.......
o We anticipate writingggggggggggggg3 node-voltage equaaaatttttttttiiiiiiiiiioooooooooooooonnnnnnnnnnnssssssssssss....
o 2 essential nodes are connected by an independent voltage source.
o 2 other essential nodes are connected by a dependent voltage source.
o There is only 1 unknown node voltage.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 29
![Page 30: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/30.jpg)
4.4. NVM: Some Special Cases
o We introduce current i becausewe cannot express it as a function of node voltages v2 and v3.
o When a voltage source is between 2 essential nodes,we can combine those nodes
to form a supernode.
o KCL must hold for the supernode:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 30
o We introduce current iii bbbbbbbbbbbeeeeeeeeeeecccccaaaaaaauuuuuuuuuussssssseeeeeeeeeeeewe cannottt eeeeeeeeeeeeeeexxxpppppppppprrrrrrreeessssssssssssssssssss iiiittttttt aaaaaaaasssssssss aaaaaaa ffffffffffuuuuuuuunnnnnnnnnnnnncccccccccctttttiiiiiiiooooooooonnnnnnnnnn oooooooofffffffff nnnnnnnnoooooooooooodddddddeeeeeeeeeee vvvvvvvvoooooooooollllllllllttttttttaaaaaaaagggggggggggeeeeeeeeessssssss vvvvvvvv222222222 aaaand v3.
o When a voltage sourrrrrrrccccccccccccceeeeeeeeeeeee iiiiiissss bbbbbbbeeeeeeeeeeeeettttttttwwwwwwwwwwwwweeeeeeeeeeeeeeeeeeeeeeeeeennnn 22222222 eeeeeeeeeeeessssssssssssssssssseeeeeeeeeeeeeennnnnnnnnntttttttttttiiiiiiiaaaallllllll nnnnnnnnnnnnoooooooooooddddddddddddeeeeeeeeeeeeeessss,we can combine thossssssssssseeeeeeeeeeeeee nnnnnnnnnnnnooooooooooooddddddddddddeeeeeeeeeeeessssssssssssss
to form a supernode.
o KCL must hold for the supernode:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 30
![Page 31: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/31.jpg)
4.4. NVM: Some Special Cases
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 31Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 31
![Page 32: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/32.jpg)
4.4. NVM: Some Special Cases
o When we used the branch-current method of analysis,we faced the task of writing and solving
6 simultaneous equations.
o Nodal analysis can simplify our task.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 32
o When we used the brannnccccccccccchhhhhhhhhhhhhh----ccccccccuuuuuuuuuurrrrrrrrrrrrrrrrrreeeeeeeeennnnnnnnnnntttttttttttt mmmmmmeeeeeetttttthhhhhhhhhhhooooooooodddddddddddd oooooooooooffffffffffff aaaaaaaaaaannalysis,we faced the task of writing and solving
6 simultaneous equations.
o Nodal analysis can simplify our task.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 32
![Page 33: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/33.jpg)
4.4. NVM: Some Special Cases
o The circuit has 4 essential nodes.
o Nodes a and d are connected by an independent voltage sourceas are nodes b and c.
o The problem reduces to finding a single unknown node voltage.Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 33
o The circuit has 4 essential noddes.
o Nodes a and d are connected by an independent voltage sourceas are nodes b and c.
o The problem reduces to finding a single unknown node voltage.Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 33
![Page 34: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/34.jpg)
4.4. NVM: Some Special Cases
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 34Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 34
![Page 35: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/35.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 35
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 35
![Page 36: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/36.jpg)
4.5. Introduction to Mesh-Current Methodo Mesh-current method (MCM) describes a circuit
in terms of be-(ne-1) equations.
o A mesh is a loop with no other loops inside it.
o MCM is applicable only to planar circuits.
o The circuit shown contains7 essential branches with unknown currents and4 essential nodes.
o To solve it via the MCM, we must write4 or 7-(4-1) mesh-current equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 36
o Mesh-current method (MCM) describes a circuitin terms of be-(ne-1) equations.
o A mesh is a loop with no other lllloooooooooooopppppppsssss iiiiiiinnnnnnnssssssiiiidddde it.
o MCM is applicable only to plannnnaaaaaaarrrr ccccciiiirrrrrrcccccccuuuuuiiiiittttttssssss...
o The circuit shown contains7 essential brancheeeesssssssssss wwwwwwwwwwwwwwiiiiiiiitttttttttttttthhhhhhhhhhhhh uuuuuuuuuuuunnnnnnnnnnnkkkkkkkkkkkknnnnnnnnnnnooooooowwwwwwwwwwwwnnnnnnnnnn ccccccccccccccccuuuuuuuuuuurrrrrrrrrrrrrrrrrrrrreeeeeeeeennnnnnnnnnnttttttttttttsssssssssss aaaaaaannnnd4 essentiaaallll nnnnnnnnnnnnoooooooooooodddddddddddddeeeeeeeeessss...
o To solve it via the MCCCCCCCCCCMMMMMMMMMMMMM,,, wwwwwwweeeeeeee mmmmmmmmuuuuuuuuuuussssssstttttttttt wwwwwwwrrriiiiiitttttttttttteeeeee4 or 7-(4-1) mesh-cuuuuurrrrrrrrrrrrrrrreeeeeeennnnnnnnntttttttt eeeeeeeeeeqqqqqqquuuuuuuaaaaaaaaaattttiiiiiiioooooonnnnnnnssssssss..
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 36
![Page 37: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/37.jpg)
4.5. Introduction to Mesh-Current Methodo A mesh current is current that
exists only in perimeter of a mesh.
o On a circuit diagram, it appears as eithera closed solid line or an almost-closed solid line
that follows perimeter of appropriate mesh.
o An arrowhead on solid line indicatesreference direction for mesh current.
o Mesh currents automatically satisfy KCL.At any node in circuit,
a given mesh currentboth enters and leaves node.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 37
o A mesh current is current thatexists only in perimeter of a mesh.
o On a circuit diagram, it appearsss aaaaasssssss eeeeeeeiiiiittttttthhhhhhheeeeeeerrrrra closed solid line or an almost-closed solid line
that follows perimmmmmmmmmeeeeeeeeettteeeerrrrrr oooooooffffff aaaapppppppppppppprrrroooooppppprrrrrriiiiaaaattteee mmmmmmmeeeesssshhh..
o An arrowheadddd oooooooooooonnnnnnnnnnn ssssssssssooolllliiiiiiiiddddddddddd llllllliiiiiiiiinnnnnnnnnnnnneeeeeeeeee iinnnnnnnnndddddddddddiiiiiiiccccccccccccaaaaaaaaaaaattttttttttteeeeeeeeeeeesssssssreference directioooooooooooooonnnnnnnnnnn ffffffffoooorrrrrrr mmmmmmmmmmmmeeeeeeeeeeessssssssshhhhhhhhhhhhh cccccccccuuuuuuuuurrrrrrrrrrrrrrrrreeeeeeeeeeeennnnnnnnnttttttttt....
o Mesh currents automatiiiicccccccccccccaaaaaaaaaaaaallllllllllllllllllyyyyyyyyyyyy sssssssssssaaaaaaaaaatttttttttttiiiiiiiiiiisssssssssffffffffffffffyyyyyyyyyyyy KKKKKKKKCCCCCCCCCCLLLLLLLLLLLLL....At any node in circuit,
a given mesh currentboth enters and leaves node.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 37
![Page 38: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/38.jpg)
4.5. Introduction to Mesh-Current Methodo Identifying a mesh current in terms of a branch current
is not always possible.
o i2 is not equal to any branch current,whereas i1, i3, and i4 can be identified with branch currents.
o Measuring a mesh current is not always possible.
o There is no place where an ammeter can be inserted to measure i2.
o The fact that a mesh current can be a fictitious quantitydoesn't mean that it is a useless concept.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 38
o Identifying a mesh current in terms of a branch currentis not always possible.
o i2 is not equal to any branch cuuurrrrrrrrreeeeeeennnnnnnttttttt,,,,whereas i1, i3, and i4 can beee iiiiiiiidddddddeeeennnnttttiiiiffffiiiiieeeeeeddddddd wwwith branch currents.
o Measuring a mesh current is noott aaaaaaalllllllwwwwwwwwwwwaaaaaaaayyyyyyyssss ppossible.
o There is no place wherrrreeeeeeeeee aaaaaaaaaaannnnnnnnnnnn aaaaaaaaaaaammmmmmmmmmmmmmmmmmmmmmmmeeeeeeeeettttttttttteeeeeeerrrrrr ccccccccccaaaaaaaaaaannnnnnnnnnnnnnnn bbbbbbbbbbbbbbeeeeeeeeeeee iiiinnnnnnnnnnnssssssssseeeeeeeeeeeeeerrrrrrrtttted to measure i2.
o The fact that aaaa mmmmmmmmmmmmeeeeeeeeesssssssssssshhhhhhh ccccccccuuuuuuuurrrrrrrrrrrrrrrrrreeeeeeeeennnnnnntttt cccccccaaaaaaaaaaaannnnnnnnn bbbbbbbbbbbbbbeeeeeeeeee aaaaaaaaa fffffffffffiiiiiiccccccccttttiiiiiiiiitttttttttttiiiiiiiiiooooooouuuuusssssss qqqqqqqqqquuuuuuuuuaaaaaaaaaaannnnnnnnnnnttttttttttiiiiiiiittttttttttttyyyyyyyyyyyydoesn't mean thaaaaaaatttttttttt iiiiiiittttttt iiissssss aaaaaaaa uuuuusssssssssseeeeeeeeellllllllleeeeeessssssssss cccccccoooooooonnnnnnncccccccccceeeeeeeeepppppppppttttttttt....
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 38
![Page 39: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/39.jpg)
4.5. Introduction to Mesh-Current Method
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 39Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 39
![Page 40: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/40.jpg)
4.5. Introduction to Mesh-Current Method
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 40Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 40
![Page 41: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/41.jpg)
o Above equations are identical in form,with mesh currents ia and ib replacing branch currents i1 and i2.
o MCM of circuit analysisevolves quite naturally from branch-current equations.
o MCM is equivalent to a systematic substitution ofne-1 current equations into be-(ne-1) voltage equations.
4.5. Introduction to Mesh-Current Method
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 41
o Above equatioonnnsss aaarreeeeee iiiiiiddddeeennnnntttttttiiiiiccccaaaalllllll iiinnnn fffffffffoooooorrrrrmmmmm,,,with mesh currennttsss iiiaaaa aaaaaannnndddddd iiiibbbbbbbbbb rrrreeeeepppppppppppllllaaaaaaacccccccccccciiiinnnnggggggggggg bbbbbbbrrrraaaannnncccchhhh cccuuuurrents i1 and i2.
o MCM of circuit analysisevolves quite naturally from branch-current equations.
o MCM is equivalent to a systematic substitution ofne-1 current equations into be-(ne-1) voltage equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 41
![Page 42: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/42.jpg)
4.5. Introduction to Mesh-Current Method
o The circuit has7 branches (5 essential branches)
where current is unknown and5 nodes (3 essential nodes).
o Thus, we need3 orb-(n-1)=7-(5-1) orbe-(ne-1)=5-(3-1) mesh-current equations to describe circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 42
o The circuit has7 branches (((5 essennnnttttttttttiiiiaaaaaaaaaaaaalllllllll bbbbbbbbbbbbrrrrrrrrraaaaaaaaaaannnnnnnnnnccccccccccchhhhhhhhheeeeeeeesssssssss)))))
where ccccuuuuuuuuuurrrrrrrrrrrrrrrrrrrreeeeeeeennnnnnnnnnnnttttt iiiisssssssss uuuuuuuuuuunnnnnnnnkkkkkkkkkknnnnnooooooooooowwwwwwwwwwwwnnnnnnnnn aaaaaaaaaaaannnnnnnnnndddddddddddd5 nodes (3 essenttttttttiiiiiiiiaaaaaaaaaaallll nnnnooooooddddddddddddeeeeeeesssssss)))))))...
o Thus, we need3 orb-(n-1)=7-(5-1) orbe-(ne-1)=5-(3-1) mesh-current equations to describe circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 42
![Page 43: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/43.jpg)
4.5. Introduction to Mesh-Current Method
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 43Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 43
![Page 44: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/44.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 44
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependent Sources4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 44
![Page 45: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/45.jpg)
4.6. MCM and Dependent Sourceso If the circuit contains dependent sources,
mesh-current equations must be supplemented byappropriate constraint equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 45
o If the circuit contains dependent sources,mesh-current equations must be supplemented by
appropriate constraint eqqqquuuuuuuaaaaaaatttttttiiiiiiooooooonnnnnnsssssss...
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 45
![Page 46: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/46.jpg)
o Circuit has6 branches with unknown currents and4 nodes.
o We need 3 mesh currents:
4.6. MCM and Dependent Sources
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 46
o Circuit has6 branches with unknown currrrrreeeeeeeeeennnnnnnnnnnnnntttttttttttsssssssss aaaand4 nodes.
o We need 3 meeeessssssssssshhhhhhhhhhh cccccccuuuuuuuuuuuurrrrrrrreeeeeeeeennnnnnnnnntttttttttttssssssss:::::
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 46
![Page 47: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/47.jpg)
4.6. MCM and Dependent Sourceso What if you had not been told to use MCM?
o Would you have chosen NVM?
o It reduces problem to finding 1 unknown node voltagebecause of the presence of 2 voltage sources between essential nodes.
o We present more aboutmaking such choices later.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 47
o What if you had not been told to use MCM?
o Would you have chosen NVM?
o It reduces problem to finding 1 uuuuunnnnnnnkkkkkkknnnnnoooooowwwwwwwnnnnnnn nnnode voltagebecause of the presence of 2222222 vvvvvvoooollllltttttttaaaaaaagggggggeeeeee sssssssooources between essential nodes.
o We present more aboutmaking such choiceeeesssssssssss lllllaaaaaaaaaaaaaattttttttttteeeeeeeeeeeeeerrrrrrrrr....rrrr
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 47
![Page 48: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/48.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 48
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Some Special Cases4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 48
![Page 49: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/49.jpg)
4.7. MCM: Some Special Caseso When a branch includes a current source,
MCM requires some additional manipulations.
o We definedmesh currents ia, ib, and ic, andvoltage across 5 A current source.
o Circuit contains5 essential branches
with unknown currents and4 essential nodes.
o We need to write 2 or 5-(4-1) mesh-current equations to solve circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 49
o When a branch includes a current source,MCM requires some additional manipulations.
o We definedmesh currents ia, ib, and ic, aaaaaaannnnnndddddvoltage across 5 A current ssssoooouuuuuuurrrrrrrccccccceeeeeee....
o Circuit contains5 essentiaaallll bbbbbbbbbbbbrrrrrrrrraaaaaaaaannnnnncccchhhhhhhhhhhheeeeeeeeeeessssssssss
with unknownn ccccccccccccuuuuuuuuuuurrrrrrrrrrrreeeeeeeeennnnnnnnnnttttttttttsssssssss aaaaaaaaaannnnnnnnnnnnnddddddddddddd4 essential nodes.
o We need to write 2 or 5-(4-1) mesh-current equations to solve circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 49
![Page 50: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/50.jpg)
4.7. MCM: Some Special Caseso Presence of current source reduces
3 unknown mesh currents to 2 such currents.
o It constrainsdifference between ia and ic to equal 5 A.
o If we know ia,we know ic, and vice versa.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 50
o Presence of current source reduces3 unknown mesh currents to 2 such currents.
o It constrainsdifference between ia and iiicccccc ttttttoooooo eeeeqqqqqqquuuuaaaaaalllllll 555555 A.
o If we know ia,we know ic, and viccceeeeeeeee vvvvvvvvvvveeeeeeeeeeeerrrrrrrrrrrrsssssssssaaaaaaaaaa....
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 50
![Page 51: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/51.jpg)
4.7. MCM: Some Special Caseso For mesh a:
o For mesh c:
o Adding the above equations:
o For mesh b:
o For current source branch:
o Solving equations:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 51
o For mesh a:
o For mesh c:
o Adding the above equations:
o For mesh b:
o For current source brancccchhhhhhhhhhhh:::::::::
o Solving equations:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 51
![Page 52: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/52.jpg)
4.7. MCM: Some Special Cases
o We can solve the problemwithout introducing unknown voltage v
by using the concept of a supermesh.
o To create a supermesh,we mentally remove current source from circuit
by simply avoiding this branchwhen writing mesh-current equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 52
o We can solve ttthhhheeee ppppprrrooobbbblllleeeemmmwithout innnttttrrrooooddddddduuuucccciiiinnnnggg uuuunnnnkkkknnnnoooowwwwnnnn vvvvoooolllllllttttaaaaaaaaagggggeeeee vvvv
by using the coonnnnnnncccceeepppppppppptttt ooooffff aaaa ssssuuuppppppppeeeerrrrmmmmeeeessssshhhhhhhhhh..
o To create a supermesh,we mentally remove current source from circuit
by simply avoiding this branchwhen writing mesh-current equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 52
![Page 53: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/53.jpg)
4.7. MCM: Some Special Cases
o We express voltages around supermesh in terms of original mesh currents:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 53
o We express vooollllttttaaaagggggeeeesss aaaarrrroooouuunnnddddddddddd ssssuuuuppppppppeeeerrrrmmmmeeeesssssssshhhhhhhhhh iiiiiinnnn ttttttteeeerrrrmmmmssssss ooooffff oooorrrrigggiinnnaal mesh currents:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 53
![Page 54: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/54.jpg)
4.7. MCM: Some Special Caseso Circuit has
4 essential nodes and5 essential branches
with unknown currents.
o Circuit can be analyzed in terms of5-(4-1) or 2 mesh-current equations.
o Although we defined 3 mesh currents,dependent current source forces
a constraint between mesh currents ia and ic .
o We have only 2 unknown mesh currents.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 54
o Circuit has4 essential nodes and5 essential branches
with unknown currents.
o Circuit can be analyzed in termssss ooooooofffffff5-(4-1) or 2 mesh--ccccccccccuuuuuuuurrrrrrrreeeennnnnnnnnntttt eeeeeeqqqqqqqquuuuuuuaaaaaattttiiiiioooonnnnssssss...
o Although we ddddeeeeeeeeeeeeeeffffffiiinnnnnnnnneeeeeeeeedddd 333333333333 mmmmmmmmmmmmmmeeeeeeeeeessssssssssshhhhhhhhh ccccccccccccuuuuuuuuuurrrrrrrrrrrrrrrrrrrrrreeeeeeeeeeennnnnnnnnnntttttttssssssssss,,,,,,,,dependent curreeeennnnnnnnnnnnnnttttttttttt ssssssssooooooouuuuuuurrrrrrrrrrrcccccccceeeeeeeeeee fffffffffooooooooooooorrrrrrrrrrccccceeeeeeeeesssssssssss
a constraint betweeeeeeeeeeeeeeeeeeeeennnnnnnnnnnn mmmmmmmmmmmmmmeeeeeeeeeeesssssssssshhhhhhhhhhh cccccccccccuuuurrrrrrrrrrrrrrrreeeeeeeeeeeennnnnnnnnnnttttttttttttssssssssssss iiiiiiiiaaaaaaaaaa aaaaaaaaaaaannnnnnnnnnnnnddddd ic .
o We have only 2 unknown mesh currents.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 54
![Page 55: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/55.jpg)
4.7. MCM: Some Special Cases
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 55Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 55
![Page 56: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/56.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 56
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versus MCM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 56
![Page 57: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/57.jpg)
4.8. NVM Versus MCMo The greatest advantage of both NVM and MCM is that
they reduce the number of simultaneous equationsthat must be solved.
o They also require the analyst to be quite systematic in terms oforganizing and writing these equations.
o When is NVM preferred to MCM and vice versa?
o There is no clear-cut answer.
o Asking a number of questions,may help you identify the more efficient method.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 57
o The greatest advantage of both NVM and MCM is thatthey reduce the number of simultaneous equations
that must be solved.
o They also require the analyst tooooo bbbbbbbeeeee qqqqquuuuiiiitttttteeeeeee sssssyyystematic in terms oforganizing and writing theseeee eeeeeeqqqqqqqquuuuuuuaaaaaaattttttiiiiioooooonnnnsss.
o When is NVM preferreeedddddddddd ttttttttttooooooooooo MMMMMMMMMMMMCCCCCCCCCCCMMMMMMMMMMMM aaaaaaaaaannnnddddddd vvvvvvvvviiiiiiccccccccccceeeeeeeeeee vvvvvvvveeeeeeeeerrrrrrrsssssssssaaaaaaaaaaa?????????
o There is no cleeeeaaaaaaaaaaaaarrrrrrrrrrr-------ccccccccccuuuuuuuuuuuuuttttt aaaaaaaaaaaannnnnnnnnnnssssssssssssswwwwwwwwwwwwwwweeeeeeeerrrrrrrrr....
o Asking a number of qqqqqqquuuuuuuuuuueeeeeeesssstttttttiiiiioooooooonnnnnnnnsssssss,,,,may help you identiffffyyyyyyyyyy tttttttttttthhhhhhhhhheeeeeeeee mmmmmmmmmoooooooorrrrrrrreeeeeeeeeee eeeffffffffffffiiiicccccciiiiiiiieeeeeeeeennnnnnnnnttttttt mmmmmmmmmmeeeeeeeeetthhod.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 57
![Page 58: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/58.jpg)
4.8. NVM Versus MCMo Does one of the methods result in fewer simultaneous equations to solve?
o Does the circuit contain supernodes?If so, using NVM will permit you
to reduce the number of equations to be solved.
o Does the circuit contain supermeshes?If so, using MCM will permit you
to reduce the number of equations to be solved.
o Will solving some portion of the circuit give the requested solution?If so, which method is most efficient
for solving just the pertinent portion of the circuit?
o Some time spent thinking about the problem in relation to the various analytical approaches available is time well spent.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 58
o Does one of the methods result in fewer simultaneous equations to solve?
o Does the circuit contain supernodes??If so, using NVM will permittt yyyyyooooooouuuuuuu
to reduce the number of eeeeeeeqqqqqquuuuaaaattttiiiioooonnnnnnnssssss to be solved.
o Does the circuit contain supermmeeessssshhhhhhhhhheeeeeeeeeessssssss???????If so, using MCM wwwiillllllllllllllll ppppppppppppeeeeeeeeeeeeerrrrrrrrmmmmmmmmmmmiiiiiitttttttttt yyyyyyyyyyoooooooooouuuu
to reduucccceeeeeeeeeeeeee tttttttthhhhhhhhheeeeee nnnnnnnnnuuuuuuuuuummmmmmmmmmmmbbbbbbbbbbeeeeeeeeeeerr oooooooooooofffffffff eeeeeeeeeeeeqqqqqqqqqqqqquuuuuuuuuuuaaaaaaaaatttttttttttiiiiiiiiiooooooooooooonnnnnnnnnnnssssssss tttttttttttoooooooooo bbbbbbbbbbbeeeeeeeeeeee sssssssssoooooooooooolllllllvvvvvvvvvvvvveeeeeeeeeedddddddddddd.......
o Will solving some poooooorrrrrrrrrrtttttttttttttiiiiiiiiiiiioooooooonnnnnn ooooooooooofffffffffffff tttttttttthhhhhhhhhhhhhheeeeeeeeeeeeee ccccccciiiirrrrrrrrrrcccccccuuuuuuuuuuuuuiiiiiiiitttttttt ggggggggggggggiiiiiivvvvvvvvvveeeeeeeeeeee ttthhhhhhhhhhhheeeeeee rrrrrrrrreeeeeeeeeeqqqqqqqqqqqqqquuuuuuested solution?If so, which method iiiisssssssssssss mmmmmmmmmmmmmmoooooooooooossssssssssstttttttttt eeeeeeeeeeeeffffffffffffffffffffffiiiiiiiiiiiiccccccciiiieeeeeeeennnnnnnnttttttttttttt
for solving just the pertinent portion of the circuit?
o Some time spent thinking about the problem in relation to the various analytical approaches available is time well spent.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 58
![Page 59: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/59.jpg)
4.8. NVM Versus MCMo Find the power dissipated in R = 300 .
o We need to find eithercurrent or voltage of resistor.
o MCM yields current in the resistor.
o MCM requires solving5 simultaneous mesh equations.
o In writing the 5 equations,we must include
the constraint i = -ib.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 59
o Find the power dissipated in R = 300 .
o We need to find eithercurrent or voltage of resistor.
o MCM yields current inn ttttttttthhhhhheeeeeeeeeeeeee rrrrrrrrrrrrreeeeeeeeeeeeessssssssssssiiiiiisssssssssssstttttttttttoooooooooooorrrrrrrrrr.......
o MCM requireeessss sssssssssooooooooooooolllllvvvvvvvvvvviiiiiinnnnngggggg5 simultaneous mmmmmmmeeeeeeeeeeessssshhhhhhh eeeeeeqqqqqqqquuuuuuuaaaaaaaatttttttttiiiiiiiiiiioooooooooonnnnsssssss..
o In writing the 5 equationnnssss,we must include
the constraint i = -ib.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 59
![Page 60: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/60.jpg)
4.8. NVM Versus MCMo Find the power dissipated in R = 300 .
o The circuit has 4 essential nodes.
o Only 3 NV equations are required.
o Because of dependent voltage sourcebetween 2 essential nodes,
we have to sum currents at only 2 nodes.
o Problem is reduced to writing2 NV equations anda constraint equation.
o NVM requires only 3 simultaneous equations,it is the more attractive approach.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 60
o Find the power dissipated in R = 300 .
o The circuit has 4 essential nodeeeesssss..
o Only 3 NV equations are requirrreeeeedddddd..
o Because of dependent voltage soouuuuuuuuurrrrrrrrrrrrrcccccccccccccceeeeeeeeeeebetween 2 essentiaaaallll nnnnnnnnnnooooooooooodddddddddddddeeeeeeeeesssssssssss,,
we haveeee tttttttttttooooooooooooo ssssssssuuuuuuuuuuummmmm cccccccccuuuuuuuuuuurrrrrrrrrrrrrrreeeeeeennnnnnnnnnttttttttttssssssssss aaaaaaattttttttttt oooooooooonnnnnnnlllllllllyyyyyyyyyyy 22222222222222222 nnnnnnnooooooooooodddddddeeessssssssss..
o Problem is reduced tttooo wwwwrrriiiiittttiiiinnnngggggg2 NV equations anda constraint equation.
o NVM requires only 3 simultaneous equations,it is the more attractive approach.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 60
![Page 61: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/61.jpg)
4.8. NVM Versus MCM
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 61Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 61
![Page 62: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/62.jpg)
4.8. NVM Versus MCMo Find the voltage vo in the circuit.
o Circuit has4 essential nodes and2 voltage-controlled dependent sources.
o NVM requires solving3 NV equations and2 constraint equations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 62
o Find the voltage vo in the circuit.
o Circuit has4 essential nodes and2 voltage-controlleeeddddddddd dddddddddddeeeeeeeeeeeeeppppppppppppppeeeeeeeeeeeennnnnnnndddddddddddeeeeeeeeeeeennnnnnnnnnntttt ssssssoooooooooooooouuuuuuuuuuurrrrrrrrrrrrrrrcccccccccceeeeeeeeeeeeessssssssssss..
o NVM requiresss sssssssssssoooooooooooolllllllvvvvvvvvviiiiiiiinnnnnnnngggg3 NV equations aaaaaaannnnnnnnnnndddddddddd2 constraint equatioooonnnnnnnnnnsssssssssss..
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 62
![Page 63: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/63.jpg)
4.8. NVM Versus MCMo Find the voltage vo in the circuit.
o Circuit contains 3 meshes.
o We can use leftmost one to calculate vo.
o If ia denotes leftmost mesh current,vo = 193-10ia.
o Presence of 2 current sources reduces problem to solvinga single supermesh equation and2 constraint equations.
o MCM is the more attractive technique here.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 63
o Find the voltage vo in the circuit.
o Circuit contains 3 meshes.
o We can use leftmost one to calculllaaaaaaaaatttttttttttteeeeeeeeeeeee vvvvvvvvvoooo.
o If ia denotes leeeffffttttmmmmoooossstttt mmmmeeeessshhhhh ccccuuuurrrrrrreeeennntttt,,,vo = 193-111100000000iiiiiiia.
o Presence of 2 currentt soooouuuuuuuuuurrrrrrrccccccceeeeeeeesssssssss rrrrrrrreeeeeeedddddddduuuuuuuuucccceeeeeeeeessssssssss pppppppppppprrrrrrrrrrooooooooobbbbbbblllleeeeeeemmmmmmmmm tttto solvinga single supermesh equatiion anddd2 constraint equations.
o MCM is the more attractive technique here.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 63
![Page 64: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/64.jpg)
4.8. NVM Versus MCM
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 64Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 64
![Page 65: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/65.jpg)
4.8. NVM Versus MCM
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 65Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 65
![Page 66: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/66.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 66
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformations4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 66
![Page 67: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/67.jpg)
4.9. Source Transformationso Even though NVM and MCM are powerful techniques,
we are still interested in methodsthat can be used to simplify circuits.
o Series-parallel reductions and -to-Y transformations arealready on our list of simplifying techniques.
o We begin expanding this list withsource transformations.
o A source transformation, allowsa voltage source in series with a resistor to be replaced by
a current source in parallel with same resistor or vice versa.
o A source transformation is bilateral.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 67
o Even though NVM and MCM are powerful techniques,,we are still interested in methods
that can be used to simplifffffffyyyyyyyy cccccccciiiiirrrrrccccccuuuuuuuiiiiittttssss.
o Series-parallel reductions and ----ttttttoooo----YYYY ttttrrrrraaaaaaannnnnnsformations arealready on our list of simpliffffyyyyiiiiinnnnnnnngggggggg tttttttteeeeeeecccccchhhhhhnnniques.
o We begin expanding thhhiiiissssssss llllllliiiiiiisssssssssttttttttttt wwwwwwwwwwwiiiiiittttttttttthhhhhhhhsource traaannnnnnsssssssssssssffffoooooooooooorrrrrrrrrrmmmmaaaaaaaaaaaattttttttttiiiiiioooooooooooonnnnnnnnnnssssssssss..
o A source transformaaaaatttttttttttttiiiiiiiiiioooooooooooooonnnnnnnn,,, aaaaaaallllllllllllllloooooooowwwwwwwwwwwwwsssssssssssssa voltage source in sssseeeeeeeeeeeeerrrrrrrrrrrriiiiiiiiiiiieeeeeeeeeeessssssssssss wwwwwwwwwwwwwiiiiiitttttttttttttthhhhhhhhhhh aaaaaaaaaaaa rrrrrrreeeeeeessssssssiiiiiissssssssssssttttttttoooooooooooorrrrrrrrrr ttttttttttttooooooooooooo bbbbbbbbeee replaced by
a current source in parallel with same resistor or vice versa.
o A source transformation is bilateral.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 67
![Page 68: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/68.jpg)
4.9. Source Transformationso We need to find relationship between vs and is
that guarantees 2 configurations are equivalentwith respect to nodes a, b.
o Equivalence is achieved ifany RL experiences same current, and same voltage,
if connected between nodes a, b:
o If polarity of vs is reversed,orientation of is must be reversed to maintain equivalence.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 68
o We need to find relationship between vsv and isithat guarantees 2 configurations are equivalent
with respect to nodes a, b...
o Equivalence is achieved ifany RL experiences same cuurrrrrrrrreeeeeeennnnnnntttttt,,,, aaaaaannnnnndddd ssame voltage,
if connected betwwwwwwwwweeeeeeeeeeeennnn nnnnnooooooooodddddeeeesssssss aaaaaaa,,,, bbbb::
o If polarity of vsv is reversed,orientation of isi must be reversed to maintain equivalence.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 68
![Page 69: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/69.jpg)
4.9. Source Transformations
o Circuit has4 essential nodes and6 essential branches with unknown currents.
o We can find current in branch containing 6 V source by solving either3 = [6-(4-1)] mesh-current equations, or 3 = [4-1] node-voltage equations.
o We can also simplify circuit by using source transformations.
o We must reduce circuit in a way thatpreserves identity of branch containing 6 V source.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 69
o Circuit has4 essential nodes and6 essential brancheeeesssssssssss wwwwwwwwwwwwwwwiiiiiiiiiiiittttttttttthhhhhhhhhhhh uuuuuuuuuuuunnnnnnnnnnnkkkkkkkkkkknnnnnnnnnnnoooooooowwwwwwwwwwwwnnnnnnnnnn ccccccccccccccuuuuuuuuuuuuurrrrrrrrrrrrrrrrrreeeeeeeennnnnnnnnnntttttttttttttssssssssss...
o We can find cccuuuuurrrrrrrrrrrrrrrrrrrrrreeeeeeeeeeennnnnnnnntttttttttt iiinnnnnnnn bbbbbbbbbbbrrrrrrrraaaaaaaannnnnnnccchhhhhhhhhhhh cccccccccccoooooooooonnnnnnnnnnnttttttttaaaaaaaaaiiiiiiinnnnnnnnnnniiiinnnnnnnnnngggggg 66666666666666 VVVVVVV ssssssssssooooooooouuuuuuuuuurrrrrrrrcccccccccccceeeeeeeeee bbbbbbbbbbbbbyyyyyyyyyy sssssssssssooooooooooolllllvvving either3 = [6-(4-1)] mmmmmmeeeeeeessssssssssshhhhhhh-cccccccuuuuuuuurrrrrrrrrrrreeeeeeeeennnnnnnnnttttttttttt eeeeqqqqqqquuuuuuuaaaaaaattttiiiiiiioooooooooonnnnnnnnnsssssssss,,,, oooorrrrr 3 = [4-1] node-volttttttaaaaaaagggggggggggeeeeeee eeeeeqqqqquuuuaaaaaattttttttttttiiiiiiiiioooonnnnsssss..
o We can also simplify circuit by using source transformations.
o We must reduce circuit in a way thatpreserves identity of branch containing 6 V source.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 69
![Page 70: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/70.jpg)
4.9. Source Transformations
is = (19.2-6)/16 = 0.825 A
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 70
isi = (19.2-6)/16 = 0.825 A
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 70
![Page 71: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/71.jpg)
4.9. Source Transformationso What happens if
there is an Rp in parallel withvoltage source?
o What happens ifthere is an Rs in series with
current source?
o In both cases,resistance has no effect on equivalent circuit that
predicts behavior with respect to terminals a, b.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 71
o What happens ifthere is an Rp in parallel with
voltage source?
o What happens ifthere is annn RRRRRRRRRRRRRRssssssss iiiiiiinnnnnnnnnnnnn ssssseeeeeeerrrrrrrriiiiiiiiiieeeeeeeeeeeeesssssssssssss wwwwwwwwwwiitttttttttttthhhhhhhhhhhh
current sourceeeeeeeee?????????????
o In both cases,resistance has no effect on equivalent circuit that
predicts behavior with respect to terminals a, b.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 71
![Page 72: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/72.jpg)
4.9. Source Transformations
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 72
p8A(developed) = -(-60)(8) = 480 WElectric Circuits 1 Chapter 4. Techniques of Circuit Analysis 72
p8A(developed) = -(-60)(8) = 480 W
![Page 73: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/73.jpg)
4.9. Source Transformations
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 73
o 125 and 10 resistorsdo not affect the value of vo butdo affect the power calculations!
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 73
o 125 and 10 resistorsdo not affect the value of vo butdo affect the power calculations!
![Page 74: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/74.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 74
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 74
![Page 75: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/75.jpg)
4.10. Thévenin and Norton Equivalentso Sometimes, we want to concentrate on
what happens at a specific pair of terminals.
o For example, when we plug a toaster into an outlet,we are interested primarily in
voltage and current at terminals of toaster.
o We have little or no interest ineffect that connecting toaster has on
voltages or currents elsewhere in circuit supplying outlet.
o We then are interested inhow voltage and current delivered at outlet change
as we change appliances.
o We want to focus on the behavior of circuit supplying outlet,but only at outlet terminals.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 75
o Sometimes, we want to concentrate onwhat happens at a specific pair of terminals.
o For example, when we plug a tooooaaaaassssssstttttttteeeeeeerrrrrr iiiiiinnnnnnnttttttoooo an outlet,we are interested primarily iiiiinnnnnnn
voltage and current at teerrrrmmmmmmmiiiiiinnnnnnnaaaaaaallllllssssss oooooofff toaster.
o We have little or no innttteeeeeeeeeeerrrrrrrrreeeeeeeeeeeessssssssssssstttttttt iiiiinnnnnnnnneffect thattt ccccccccccccccoooooonnnnnnnnnnnnnnnnnneeeecccccccccctttttttiiiiiiiiiiinnnnnnnnnnggggggggggggg ttttttttttoooooooaaaaaaaaassssssssssstttttttttteeeeeeeeeeeerrrrrrrrrrrr hhhhhhhhhhhhhaaaaaaaaaasssssssssss ooooooooooonnnnnnnnnnn
voltages or currrrrrrrrrrrrrrrrreeeeeeeeeeennnnnnnnttttsssssssss eeeeeeeeeeeelllllssssssssseeeeeeeeeeeeewwwwwwwwwwwwwwhhhhhhhhhhhhheeeeeerrrrreeeeeeeeeee iiiiiiiinnnnnnnnn cccccccccccccciiiiiiiiiirrrrrrrccccccccccccccuuuuiiiitttttttttt ssssssssssuuuuuuupppppppppppppppppppppppppllllying outlet.
o We then are interested iiiinnnnnnnnnnnnnhow voltage and current delivered at outlet change
as we change appliances.
o We want to focus on the behavior of circuit supplying outlet,but only at outlet terminals.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 75
![Page 76: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/76.jpg)
4.10. Thévenin and Norton Equivalentso Thévenin and Norton equivalents are
circuit simplification techniquesthat focus on terminal behavior.
o They are extremely valuable aids in circuit analysis.
o Here we discuss resistive circuits,but Thévenin and Norton equivalent circuits may be used to represent
any circuit made up of linear elements.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 76
o Thévenin and Norton equivalents arecircuit simplification techniques
that focus on terminal behhhhhaaaaaaavvvvvvviiiiiiiooooooorrrrrr...
o They are extremely valuable aiddddddddsssss iiiiinnnn cccciiiirrrrcccccuuuuuuuiiiiitttt analysis.
o Here we discuss resistive circuittsss,but Thévenin and NNNooooooooooorrrrrrrrrrtttttttttttooooooooooooonnnnnnnnnnn eeeeeeeeeeeqqqqqqqqqqqqqquuuuuuuuuiiiiiiivvvvvvvvvvaaaallllleeeeeeeeeeennnnnnnnnttttttttt cccccccccciiiiiirrrrrrrrcccccccccuuuuuuiiiiiiiittttttttttttssssssss mmmmmmmmmaaay be used to represent
any circccuuuuuuiiiiiiiiiiitttttttt mmmmmmmmmmmaaaadddddddddeeeeeeeeeeee uuuuuuuuuuppppppppppppp ooooooooooofffff lllliiiiiinnnnnnnnnneeeeeeeeeeeeeeeaaaaaaaaaaarrrrrrrrrrr eeeeeeeellllllleeeeeeeeeeeemmmmmmmmmmmeeeeeeeeeennnnnnnnnnntttttttttsssss...
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 76
![Page 77: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/77.jpg)
4.10. Thévenin and Norton Equivalents
o Letters a and b denotepair of terminals of interest.
o A Thévenin equivalent circuit isan independent voltage source VTh in series witha resistor RTh ,
which replaces an interconnection of sources and resistors.
o If we connect same load across terminals a and b of each circuit,we get same voltage and current at terminals of the load.
o This equivalence holdsfor all possible values of load resistance.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 77
o Letters a and b denotepair of terminals of interestttt...
o A Thévenin equivalent circuit isan independent vooooltttttttttttaaaaaaaaaggggggggggggggeeeeeeeeeeeeee ssssssssssssoooooooooooouuuuuuuuuuuuuurrrrrrrrcccccccccccceeeeeeeeeee VVVVVVVVTTTTTTTTThhhhhhhhhhVVVV iiiiiiiiinnnnnnnnnnnnn ssssssssssseeeeeeeeeeeeeerrrrrrriiiiiieeeeeeeeeeeesssssssss wwwwwwwwwwwwwiiiitha resistor RRRRRRRRTTTTTTTTTTThhhhhhhhhhh ,,,,,,,
which replacessssssssss aaaaaaaaaaaannnnnnnn iiinnnnnnnnttttttttttteeeeeeeeeeeeerrrrrrrrccccccccccccoooooooooooonnnnnnnnnnnnnnnnnneeeeeeeeeeeccccccccccctttttttttttttiiiiiiiiioooooooooonnnnnnnnnnnnnn oooooooooooffffffffffff ssssssoooooooouuuuuuuurrrrrrrrrrrrrrccccccccccceeeeeeeeeessssssssssssss aaand resistors.
o If we connect same loadddd aaaaacccccccrrrrrooooosssssssss tttttttttteeeeeerrrrrrrmmmmmiiiiinnnnnaaaallllllllsssssssss aaaaaaaaa aaaaaannnnnndddddddddddd bbb of each circuit,we get same voltage and current at terminals of the load.
o This equivalence holdsfor all possible values of load resistance.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 77
![Page 78: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/78.jpg)
4.10. Thévenin and Norton Equivalents
o We must be able todetermine VTh and RTh.
o If load resistance is infinitely large,we have an open-circuit condition.
The open-circuit voltage at the terminals a and b is VTh in circuit (b).It must be same as open-circuit voltage at terminals a and b inoriginal circuit.
o To calculate VTh,we simply calculate open-circuit voltage in original circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 78
o We must be able todetermine VThVV and RTh.
o If load resistance is inffffiiiinnnnnnnnnniiiiittttttttttteeeeeeeeellllllllllllyyyyyyyyyyy llllllllllaaaaaaaaarrrrrrrrrrggggggggggeeeeeeeeee,,,we have aaannnnnn oooooooooooppppppppppeeeeeeeeeeeennnnnn---cccccccccciiiiiiiiiirrrrrrrrcccccccccccuuuuuuuuiiiiittttttt cccccccccccoooooooooonnnnnnnnnnndddddddddddddiiiiiiiiiiittttttttiiiiiiiiioooooooonnnnnnnnnnn....
The open-circuuuuuuuiiiiiiiitttttttttt vvvvvvooooolllllttttaaaaaagggggggeeeeeeeeee aaaaaattttttttt ttthhhhhhhhhhheeeeeee tttttttteeeeeeerrrrrrrrrrmmmmmmmmmiiiiiiiiinnnnnnnnnaaaallllllssssss aaaaaaaaaaaa aaaaaannnnnnnndd b is VThVV in circuit (b).It must be same aasssss oooooooppppppeeeeennnn--cccciiiiiiirrrrrrcccccccccuuuuuiiiitttttt vvvvoooolllllttttttttaaaaaaagggggeeeeee aaaaatttttt tterminals a and b inoriginal circuit.
o To calculate VThVV ,we simply calculate open-circuit voltage in original circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 78
![Page 79: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/79.jpg)
4.10. Thévenin and Norton Equivalents
Reducing load resistance to zerogives us a short-circuit condition.
o In circuit (b), short-circuit current directed from a to b is:
o This short-circuit current must be identical toshort-circuit current that exists in
a short circuit placed across terminals a to b of original network.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 79
Reducing load resistance to zerogives us a short-cirrccccuuuuuuuuuuiiiiiiiiittttttttttttt ccccccccccccooooooooooonnnnnnnnnnndddddddddddiiiiiiittttttttttiiiiiiiooooooooooonnnnnnnn...
o In circuit (b), ssshhhhhhhhoooorrrrttt--ccciiiirrrrccccuuuiiiiiiitttt ccccuuuurrrrrrrreeeennnntttt dddddddddiiiirrrreeeecccctttttttttteeeedddddddd ffffffffrooooommmmm aaaa ttttoooo bbbbbbb iiiiiiiissssssss::::::
o This short-circuit current must be identical toshort-circuit current that exists in
a short circuit placed across terminals a to b of original network.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 79
![Page 80: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/80.jpg)
4.10. Thévenin and Norton Equivalents
o Thévenin resistance isratio of open-circuit voltage to short-circuit current:
o If short-circuit current is directed from b to a is,a minus sign must be inserted in the equation.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 80
o Thévenin resissttttaaaannnnccceeee iiissssratio of opppeeennnn---ccciiiiiiiirrrccccuuuuiiittttt vvvvoooolllllttttaaaagggggggggeeee ttttoooo sssshhhhhhhhoooorrrrrrrrrtttttt---ccccciiiiirrrcuuuuuiiiiittttt ccccuuuurrrrrrrreeeenntttttt::::
o If short-circuit current is directed from b to a is,a minus sign must be inserted in the equation.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 80
![Page 81: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/81.jpg)
4.10. Thévenin and Norton Equivalents
o When terminals a and b are open,there is no current in 4 resistor, andvab is identical to v1.
o Thévenin voltage for circuit is 32 V.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 81
o When terminals a and b are openn,,,there is no currentt iiiinnnnnnnn 4444444444444 rrrrrrrreeeeeeeessssssssiiiiiiiiiiisssssssstttttttttttoooooooorrrrrr,, aaaaaaaaaannnnnnnnnnnnnddddddddddddvab is identtttiiiiicccccccccccaaaaaaaaaaaalllllll ttttttttttttooooooooo vvvvvvvv1111.
o Thévenin voltage for circuit is 32 V.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 81
![Page 82: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/82.jpg)
4.10. Thévenin and Norton Equivalents
o The short-circuit current (isc) is found easilyonce v2 is known.
o Problem reduces tofinding v2 with the short-circuit in place:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 82
o The short-circcuuuuiiittttt ccccuuuurrrrrrreeeennnntttt (((((((iiisssssssscccccc)))))) iiissss ffffffffoooouuunnnndddddddd eeeeeeeeaaaaaasssiiiiilllllyyyyyyyonce v2 is kkkknnnoooowwwwnnn.....
o Problem reduces tofinding v2 with the short-circuit in place:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 82
![Page 83: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/83.jpg)
4.10. Thévenin and Norton Equivalents
o If a 24 resistor is connectedacross terminals a and b in original circuit,
voltage across resistor is 24 V andcurrent in the resistor is 1 A,
as would be the case with Thévenin circuit.
o This same equivalence between circuits holdsfor any resistor value connected between nodes a and b.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 83
o If a 24 resisstttoooorrrr iiissss cccoooonnnnnnnneeeccctttteeeedddddddddddacross termmmiiinnnnaaaallllllllsss aaaa aaannnddddddd bbbbbb iiiiinnnn oooorrrriiiiiiiggggggggiiiiinnnnaaaallllll ccccciiirrrrrccccuuuitttt,,,,,,,
voltage across rrreeeeeeeesssiiisssssttttooorrrr iiiissss 222224444 VVVV aaaaannnnddddddcurrent in the resiisssstttooorrrr iiiss 111 AAAA,
as would be the case with Thévenin circuit.
o This same equivalence between circuits holdsfor any resistor value connected between nodes a and b.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 83
![Page 84: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/84.jpg)
4.10. Thévenin and Norton Equivalentso A Norton equivalent circuit consists of:
an independent current source in parallel withNorton equivalent resistance.
o We can derive it froma Thévenin equivalent circuit simply by
making a source transformation.
o Norton current equalsshort-circuit current at terminals of interest.
o Norton resistance is identical toThévenin resistance.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 84
o A Norton equivalent circuit consists of:an independent current source in parallel withNorton equivalent resistance....
o We can derive it froma Thévenin equivalent circuuuiiiittttt sssssssiiiimmmmmmmppppppplllllyyyyyy bbbyyy
making a source ttttttttttrrrraaaaaaaaannnnssssffffffoooorrrrrrrrrrmmmmaaaaaaattttiiiiooooonnnn...
o Norton currennnttttttttt eeeeeeqqqqqqqqqqqquuuuuuuuuuaaaallllssssssssssssshort-circuit currrrrreeeeeeeeeeeeeennnnnnnnnnntttttttt aaaaaattttttt ttttttttttteeeeeeeeerrrrrrrrrmmmmmmmmmmmmmmiiiiiinnnnnnnnnnnnaaaaaalllsssssssssss ooooooooooofffffffff iiiiinnnnnnnnnnnttttttteeeeeeeeeeeeerrrreeeeessssssssssssttttttttt......
o Norton resistance is idennnnnnnnnnnnnttttttttttttiiiiiiiiiiccccccccccccaaaaaaaaaaalllllllllll ttttttttttooooooooooThévenin resistance.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 84
![Page 85: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/85.jpg)
4.10. Thévenin and Norton Equivalentso Sometimes, we can make effective use of source transformations
to derive a Thévenin or Norton equivalent circuit.
o This technique is most useful whenthe network contains only independent sources.
o The presence of dependent sources requiresretaining identity of controlling voltages and/or currents.
o This constraint usually prohibitscontinued reduction of circuit by source transformations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 85
o Sometimes, we can make effective use of source transformationsto derive a Thévenin or Norton equivalent circuit.
o This technique is most useful wwwhhhheeeeeeennnnnnnthe network contains only innnnnnndddddddeeeepppppeeeennnndddddddeeeeeeennnnt sources.
o The presence of dependent souurrrcccceeeeeeeesssssssssss rrrrrrreeeeeeqqqquuiiiresretaining identity ooffff ccccccoooooooooooonnnnnnnnnnnnttttttttttrrrrrrrrrrooooooooooolllllllllllllllllliiiiiiinnnnnnnnngggggggggg vvvvvvvooooooooooolllllllttttttttaaaaaaaaaaaaagggggggggggggeeeeeeeeeeessssssss aaaaaaannnnnnnnnnnnddddddddd//////////ooooorr currents.
o This constrainnnttttt uuuuuuuuuuussssssssssssuuuuuuuuuuuuaaaaaaaaaaallllllllyyyyyyyyyyyy ppppppppppprrrrrrrrrrroooooooooooohhhhhhhhhhhiibbbbbbbbbbbbiiiiiiiiiiitttttttttttssssssssssscontinued reducttttttttttttiiiiiiiiiiooooooooooooonnnnnnnn oooooooofffffff ccccccccccccciiiiirrrrrrrrrrccccccccccccuuuuuuuuuuuuuiiiiiiiiittttttt bbbbbbbbbbbyyyyyyyyyyy ssssssssssoooooooooouuuuuuuuuuuuuurrrrrrrrccccccccccceeeeeeeeeeee tttrrrrrrrrrrraaaaaaaannnnnnnnnnnnnnnsssssssssfffffffffoooooooooooooorrrrrrmations.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 85
![Page 86: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/86.jpg)
4.10. Thévenin and Norton Equivalents
o Thévenin Equivalent:
o Norton Equivalent:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 86
o Thévenin Equuiiivvvvaaalllleeennnnttt::::
o Norton Equivalent:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 86
![Page 87: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/87.jpg)
4.10. Thévenin and Norton Equivalentso Find the Thévenin equivalent for the
circuit containing dependent sources.
o Current ix must be 0.Note the absence of a return path for ix to enter left-hand portion of circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 87
o Find the Thévenin equivalent for the circuit containing dependent sources.
o Current ixi must be 0.Note the absence oooffffffffffff aaaaaaaaaaa rrrrrrrrrreeeeeeeeeeettttttttttttuuuuuuuuuuurrrrrrrrrrrrrnnnnnnnnnnn ppppppppppaaaattttttthhhhhhhhhhhh fffffffffooooooooooooorrrrrrrrrr iiiiiiixxxxxxxxxxxxxi tttttttooooooooo eeeeeeeeennnnnnnnnttttteeeer left-hand portion of circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 87
![Page 88: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/88.jpg)
4.10. Thévenin and Norton Equivalentso Find the Thévenin equivalent for the
circuit containing dependent sources.
o With short circuit shunting 25 ,all current from dependent current source appears in short circuit:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 88
o Find the Thévenin equivalent for the circuit containing dependent sources.
o With short circuit shunting 25 ,,,,all current from dependent ccccuuuuuurrrrrrrrrrrrreeeeeeennnnnnntttttt source appears in shhhoooorrtt ccciiirrcccuuiittt::::
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 88
![Page 89: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/89.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 89
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 89
![Page 90: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/90.jpg)
4.11. More on Deriving a Thévenin Equivalento Technique for determining RTh we discussed is
not always the easiest method available.
o 2 other methods generally are simpler to use.
o The first is useful if network containsonly independent sources.
o To calculate RTh for such a network, we:deactivate all independent sources,calculate resistance seen
looking into network at designated terminal pair.
o A voltage source is deactivated by replacing it with a short circuit.
o A current source is deactivated by replacing it with an open circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 90
o Technique for determining RTh we discussed isnot always the easiest method available.
o 2 other methods generally are ssssiiimmmmmmmppppppplllllleeeeeeerrrrr ttttoooo use.
o The first is useful if network connnnnnntttttttaaaaaaiiiinnnnsssssssonly independent sources.
o To calculate RTh for succcchhhhhhhhhhh aaaaaaaaaaa nnnnnnnnnnnnnneeeeeeeeeeeeettttttttttttwwwwwwwwwwwwwwooooooooooorrrrrrrrrkkkkkkkkkkk,,, wwwwwwwwwwwweeeeeeeeeee::::::::::deactivateeee aaaaaaaaaaaallllllllllll iiiiiiiinnnnnnnnnnnnnnndddddeeeeeeeeeeepppppppppppeeeeeeeeeeeeennnnnnnnnnnnnddddddddddddeeeeennnnnnnnnnntttttttttt ssssssssssooooooooooooooouuuuuuuuuuuurrrrrrrrrccccccccccccceeeeeeeeeeeeessssssssssss,,,,,,,calculate resistannnnnnnnccccccccccceeeeeeeeeeeeee ssssseeeeeeeeeeeeeeeeeennnnnnnnnnnnn
looking into netwooooooooooorrrrrrrrrkkkkkkkkkkkkkk aaaaaaaaaaaattttttttttttt ddddddddddddeeeeeeeeeessssssssssiiiiiiiiiiigggggggggggggnnnnaaaaaaaattttttteeeeeeeeeeeeeddddddddddddd tttttttttttteeeeeeeeeeerrrrrrrrrrrmmmmmmmmmmmmmiiiiiiiiinnnnnnnnaaal pair.
o A voltage source is deactivated by replacing it with a short circuit.
o A current source is deactivated by replacing it with an open circuit.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 90
![Page 91: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/91.jpg)
4.11. More on Deriving a Thévenin EquivalentFirst alternative procedure to find RTh
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 91
First alternative procedure to find RTh
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 91
![Page 92: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/92.jpg)
4.11. More on Deriving a Thévenin Equivalento If circuit or network contains dependent sources,
an alternative procedure for finding RTh is as follows:We first deactivate all independent sources.We apply either
a test voltage source ora test current source
to Thévenin terminals a and b.Thévenin resistance equals
ratio of voltage across test source to current delivered by test source.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 92
o If circuit or network contains dependent sources,an alternative procedure for finding RTh is as follows:
We first deactivate all indeeeeeeeppppppppeeeeeeeennnnnndddddddeeeeeeennnnntttt sources.We apply either
a test voltage source oooorrrra test current sssoooouurrrccceee
to TTTThhhhéééévvvveeeennnniiiinnnn ttttteeerrrmmmmiiiiinnnnaaaallllllssss aaaa aaaannnnddddddddddd bbbbbbbbbbbbbb...Théveniiiinnn rrrreeeessssiiiiiiissssttttaaaannnccceeee eeeeqqqquuuuaaaalllllssss
ratio of voltttaaggggggggeee aaaaaccccrrrroooossssssss tttteeeessstttt sssssooooouuuurrrrcccceeeeeeee tttttoooo ccccuuuurrrrrreeennnnt delivered by test source.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 92
![Page 93: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/93.jpg)
4.11. More on Deriving a Thévenin EquivalentSecond alternative procedure to find RTh
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 93
Second alternative procedure to find RTh
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 93
![Page 94: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/94.jpg)
4.11. More on Deriving a Thévenin Equivalento We can use a Thévenin equivalent to
reduce one portion of a circuit togreatly simplify analysis
of larger network.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 94
o We can use a Thévenin equivalent toreduce one portion of a circuit to
greatly simplify analysisof larger network.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 94
![Page 95: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/95.jpg)
4.11. More on Deriving a Thévenin Equivalento This modification has no effect on branch currents i1, i2, iB, and iE.
o We replace circuit made up of VCC, R1, and R2
with a Thévenin equivalent,with respect to terminals b and d.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 95
o This modification has no effect on branch currents i1, i2, iB, and iE.
o We replace circuit made up of VCCVV , CC RR11, and R2
with a Thévenin equivalent,,,,with respect to terminalssssss bbbbbbb aaaannnndddd ddddddd....
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 95
![Page 96: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/96.jpg)
4.11. More on Deriving a Thévenin Equivalent
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 96Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 96
![Page 97: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/97.jpg)
4.11. More on Deriving a Thévenin Equivalent
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 97Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 97
![Page 98: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/98.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 98
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 98
![Page 99: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/99.jpg)
4.12. Maximum Power Transfero We assume
a resistive networkcontaining independent and dependent sources and
a designated pair of terminals a and b,to which a load RL, is to be connected.
o Problem is to determine value of RL thatpermits maximum power delivery to RL.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 99
o We assumea resistive network
containing independent annnnnnnddddddd dddddddeeeeeeepppppppeeeeeennnndddent sources anda designated pair of terminaaaaaaalllllllsssssss aaaaaa aaaannnnnnddddddd bbbbbbb,,,
to which a load RL, is to bbbbeeeeee ccccccooooooonnnnnnnnnnnneeeeeeecccccttteeed.
o Problem is to determinneeeeeeeeee vvvvvvvvvaaaalllluuuuuuuuueeee ooooooffff RRRRRRLLLLLLL ttttthhhhaaaattttttpermits mmmaaaaaxxxxxxxxxxxxiimmmmmmmmmmmuuuummmmmmmmmmm pppppppppoooowwwwwwwwweeeeeerrrrrrrrr ddddddeeeeeeeeelllliiiivvvveeeerrryyyyyyyyyyy tttttoooo RRRRLLLLLLLLLL...
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 99
![Page 100: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/100.jpg)
4.12. Maximum Power Transfero Replacing original network by its Thévenin equivalent
greatly simplifies task of finding RL.
o Derivation of RL requiresexpressing power dissipated in RL
as a function of 3 circuit parameters VTh, RTh, and RL:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 100
o Replacing original network by its Thévenin equivalentgreatly simplifies task of finding RL.
o Derivation of RL requiresexpressing power dissipatedddddddd iiiinnnn RRRRLLLLL
as a function of 3 circuit ppppaaaaaaarrrrrrraaaaaaammmmmmmeeeeeetttttteeeeerrrsss VThVV , RTh, and RL:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 100
![Page 101: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/101.jpg)
4.12. Maximum Power Transfer
Derivative is 0 and p is maximized when:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 101
Derivative is 0 and p is maximizedddddd wwwwwwwwwwwwwwwhhhhhhhhhhheeeeeeenn:
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 101
![Page 102: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/102.jpg)
4.12. Maximum Power Transfer
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 102
RL = 25
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 102
RL = 25
![Page 103: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/103.jpg)
4.12. Maximum Power Transfer
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 103Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 103
![Page 104: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/104.jpg)
Chapter Contents4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Current Method4.6. MCM and Dependent Sources4.7. MCM: Some Special Cases4.8. NVM Versus MCM4.9. Source Transformations4.10. Thévenin and Norton Equivalents4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 104
4.1. Terminology4.2. Introduction to the Node-Voltage Method4.3. NVM and Dependent Sources4.4. NVM: Some Special Cases4.5. Introduction to the Mesh-Currrrrrrreeeeeeennnnnntttttt MMMMMMMMeeeeeeettttthhhod4.6. MCM and Dependenttt SSSSoouuurrrrcceeeess4.7. MCM: Somee SSSSppppppeeecccciaaaalll CCCCCCCaaaasssseeeessss4.8. NVM Versusss MMMMMMCCCCCCCMMMMM4.9. Source Transformaatttiiioooooonnnsssss4.10. Thévenin and Nortonnn EEEEqqquuuuiiivvvaaallleeennnttsss4.11. More on Deriving a Thévenin Equivalent4.12. Maximum Power Transfer4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 104
![Page 105: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/105.jpg)
4.13. Superpositiono A linear system obeys principle of superposition, i.e.,
whenever a linear system is excited, or driven,by more than one independent source of energy,
total response is sum of individual responses.
o An individual response is result ofan independent source acting alone.
o Because we are dealing withcircuits made up of interconnected linear-circuit elements,
we can apply superposition directly to analysis of such circuits.
o At present, we restrict the discussion to simple resistive networks.
o Principle is applicable to any linear system.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 105
o A linear system obeys principle of superposition, i.e.,whenever a linear system is excited, or driven,
by more than one indepennnnnnndddddddeeeeeeeennnnnntttttt ssssssoooooouuuurce of energy,total response is sum ooooooofffffff iiiiiinnnnnnddddiiiivvvvvviiiiiiiddddddduuuuual responses.
o An individual response is resulttt oooooofffffffan independent souuuuuuuurrrrccccccccceeee aaaaaaccccccttttiiiiiiiiinnnngggg aaaallllllooooonnnneeee....
o Because we arrreeeeeeeeeeeeee dddddddddeeeeeeeeeaaaaallliiiinnnnnnnnnnnngggggggggggg wwwwwwwwwwwwwwwiiiitttttttttthhhcircuits made up oooooooooooooofffffffffff iiiiiinnnnntttttttteeeeeeeeerrrrrrrrrrrccccccccooooooooooooonnnnnnnnnnnnnnnnnnnnnneeeeeeeeeccccccccctttttteeeeeeeeeeeeddddddddddd lllllllliiiiiinnnnnnnnnnnneeeeeeeeeeeaaaaaaaaaaaarrr---ccccccccccccciiiiiiiirrrrrrrrrrrccccuuuuuuuuuuuiiiiiiiiiiiittttt elements,
we can apply supeeeerrrrrrrrrrrpppppppppppppppoooooooooooossssssssssssiiiiiiiitttttttttiiiiiiiioooooooooonnnnnnnnnnn dddddddddddiiiirrrrrreeeeeeeeeeecccccccccttttttttttttllllllllyyyyyyyyyyyy tttttttttoooooooooo aaaaaaaaaaaaannnnnnnnnnnnnnaaaaaaalllysis of such circuits.
o At present, we restrict the discussion to simple resistive networks.
o Principle is applicable to any linear system.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 105
![Page 106: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/106.jpg)
4.13. Superpositiono Superposition is applied in both analysis and design of circuits.
o In analyzing a complex circuitwith multiple independent voltage and current sources,
there are often fewer, simpler equations to solveby applying superposition.
o Applying superposition can simplify circuit analysis.
o Sometimes, applying superposition actually complicates analysis,producing more equations to solve.
o Superposition is required only ifindependent sources in a circuit are fundamentally different.
o When all independent sources are dc sources,superposition is not required.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 106
o Superposition is applied in both analysis and design of circuits.
o In analyzing a complex circuitwith multiple independent vvvvooooolllllllttttttttaaaaaaaggggggeeeeeee aaaaaannnnddd current sources,
there are often fewer, simmmmmmmpppppplllllleeeerrrr eeeeqqqqqquuuuuuuaaaaaations to solveby applying superpositttiiiioooooonnnnnnnn..
o Applying superpositionnn cccccccaaaaaaaaaaannnnnnnnn sssssssssssiiiiiimmmmmmmmmmmmmpppppppppppllllllliiiiiiiiffffffffffyyyy ccccccciiiiiiirrrrrrrrrcccccccccuuuuuuuuuuuiiiiiittttttttt aaaaaaaaannnnnnnaaaaaaaaaaaalllllyyyyyyyyyyyyyssssssssiiissss.
o Sometimes, aaapppppppppppppppppppppppllllllyyyyyyyyyyyyiiiiiiiiiinnnnnnnnnnngggg sssssssssssuuuuuuuuuuuupppppppppppppppeeeeeeeeeeeeerrrrrrrrppppoooooooooooossssssssssiiiiiiiiiittttttttiiiiiiiiiiiioooooooooooooonnnnnnnnnnn aaaaaaaaaaaaacccccccccccctttttttttttttuuuuuuuuuuuaaaaalllllllllllllllllllllyyyyyyyyyyy ccccooooooooooooommmmmmmmmmmmmpppppppppppllllllllllliiiiiiiiiccccccccccccaaaaaaaaaaatttttttttttteeeeeeeeeeeeesssssssssssss aaaaaaaaaaaannnnalysis,producing more eeeeeeeeeeqqqqqqqqqqqqquuuuuuuuuuuuaaaaatttttttiiiiioooooooooonnnnnnnnnssssssssss tttttttttttoooooooooooooo ssssooooooooooollllllvvvvvvvvvvvveeeeeeeeeee...
o Superposition is requireeddddddddddddd oooooooooonnnnnnnlllllllyyyyyyyy iiiiiiiiifffffffffindependent sources in a circuit are fundamentally different.
o When all independent sources are dc sources,superposition is not required.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 106
![Page 107: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/107.jpg)
4.13. Superpositiono Superposition is applied
in design to synthesize a desired circuit response thatcould not be achieved in a circuit with a single source.
o If desired circuit response can be written asa sum of two or more terms,
response can be realized by includingone independent source for each term of response.
o This approach to design of circuits with complex responsesallows a designer to
consider several simple designsinstead of one complex design.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 107
o Superposition is appliedin design to synthesize a desired circuit response that
could not be achieved in a ccccccciiiiiirrrrrrrrccccccuuuuuuuiiiiiitttttttt wwwwwiiith a single source.
o If desired circuit response can bbbbbbbeeeeeee wwwwrrrriiiitttttttteeeeennnnnnn aaasa sum of two or more termssss,
response can be rrrrrrrrreeeeeeeaaaaaaallliiiizzzzeeeeeeeeeeddddddddd bbbbyyyy iiiinnnnnnnccccclllluuuddddddiiinnnnggggone iiinnnnnnnddddddddddeeeeeeeeeeppppppppeeennnnnnnnnddddddddeeeennnntttt ssssssooooooooouuuuuuuuuurrrrccccccccceeee ffffoooorrr eeeeeeeeaaaaccchhhh tttttttteeeeeeeeerrrrrrrrmmmmmmm oooooooooffff rrrreeeesssssspppppppoooonnnsssseeee.
o This approach to dessssssiiiiiiiiiigggggggggggggnnnnnnnnnnn oooooofffffff cccccccccccciiiiiiirrrrrrrrrccccccccccccuuuuuuuuuiiiiiiiitttttttttttsssssssss wwwwwwwwwwwwwiiiiiiiiittttttttttthhhhhhhh cccccccccccccoooooooooommmmmmmmmmmmmppppllllllleeeeeeeeeeeeexxxxxxxxxxx rrrrrreeeeeeeeeeesssssssssppppponsesallows a designer to
consider several simple designsinstead of one complex design.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 107
![Page 108: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/108.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 108Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 108
![Page 109: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/109.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 109Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 109
![Page 110: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/110.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 110Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 110
![Page 111: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/111.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 111Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 111
![Page 112: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/112.jpg)
4.13. Superpositiono When applying superposition to linear circuits
containing both independent and dependent sources,you must recognize that dependent sources are never deactivated.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 112
o When applying superposition to linear circuitscontaining both independent and dependent sources,
you must recognize that deeeeeeeppppppppeeeeeeeennnnnndddddddeeeeeeennnnntttt sources are never deactivated.
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 112
![Page 113: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/113.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 113Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 113
![Page 114: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/114.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 114Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 114
![Page 115: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/115.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 115Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 115
![Page 116: Chapter 4. Techniques of Circuit Analysis - KNTU …wp.kntu.ac.ir/faradji/EC1/EC1_Ch4.pdf · 2016-10-24 · Electrical Engineering, ... o To discuss the more involved methods of circuit](https://reader037.vdocument.in/reader037/viewer/2022102709/5b2e68d87f8b9a55208bee55/html5/thumbnails/116.jpg)
4.13. Superposition
Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 116Electric Circuits 1 Chapter 4. Techniques of Circuit Analysis 116