chapter 2shodhganga.inflibnet.ac.in/bitstream/10603/15789/13... · drops of kovac’s reagent...

MATERIALS AND METHODS

Chapter 2

2. MATERIALS AND METHODS

The present study was taken to isolate efficient detergent

degrading bacteria from the detergent contaminated soil of Kerala,

India. Extensive screening was done to isolate efficient bacteria for the

treatment of detergent contained wastewater. Conditions favourable

for the degradation were optimized and the metabolic byproducts were

analyzed. The general procedure and special techniques as well as

the materials used in this study are detailed in this chapter.

2.1 Isolation and screening of SDS degrading bacteria

2.1.1 Collection of soil samples

Soil samples were collected from different parts of detergent

contaminated domestic laundry premises of meenachil river shore

located in Kottayam, Kerala, India. A total of 14 samples were used for

the isolation of SDS degrading bacteria. Five different samples were

collcted from a single location. Samples were mixed and

homogenized. From the mixed samples about 50 gram of soil were

taken as representative samples of particular location.

2.1.2 Isolation of SDS degrading bacteria

10 gm of soil was collected from detergent contaminated area,

mixed with 90 ml of sterile distilled water containing filter sterilized

100mg/litre of SDS and was incubated in a rotatory shaker at 150 rpm

at room temperature (30 ± 20C) for 24 hours .After incubation the

above soil samples were subjected to serial dilution using sterile

distilled water and were pour plated with nutrient agar medium.

(Appendix 1). The plates were incubated at 48 hours and the colony

count was taken. The same procedure was repeated by the

42 Chapter 2

enrichment of soil extract progressively with 500 mg/litre ,1000

mg/litre,1500 mg/litre SDS concentration and the respective colony

count were taken.

2.1.3 Screening of the SDS degrading isolates

All the colonies isolated by soil enrichment technique were

individually inoculated into 10 ml of mineral salt medium supplemented

with filter sterilized SDS (100mg/litre). The composition of the mineral

medium used was (mg/litre) KH2PO4, 1500; K2HPO4, 3500;

MgCl2.6H2O, 150; NaCl, 500; Na2SO4 140. The medium also

contained the following trace elements (1 ml stock): FeCl2.6H2O, 240;

CoCl2.6H2O, 40; CuSO4.5H2O, 60; MnCl2.4H2O, 30; ZnSO2.7H2O, 310

g; and NaMoO2.2H2O, 30. Incubation was carried out at room

temperature (30 ± 20C) for 24 hours. The isolates, which showed

growth were used to inoculate individually into MSSM with 500 mg/litre

SDS concentration .The same procedure was repeated and the isolate

which showed growth were inoculated into MSSM with 1000 Mm SDS

concentration. The same procedure was repeated with 1500 mg/litre

SDS containing MSSM. The colonies which showed growth in MSSM

enriched with 1500 mg/litre concentration was selected as the SDS

degrading strains. The selected cultures were purified by repeated

streaking and were stored at 200 C in 50 Mm KH2PO4 buffer at pH 7.2

containing 20% glycerol .Working cultures were maintained by sub

culturing every two weeks on mineral salt agar slants containing SDS

at 1500 mg/litre

Materials and Methods

43

2.1.4 Screening of SDS degradation by MBAS assay

When a microorganism is grown in a medium containing SDS,

the ability to utilize SDS can be assessed by finding out the level of

SDS left over. The concentrations of anionic surfactant (SDS) were

determined by a modified version of the Methylene blue active

substance (MBAS) assay as described by Hayashi (1975). The

method is based on the formation of a complex between the anionic

surfactant and an excess of the cationic dye Methylene blue, followed

by extraction of the complex (but not excess dye) into chloroform and

measurement of the absorbance of the blue chloroform layer at

655nm.

R SO3 +(Me)N S

N

N2 (Me)2

+

-

+

R SO3

-

(Me)N S

N

N2 (Me)2

+

+

AS MB

AS-MB

A stock solution of methylene blue (0.0625g in 100ml of

distilled water) was under laid with 10ml of chloroform to remove any

chloroform extractable impurities and was stored in a brown bottle to

minimize photochemical degradation.

44 Chapter 2

Alioquots of methylene blue solution (0.1ml), 0.4ml of 0.825Mm

phosphate buffer (pH 7.2), and an appropriate volume of sample (up to

1ml, in triplicate) were mixed in acid-washed, optically matched glass

tubes (12cm by 1cm (internal diameter) and vortexed intermittently five

times for 3 seconds each time. Chloroform was added to each tube and

the contents were vigorously vortexed for 5 seconds. The tubes were

allowed to stand at 40C for 5 minutes, followed by centrifugation at

2,000 rpm for 4 minutes. The tubes were allowed to warm to room

temperature, and the absorbance of the chloroform layer was measured

at 655nm, against an appropriate blank.

Single colonies from MSSM agar plates were inoculated into

nutrient broth and they were incubated aerobically at 300c with

shaking at 150 rpm. The cultures were allowed to grow till optical

density of 1 OD was obtained in 620nm. 1ml of such cultures were

centrifuged, cells were washed and resuspended in MSSM medium.

The cell suspension was used to inoculate 1 OD flasks containing

MSSM media supplemented with 0.1% SDS. The cultures were

incubated at 30oc for 48 hours. Appropriate volumes of sample were

analyzed in triplicates.

655 655

655

A experimental-A blankPercentage of anionic surfactant left over = X 100

A Standard


45

Scheme for Modified MBAS assay

2.1.5 HPLC analysis of SDS degradation

The biodegradation was confirmed by isocratic HPLC

(Shimadzu) analysis using reverse phase C-18 column equipped with

SPD 20 A UV detector (220 nm). The mobile phase gradient was

acetonitrile –water (95:5). Flow rate was 1ml/min. Data acquisition and

processing was performed by using LC solution system software.

(Shimadzu).

1ml sample

Keep at 40C for 5 min.

Centrifuge at 2000 rpm for 4 min

Absorbance at 655 nm

Shake well

400l phosphate buffer pH 7.2

100l Methylene blue stock

Vortex for 5 sec

Aqueous phase

CHCl3 layer

46 Chapter 2

2.2 Identification of selected bacteria

The selected isolates were subjected to cultural, morphological,

biochemical and physiological characterization as mentioned in

Bergey’s manual of determinative bacteriology (Holt et al., 1994) and

confirmed by 16S rDNA sequencing. 16S rDNA sequencing was done

at Institute of microbial technology, Chandigarh, UP, India.

2.2.1. Morphological, cultural and biochemical tests for identification of the isolates

1 . Morphological tests

● Colony morphology

● Gram’s staining

● Endospore staining (Shaffer-Fulton method)

● Motility by hanging drop

2. Physiological tests

Growth at different temperature (0C): (8, 15, 20, 25, 30, 37, 42, 52)

Growth at different pH: (4, 5, 6, 7, 8, 9)

Growth at different NaCl (%): (2, 4, 5, 7, 10)


47

3. Biochemical testes

Growth on MacConkey agar

The isolates were inoculated on to MacConkey agar medium,

incubated at 370C for overnight and observed for growth and lactose

fermentation.

Indole test

The organisms were grown in tryptone broth for 48 hr at 370C.

Development of a cherry red colour at the upper layer by adding five

drops of Kovac’s reagent (prepared by adding 10 g of p-dimethyl

aminobenzaldehyde in 150 ml of isoamylalcohol and then added 50 ml

of HCl.) indicated a positive test

Methyl red (MR) test

To 5 ml culture in MR-VP broth added 5 drops of methyl red

indicator solution (0.2% in 50% alcohol). Appearance of red colour

indicated a positive test.

Voges Proskauer (VP) test

Barritt’s reagent and MR-VP medium were used. In this test,

production of acetoin (acetyl methyl carbinol) was detected by the

addition of few drops of 5% alpha naphthol in 0.2 ml of 40% aqueous

solution of KOH. The mixture in the tubes were shaken vigorously for

few minutes and allowed to stand for two hours. Positive reaction was

shown by development of crimson ruby colour.

48 Chapter 2

Citrate utilization test

Tubes containing Simmons’s citrate agar media were

inoculated by each organism. Following incubation citrate positive

cultures were identified by the presence of growth on the surface of

slant accompanied by blue colouration.

H2S production test

Filter paper strips were saturated with 5% led acetate solution,

air dried and autoclaved at 10 lb pressure for 15 min. Inoculated the

nutrient broth tubes with the desired culture and the led acetate strips

were inserted above the liquid between the plug and inner wall of

tube. Tubes were Incubated and examined the blackening of paper,

indicating H2S production.

Casein hydrolysis test

Skim milk agar plates were prepared. Plates were incubated at

300C for 4 days after spot inoculation and observations were taken

regularly. Formation of clear zone was taken as positive.

Esculin hydrolysis test

Bile esculin medium in plate was inoculated with one to three

colonies of the organism to be tested and incubated at 370C in an

ambient atmosphere for up to 48 hr. A definite blackening of the plated

medium is considered as a positive test.

Gelatin hydrolysis test

Gelatin agar medium was prepared by adding 12% gelatine in

nutrient broth, dispensed in tubes and autoclaved at 1210C for 12


49

minutes. Gelatin tubes were inoculated by stabbing to the bottom and

incubated at 370C along with uninoculated controls for 30 days.

Liquefaction at weekly intervals was detected after placing the tubes

in refrigerator for 30 minutes.

Starch hydrolysis test

Starch agar (prepared by adding 20 ml of 10% starch solution,

steamed for 1 hr in 100 ml of melted nutrient agar) poured in petriplates

was inoculated with test organisms and incubated for 3-5 days. The

plates were flooded with Gram’s iodine solution. Blue colour of medium

with colourless areas around growth indicated a positive test.

Urea hydrolysis test

Christensen’s urease agar medium containing the indicator

phenol red were inoculated with test cultures and incubated at 370C

for 18-24 hrs. A rose red pink colour was an indication of positive test

for urease.

Nitrate reduction test

The cultures were grown in nitrate peptone broth containing

potassium nitrate – 2 g, peptone- 5 g, distilled water- 1000 ml for five

days and five drops of solution A and B each were added.

Solution A: Sulfanilic acid -8 g; Acetic acid 5 N – 1 litre

Solution B: α- Napthylamine- 5 g; Acetic acid 5 N – 1 litre

The tubes showing red colour within two minutes were taken as

positive test for nitrate reduction test.

50 Chapter 2

Catalase test

A small portion of microbial growth from solid medium was

taken and emulsified with a drop of H2O2 (3-6%). Immediate

effervescence indicated a positive catalase reaction.

Oxidase test

A strip of filter paper moistened with 1% solution of tetra methyl

para phenyline diamine dihydrochloride was placed on the lid of a

Petri dish, using a sterile platinum wire loop small portion of growth

was taken and applied on the filter paper. Immediate development of

deep purple colour indicated the test organism as oxidase positive.

Lysine and ornithine decarboxylase and arginine dihydrolase

Definitive tests for lysine and ornithine decarboxylase and

arginine dihydrolase and to confirm the organism’s ability to ferment

glucose was carried out in Moeller’s decrboxylase broth media. This

medium contains glucose, bromocresol purple, a nitrogen source,

cresol red indicator, the enzyme activator pyridoxal and the amino acid

to be tested. The tubes were inoculated with a small amount of growth

from isolated colonies. All tubes were overlaid with sterile mineral oil

to a depth of 1 cm to prevent introduction of O2. Tubes were incubated

at 370C for up to 14 days, although results could be read in 2 days. A

change in the medium colour to purple indicates positive test and the

organism’s ability to utilize to aminoacid to form alkaline end products.

A yellow colour indicates that only the glucose was utilized, with the

formation of acid. A grey colour may indicate reduction of the indicator

rather than alkaline end products.


51

Hippurate hydrolysis

The end products of hydrolysis of hippuric acid include glycine

and benzoic acid. Glycine is deaminated by the oxidizing agent,

ninhydrin, which becomes reduced during the process. The end

products of the ninhydrin oxidation react to form a purple coloured

dye. A loopful of an overnight growth on heart infusion agar containing

5% defibrinated rabbit blood was emulsified in 0.4 ml of 1% aqueous

sodium hippurate. The dense suspension was incubated in a 37°C

water bath for 2 hrs. After incubation, 0.2 ml of ninhydrin solution

(3.5% ninhydrin in a 1:1 mixture of acetone and butanol) was slowly

added with a pipette down the side of the tube to form an overlay.

After incubation for a further 10 min in the 37°C water bath, the tube

was examined for the appearance of a deep purple colour.

Tyrosine degradation

Microorganisms were grown in liquid culture, with shaking on a

test tube shaker (300 rpm) for 7 days at 30C. The medium (pH 7.0)

contained 0.2% (NH4)2SO4, 0.1% KH2PO4, 0.05% MgSO4, 0.02% yeast

extract and 2.0% amino acid tyrosine as a sole carbon source. After

cultivation for 7 d, amino acid metabolizing bacteria were selected by

turbidity.

Tween hydrolysis

Medium was prepared by adding 1 ml of Tween, 20, 40, 60 and

80 (Sigma) to molten nutrient agar and cooled to 550C. mixed gently

several times to disperse the tween and poured into Perti dish. Spot

inoculated the culture under test on to the plate. Known positive and

negative bacteria were also included. The plates were placed in a

52 Chapter 2

plastic bag to keep them moist and incubated at 370C up to 5 days.

Tween positive colonies that develop a clearly visible halo of

precipitated fatty acids when viewed against a dark background

2.3 Molecular characterization of the isolates

2.3.1 16S rDNA typing

Currently, 16S r DNA sequence is by far the preferred phylogenitic

marker used in microbial ecology. As molecular chronometers, r DNA

sequences have preserved their evolutionary history. Highly conserved

portions carry the information of early evolutionary events and changes that

are more recent occur within less conserved positions or stretches. The

degree of divergence of present day r DNA sequences gives an estimate of

their phylogenitic distances. PCR amplification of bacterial 16S r DNA

sequence can be carried out using universal bacterial primers. The obtained

16S rDNA amplicons are sequenced, and comparatative analysis using

comprehensive database of bacterial 16S rDNA gene sequences with

appropriate software allows rapid identification of unknown bacteria the

general protocol is described below.

Isolation of bacterial genomic DNA (Pitcher et al., 1989)

1. Starting material was a well grown 24-48 hr old pure culture from

MSSA plates.

2. Cells were removed with a sterile loop and resuspended in 0.5-1

ml resuspension buffer (RB) (0.15M NaCl, 0.001M EDTA pH: 8).

3. Cells were pelleted by centrifugation at 8000 rpm for 5 minutes

and supernatent was removed using a 1 ml micro tip.

4. Cells were again pelleted and removed the supernatant using a

200 µl micro tip.


53

5. 100 µl of TE was added to the pellet and mixed using a pipette

and added 100 µl of lysozyme (50 mg/ml).

6. 500 µl of GES (Guanidium thiocyanate-EDTA-Sarkosyl solution)

was added and mixed the reaction vials gently.

7. Incubated the mixture for 5 min. on ice.

8. 250 µl of cold (-200C) ammonium acetate (7.5M) was added to

the above solution, mixed the tubes by shaking gently and

incubated for 5 minutes on ice.

9. Added 500 µl chloroform-isoamyl alcohol (24:1), shook

vigorously until the solution was homogenously milky, and

centrifuged the mixture at 10,000 rpm for 10 min. or until the

upper phase was clear.

10. Numbered tubes were prepared with 378 µl isopropanol at -200C.

11. Carefully removed 700 µl DNA-solution of the upper phase using

a 1000 µl micro tip and added the DNA solution to the tubes

containing isopropanol.

12. Shook gently until a white cloud of precipitated DNA became

visible

13. Centrifuged the DNA and removed the supernatant as described

in step 3 and 4.

14. 150 µl 70% ethanol was added, centrifuged briefly and removed

ethanol with 200 µl pipette, repeated centrifugation and removed

residual ethanol.

15. Air dried the DNA pellet and redissolved in 200 µl TE, pH 8.

54 Chapter 2

16. Incubated at room temperature or at 40C until the DNA was

dissolved.

17. Incubated 1hr at 370C and stored the DNA at 40C.

Quantification of DNA

Reliable measurement of DNA concentration is important for

many applications in molecular biology including complete digestion of

DNA by restriction enzymes and amplification of target DNA by

polymerase chain reaction (PCR). DNA quantification is generally

carried out by spectrophotometric measurements.The purines and

pyrimidines in nucleic acid show absorption maxima around 260 nm

(dATP 259, dCTP 272; dGDP 253; dTTP 247).

(a). Spectrophotometric measurements

1. One ml of TE buffer was taken in a cuvette and calibrate the

spectrophotometer at 260 nm as well as 280 nm wavelength.

2. Twenty µl of original DNA solution was diluted with 3 ml TE buffer

mixed properly and recorded the optical density (OD) at both 260

and 280 nm using UV spectrophotometer (Hitachi, UV-2800)

3. The quality of DNA was judged from the ratio of the OD values

recorded at 260 and 280 nm. The A260/A280 ration around 1.9

(1.89-1.95) indicates best quality of DNA.

16S rDNA amplification by PCR

1. The conserved eubacterial 16S rDNA primers

8f – ( 5AGAGTTTGATCCTGGCTCAG3)

1492r –( 5TACGGATACCTTGTTAGCACTT 3)


55

2. Target sequence size ~ 1465 bp

3. PCR reaction mixture

1 µl of template DNA (= 100 ng of bacterial genomic DNA)

5 µl of 5X PCR buffer

2.5 µl of 2 Mm dNTPs

1.5 µl of 25 Mm MgCl2

1 µl of forward primer

1 µl of reverse primer

12 µl of nuclease free water

0.3 µl of Taq DNA polymerase

PCR reaction was carried out in Eppendrof AG22331 Thermal

Cycler

4. PCR reaction cycle

940C – 2 min.

940C – 20 sec.

550C – 15 sec.

720C – 2 min.

720C – 3 min.

The PCR products were size fractionated on 1.5% agarose gel

stained with ethidium bromide to check the amplification

56 Chapter 2

Cloning of 16S rDNA sequence

In PCR cloning Trap System 16S rDNA PCR product directly

used for cloning without any post PCR purification, modification or

dilution.

Ligation

PCR product ligate into Insert-ready PCR-TRAP Cloning

vector. 20 µl ligation reaction mix contains,

d H2O - 10 µl

10X ligase buffer - 2 µl

Insert-ready PCR-TRAP Vector - 2 µl

PCR product - 5 µl

T4 DNA ligase - 1 µl

This mix ligate overnight at 160C and used directly for

transformation

Transformation

Added 10 µl of each ligation mix to 100 µl GH- competent cells

and incubated and incubated on ice for 45 min. Heat shock the cells

for 2 minutes at 420C and then set the tubes on ice for 2 minutes.

Added 0.4 ml L.B medium (without tetracyciline) and incubate the cells

at 370C for 1 hr. Then plated 200 µl of cells on an LB- Tet plate

(containing 20 µg/ml of tetracycline) and stored at 37 0C. Transformed

colonies collected.


57

Sequencing Data

The sequence of the insert was determined using the automated

DNA sequencing service provided at Institute of Microbial Technology

(IMTECH), Chandigarah, India. The sequences were analyzed using

the gapped BLAST (www. ncbi.nlm.nig.gov) search algorithm and

aligned to their nearest neighbors. The sequences were deposited in

the NCBI gene bank data base. The phylogenetic tree for the isolate

was inferred by the neighbor-joining method using the soft ware

package MEGA (Molecular Evolutionary Genetics Analysis) version 3.1.

2.3.2 Isolation of plasmid DNA

Plasmid DNA was detected using Medox –EasyTM ultrapure

spin column plamid DNA mini preparation kit. The plasmid DNA was

selectively absorbed in silica gel based MX-10 column and other

impurities such as proteins, salts, nucleotides, oligos (<40-mer) are

washed away. The plasmid DNA is then eluted off the column and can

be used for any downstream application.

Plasmid isolation kit

Components

RNase-A (10 mg/ml)

Solution I

Solution II

Solution III

Wash solution

Elution buffer

MX-10 Column +

2.0 ml collection tube

58 Chapter 2

1. 3-5 ml overnight bacterial culture was used. Added 1.5 ml of

culture to a 1.5 ml Microfuge tube and centrifuged at 12,000

rpm for 1 minute. Drained of the liquid completely and repeat

with another portion of culture (in the same tube).

2. Two hundred µl of Solution I was added to the pellet mix gently

and kept for 2 minutes.

3. Added 400 µl of Solution II to the mixture, mixed gently by

inverting the tube 4-6 times and then kept at room temperature

for 1 min. To prevent contamination from genomic DNA

vortexing was avoided

4. Added 700 µl of Solution III, and mixed gently, incubated at

room temperature for 2 minutes.

5. Centrifuged at 12,000 rpm for 5 minutes.

6. Transferred half of the above supernatant (step 5) to the MX-10

column. Centrifuged at 5,000 rpm for one minute. Discarded

the flow- through in the tube and added the second half of the

mix. Centrifuged again at 5, 0000 rpm for 1 minute.

7. Discarded the flow through in the tube. Added 500 µl of wash

solution to the column, and centrifuged at 8,0000 rpm for 1

minute

8. Repeated the wash procedure in step 7.

9. Discarded the flow-through in the collection tube, centrifuged at

8,000 rpm for an additional 1 minute to remove any residual

wash solution.

10. Transferred the column to a clean 1.5 ml Microfuge tube,

added 50 µl of elution buffer into the centre part of the column


59

and incubate at room temperature for 2 minutes. Centrifuged at

10, 000 rpm for 2 minutes.

11. 5-10 µl of eluted sample was loaded in 0.8% agarose gel and

checked for the presence of plasmid DNA.

2.3.3 Curing of plasmid DNA

The plasmid curing was performed as described by Trevors

(1986).

Generalized plasmid curing procedure

1) Overnight logarithmically growing culture was used to inoculate

a series of culture flasks or test tubes containing nutrient broth

or appropriate growth medium amended with a range of curing

agent concentrations.

2) Cultures were incubated at various temperature 380C,400C,

450C for 48 hours

3) Culture tube or flask displaying observable turbidity and

containing the highest concentration of curing agent was used

to plate out dilutions on nutrient agar.Individual colonies were

patch- plated to a selective agar medium (minimal mineral salt

medium containing 0.1% SDS called MSSM) to screen for loss

of plasmid- encoded trait (SDS degradation) and individual

colonies which failed to grow on selective medium were tested

for plasmid loss using alkaline lysis plasmid isolation

procedure.

The curing of plasmid was carried out using ethidium bromide,

acridine orange, SDS (10%) as well as elevated temperature. The

60 Chapter 2

concentration range of mutagens was 50g ml-1 to 600g ml-1 with

increments of 50 for ethidium bromide and 100g ml-1 to 800g m-1

with increment of 100 for acridine orange. For curing by heat

treatment, cultures were grown in LB at the desired temperature, i .e.;

380C, 400C or 450C overnight, reinoculated in fresh LB medium and

reincubated at the corresponding temperature until late log phase.

Diluted samples of the culture displaying observable turbidity were

plated on LB agar. SDS negative colonies were selected by preparing

patch plates of MSSM+ SDS and MSSM + dextrose.

The protocol for plasmid curing using the combination of

acridine orange or ethidium bromide and elevated temperature was as

follows; to 100ml LB broth containing 700g m-1 acridine orange or

600g m-1 ethidium bromide, overnight grown culture of organism was

inoculated. This was incubated on a rotary shaker (120 rev min -1) at

450C for 48hours. Cell broth was then suitably diluted and spread on

nutrient agar plates and incubated at 300C for 24hours. Isolated

colonies were patch plated onto MSSM + dextrose agar and MSSM +

SDS agar plates and incubated for 24h at 300C. Colonies missing from

MSSAM +SDS agar plates were picked up from the master MSSM +

dextrose agar plates and checked further for disappearance of

plasmid DNA. The percentage curing efficiency was expressed as

number of colonies with cured phenotype per 100 colonies tested.


61

Table -2

Plasmid Curing

Curing agent Mode of action

Acridine orange, Ethidium bromide

Intercalating dyes; preferential inhibition of plasmid replication.

Sodium dodecyl sulphate (SDS)

Plasmid-containing cells are possibly more sensitive to SDS because of plasmid-Specified pili on cell surface.

Elevated growth temperature

Complete or partial deletions.

2.4 Optimization of the condition for SDS degradation

Inoculum preparation

One loopful of the culture was inoculated to a 50 ml of mineral

salt SDS medium.The flasks were incubated overnight at room

temperature (30± 20C) at 150 rpm. The cells were harvested by

centrifugation. The pellets were collected and diluted using

physiological saline (0.86% NaCl) till the OD becomes 1.This was

used as the inoculum for further studies.

2.4.1 Effect of incubation period for the biodegradation of SDS

The mineral salt medium containing 1500 mg/litre (optimum

substrate concentration) was inoculated with the inoculum (1 OD) and

was incubated for 48 hours at room temperature at 150 rpm.Samples

were drawn at every 2 hours and the % of SDS reduction was

calculated in the cell free supernatant.The minimum incubation period

required to effect maximum SDS degradation was selected as the

optimum incubation period.

62 Chapter 2

2.4.2 Effect of temperature for the biodegradation of SDS

The inoculum (1 OD) was added to mineral salt SDS medium

containing 1500 mg/litre as the substrate. The temperature range was

from 300C to 500C . The flask was incubated for 48 hours at room

temperature at 150 rpm. The percentage of degradation of SDS at

each temperature was monitored and the graph was plotted with % of

SDS reduction against the temperature The temperature at which

maximum SDS degradation occurred was selected as the optimum

temperature for SDS degradation process.

2.4.3 Effect of pH on the biodegradation of SDS


containing 1500 mg/litre as the substrate. The pH range was from 4-10.

The flask was incubated for 48 hours at room temperature at 150 rpm.

The percentage of degradation of SDS at each pH was monitored and

the graph was plotted with % of SDS reduction against the pH. The pH

at which maximum SDS degradation occurred was selected as the

optimum pH for SDS degradation process.

2.4.4 Effect of agitation on the biodegradation of SDS


containing 1500 mg/litre as the substrate. The flask was incubated for

48 hours at room temperature at 150 rpm .The control was incubated

at room temperature without agitation. The percentage of degradation

of SDS agitation was monitored.


63

2.4.5 Effect of carbon source on SDS degradation

Various carbon sources including glucose, sucrose, maltose,

mannitol and succinic acid were added separately at a fixed

concentration of 0.2% to inoculated mineral salt SDS medium. The

flask was incubated for 48 hours at room temperature at 150 rpm. The

percentage of degradation of SDS at each carbon source was

monitored and the graph was plotted with % of SDS reduction against

the carbon source.

2.4.6 Effect of nitrogen source on SDS degradation

Various nitrogen sources including ammonium chloride, ammonium

nitrate, tryptone, yeast extract and casein were added separately at a

fixed concentration of 0.2% to inoculated mineral salt SDS medium.

The flask was incubated for 48 hours at room temperature at 150 rpm.

The percentage of degradation of SDS at each nitrogen source was

monitored and the graph was plotted with % of SDS reduction against

the nitrogen source.

2.4.7 Effect of substrate (SDS) concentration on the biodegradation of SDS

The inoculum (1 OD) was added to mineral salt SDS medium at

different concentrations of SDS as 500 mg/litre to 10000 mg/litre. The

flasks were kept at room temperature at 150 rpm along with the

control. The percentage of degradation of SDS at each substrate

concentration was monitored for the 48 hours and the graph was

plotted with % of SDS reduction against the substrate concentration.

The highest concentration of SDS at which maximum SDS

degradation occurred was selected as the optimum substrate

concentration for SDS degradation process.

64 Chapter 2

To examine the toxicity effect of high surfactants on bacterial

growth, different concentration of SDS (500 mg/litre to 22000 mg/litre)

were selected. The effects of each surfactant concentration on the

growth of Pseudomonas aeruginosa in mineral salt medium was

determined by counting the colony forming unit (CFU) according to the

LB plating method of Claus and Balkwill (1989).

2.5 Growth curve of free and immobilized cells of Pseudomonas aeruginosa MTCC 10311

Mineral salt SDS medium was inoculated with 3% of inoculum

of 1 OD concentration in the case of free cells and 100 beads per

100ml in the case of immobilized cells. The quantification of the

growth of free cells was done by serial dilution of the sample followed

by viable counts at regular intervals of 4 hours. In the case of alginate

immobilized cells, to recover the bacteria for viable counts, known

amounts of beads were immersed in phosphate buffer (1M, pH -7) and

dissolved by vigorous shaking ( Muyima and clorte ,1995).

2.6 Preparation of immobilized cells

Pseudomonas aeruginosa (MTCC 10311) was grown in mineral

salt SDS medium for 24 hours were harvested by centrifugation at

10,000 rpm for 30 minutes. These cells were resuspended in

physiological saline (0.86% NaCl) at a cell concentration of 1 OD and

were mixed with 4% sodium alginate in the ratio of 1:2.The mixture

was added drop wise to excess ,0.2 M CaCl2 to get alginate entrapped

cells.(Jayachandran et al., 1994)


65

2.6.1 Activation of immobilized viable cells

The immobilized viable beads were activated for achieving

maximal activity using MSSM medium. Prepared immobilized beads

were taken in large 500 ml beaker and immersed with SDS containing

minimal medium for varying time intervals. Optimal activation time that

promoted maximal activity, for immobilized cells was determined in

terms of percentage reduction of SDS.

2.6.2 Biodegradation of SDS by immobilized cells of Pseudomonas aeruginosa MTCC 10311

The MSSM medium was taken as 300 ml aliquots in 1 litre

flasks and was inoculated with 300 activated immobilized beads. The

flasks were incubated at room temperature on a shaker at 150 rpm

under optimized conditions of SDS degradation. Samples were

withdrawn at regular intervals of 4 hours for SDS estimations from the

mineral salt SDS medium and a graph was plotted with % of SDS

reduction against incubation period.

2.7. Analysis of the product of SDS degradation by FTIR and GCMS

A metabolic product of SDS degradation was analyzed by FTIR

analysis and GC-MS analysis. 1 litre of the mineral salt SDS medium was

taken and inoculated with the Pseudomonas aeruginosa MTCC 10311.

The flasks were incubated for 48 hrs under optimal conditions for SDS

degradation. The medium was centrifuged at 10000 g and the pellet was

separated. The supernatant was repeatedly extracted with the solvent

ether and the extract was concentrated by evaporation. This ether extract

was used for the above studies. The conditions used in the GC were as

follows: Injection temperature- 2500C; flow -1ml/min; carrier-helium; oven

66 Chapter 2

temperature- 600 C for 2 minutes hold , 60 0 C -260 0C: 5 0C /min, 2600C -

3000 C: 200 C /min ; column -Varian VF -5ms. Conditions used in the MS

were as follows: Mass scan- 40-400m/z; Ionization –EI; Trap temperature

-2300 C; Transfer line -2700 C

2.8. Extraction and purification of alkyl sulphatase from Pseudomonas aeruginosa MTCC 10311

Stage I: Extraction of crude extract

Isolates grown on a mineral salt medium supplemented with

SDS were harvested by centrifugation (10,000 rpm).This pellet were

collected and resuspended in 0.1 ml of 100Mm phosphate buffer (pH

7.5) containing 0.58 M sucrose and 10Mm EDTA and lysed by

incubating with 4 mg of lysozyme (sigma) in 0.1 ml of phosphate-

sucrose –EDTA buffer for 60 minutes at 370 C. Triton X-100 (0.1 ml of

10% v/v) was added to complete lysis (Lee et al., 1997). The

centrifuged cell free lysate was subjected to purification.The universal

protease inhibitor, α2 macroglobulin, was added to the extract to a final

concentration of 0.5 mg/ml, and the whole mixture was stirred for 5

min in ice. (Matt et al., 1994)

Alkylsulfatase assay

Alkylsulfatase activity in cell extracts was assayed by

incubating 50 μl partially purified enzyme (0.14 mg ml-1 protein) of

isolate Pseudomonas aeruginosa with 450 μl of 50 Mm Tris-HCl and

500 μl of 100 Mm SDS. The loss of the substrate was measured by

MBAS assay as described before. The disappearance of SDS was

linear until 15 min under the assay conditions. Total enzyme activity

was determined from the initial rates of SDS disappearance. One unit

of enzyme was defined as the amount of enzyme which converted 1 μl

of SDS per minute under assay conditions. (Shukor et al., 2008)


67

Protein assay

Protein was routinely determined by Lowry’s method with BSA

as standard and measuring the absorbance of sample at 280 nm

Stage: 2 Removal of nucleic acid

The cell free extract from stage I was treated with sufficient

streptomycin sulphate (5% w/v) to give a final concentration of 1 mg of

antibiotic /mg of protein. After stirring for 10 min at 40C ,precipitated

nucleic acid was removed by centrifugation as before.The clear

supernatant was dialyzed overnight against 100 Mm tris /HCl, pH 7.5

(3×5 liters). (Matt et al., 1994)

Stage 3: DEAE-cellulose (DE 52) column chromatography

The nucleic acid –free extract from stage 2(35 ml) was applied

to DEAE-cellulose ( sigma, USA) column (1.5 ×30 cm) that had been

pre-equilibrated with column buffer.(10Mm Tris/HCl containing 0.5 M,

PH 7.5). The column was washed with column buffer(50 ml) followed

by adding NaCl (0.8 M, total volume 200ml) in column buffer. The

flow rate was adjusted to 5ml/hr and 2 ml fraction was collected and

assayed for protein and enzyme activity. Fractions with the highest

specific activity (fractions 64-70) were combined and dialyzed for 2

h(3×5 liters column buffer). (Matt et al., 1994)

68 Chapter 2

Stage 4: Sephadex G-200 exclusion column

The pooled fractions from stage 3 (10 ml) were applied to a

Sephadex G-200 column that had been pre-equilibrated with column

buffer. The equilibration and elution buffer was 50 Mm Na H2PO4

containing 0.15 M NaCl.

2.8.1 Determination of the molecular mass of the enzyme - Native Polyacrylamide gel electrophoresis (Native PAGE)

The purified enzyme was subjected to electrophoretic studies

to confirm purity. Electrophoresis was performed as suggested by

Hames (1990) using polyacrylamide.

Stock solutions

1. Acrylamide - bisacrylamide (30:0.8) was prepared by dissolving

30 g of acrylamide and 0.8 g of bisacrylamide in a total volume

of 100 ml of distilled water. The solution was filtered through

Whatman No: 1 filter paper and stored at 40C in a dark bottle.

2. TEMED (N,N,N’,N’- tetramethyl ethylene diamine) was used as

such which was stored in a dark bottle at 40 C.

Stacking gel composition (2.5%)

Acrylamide- bisacrylamide - 2.5 ml

(30:0.8 g/ 100 ml distilled water)

Stacking gel buffer stock - 5.0 ml

10 % Ammonium per sulphate - 0.1 ml

Distilled water - 11.5 ml

TEMED - 0.02 ml


69

Resolving gel composition (10%)

Acrylamide - bisacrylamide - 10.0 ml

Resolving gel buffer - 3.75 ml

10 % Ammonium per sulphate - 0.15 ml

Distilled water - 14.45 ml

TEMED - 0.02 ml

Stacking gel buffer stock –Tris-HCl (pH 6.8)

6.0 g Tris was dissolved in 40 ml of distilled water and titrated to

a pH of 6.8 with 1.0 M HCI and made up to a final volume of 100 ml. It

was filtered through Whatman No: I filter paper and stored in a

refrigerator.

Resolving gel buffer stock - Tris - HCl (pH 8.8)

36.3 g Tris was dissolved in 48 ml of 1.0 M HCl and made up to

a final volume of 100 ml. It was filtered through Whatman No: I filter

paper and stored in a refrigerator.

Reservoir buffer

3.03 g Tris and 14.4 g glycine were dissolved in distilled water

and made up to 1000 ml with distilled water (pH 8.3).

Sample Preparation

Sample Buffer

Distilled water : 3.0 ml

Stacking gel buffer : 1.0 ml

70 Chapter 2

Bromophenol blue (0.5 %) : 0.4 ml

Sucrose (10%) : 1.6 ml

Enzyme solution and sample buffer are mixed in the ratio 1:1.

Pre-running of the gel

The glass plates with the gel were clamped to the electrophoresis

unit and connection was made to cathode and anode. The tanks were filled

with reservoir buffer, which contain tris base and glycine. pH was maintained

as 8.3 and the pre-running was continued for ½ h.

Sample loading

The crude sample, streptomycin sulphate treated fraction, the

anion exchange fraction ands sepadex G-200 column fraction were

loaded. 20l of the sample was mixed with the sample buffer, which

consists of glycerol and the tracking dye, bromophenol blue. The pre

running was stopped and the sample was loaded into the wells. The

marker (Genei, Banglore) was loaded separately. The marker

contained four protein markers of molecular weights 88, 62, 49, 38,

28,18,14,6,3 kilodaltons.

After sample loading the electrophoresis was performed for 5 h

at 40C at a voltage of 80V. After running, the gel was carefully taken

out and was subjected to silver staining.

Silver staining

The gel was transferred to a clean plastic container and

washed in the washing solution with slow shaking for 10 min. The


71

washing solution was discarded and the gel was rinsed with plenty of

water for 2 minutes. The gel was immersed in sodium thiosulfate

solution for 1-2 min. The gel was washed with water twice, each time

1-2 min. and the washed water was drained off. The gel was soaked in

silver nitrate solution for 10 min with gentle shaking .The gel was

washed with water twice, each time 1-2 minutes. The washed water

was drained off. The developer solution was poured to the container

and the gel was slowly shaken. The proteins reduced the silver nitrate

and yellow-brown colored bands appeared. When sufficient intensity

was developed for the bands of the bands developed, citric acid

solution was added to stop the reaction. The protein-banding pattern

was recorded by photography.

2.8.2 Zymogram of alkyl sulphatase extracted from Pseudomonas aeruginosa

Non–denaturing polyacrylamide gel electrophoresis of extracts

of cells grown on SDS, followed by incubation of gel at 300C in

solution containing 10 Mm SDS and 20 Mm –BaCl2 in 20Mm Tris-

HCl, pH 7.8. (Hales et al., 1985)

2.9 Starvation experiment (Roig et al., 1998)

Starvation experiments were performed in starvation medium

with the following composition (mg /litre) NH4Cl, 5400 , KH2PO4, 400,

MgSO4, 200, Tris, 6000 and the pH was kept at 7.4. Cells were

inoculated in six sets of 50 ml of starvation medium and were

incubated at room temperature. The sodium dodecyl sulphate was

added each of the flasks after different check intervals of starvation

time (0 hours, 2 hours, 4 hours, 8 hours, 16 hours, 32 hrs) and

incubated for 48 hours.

72 Chapter 2

2.10 Treatment of synthetic wastewater

2.10.1 Characterization of the effluent

i) Synthetic wastewater composition

Composition of synthetic wastewater was (mg/litre) SDS -

2400, NH2SO4 - 125, MgSO4. 7H2O- 25, FeCl3.6H2O - 0.125, CaCl2 -

1.825, KH2PO4 - 131.75, K2HPO4 -267, MnSO4.H2O - 267, starch-100.

pH - 7.2. COD and BOD were evaluated as per standard methods.

(APHA, 1995).

ii) Analytical methods

The effluent was analyzed for Chemical Oxygen Demand

(COD) Biological Oxygen Demand (BOD), and pH (APHA, 1989).

ii.a) pH

Measurement of pH was carried out using a pH meter

(Systronics digital pH meter).

ii.b) Biochemical Oxygen Demand

The biochemical oxygen demand was estimated as per the

method in APHA (1989).

1. The DO of the sample was determined initially and after 5 days

of incubation in a BOD incubator at 200C.

2. A blank was also carried out simultaneously.

3. The BOD5 was then calculated by the following formula.

BOD5 at 200C in mg/l= (D0-D5)-(C0-C5)


73

Where

D0 = DO content of the sample on the 1st day

D5 = DO content of the sample on the 5th day

C0 = DO content of the blank on the 1st day

C5 = DO content of the blank on the 5th day

ii.c) Chemical Oxygen Demand (COD)

Chemical Oxygen Demand was determined following the official

method mentioned in APHA (1989).

1. 10 ml of the sample was diluted to 500 ml using distilled water.

2. 50 ml of the diluted sample was taken in a round bottom flask .

(R. B. Flask) for COD determination.

3. 1g HgSO4 was added to the above sample to overcome the

difficulties caused by chloride ions.

4. 5 ml of con. H2SO4 was added to dissolve the HgSO4.

5. 1 g AgSO4 was then added to the above mixture as a catalyst.

6. To the above solution 25 ml of 0.25 N potassium dichromate

was added.

7. The RB flask was attached to the condenser and the water was

allowed to flow.

8. 70 ml of con. H2SO4 was added through the open end of the

condenser and swirling was continued while the acid was being

added.

74 Chapter 2

9. The contents in the flask were refluxed for 2h, cooled, washed

into a 500 ml beaker and was suitably diluted and made up to

140 ml.

10. 3-4 drops of ferroin indicator was added and the contents were

titrated against ferrous ammonium sulfate (0.25 N).

11. The end point of the titration was the first sharp colour change

from the blue-green to reddish brown.

12. A blank was also run simultaneously in the same manner using

distilled water.

13. The COD then calculated using the formula.

COD mg/l= 4 2 4A B N of Fe(NH ) SO 8 1000

volume of sample

Where A= volume of Fe (NH4)2 SO4 consume for blank (ml)

B = volume of Fe (NH4)2 SO4 consumed for sample (ml)

2.10.2 Treatment of the synthetic waste water with free cells and Immobilized cell of Pseudomonas aeruginosa in batch process

The synthetic waste water samples were collected as 300 ml

aliquots in 1 litre flasks and were inoculated with 18 hour old culture

(1 OD) in free cell treatment and 300 activated immobilized beads in

immobilized cell treatment. The flasks were incubated at room

temperature (30 ± 20C) on a shaker at 150 rpm.Samples were

withdrawn at regular intervals of 4 hours for SDS and COD

estimations. The graph was plotted with % of reduction in SDS and

COD along Y-axis and incubation period along X axis.


75

2.10.3 Designing of bioreactor

The three stage bioreactor for the removal of SDS was

designed in such a way that the first stage consisted of aeration,

Second stage consisted of physical adsorption and third stage

consisted of treatment with immobilized cells. The three stage

bioreactor was made up of glass. It has 4 subunits. Unit I composed of

aeration pump, filter disc (03 Nos) and bush (2 types). Aeration pump

has 14 cm Height and 0.2 cm diameter, it has air inlet and outlet.

Nozzle of 0.1 cm opening was there in the outlet for aeration. Filter

discs (3 nos) of diameter 4 cm, thickness 0.2 cm, centre hole of

diameter 0.25cm was meant for upward movement of water (plate 1).

Two types of bush (0.3cm dia and length 1cm), (0.3 cm dia and 4.8 cm

length) were inserted for the support of the filter. Unit 2 consists of a

hollow covering glass of height 10 cm and 4.1 dia and small folding of

0.1 cm for support. Unit 3 was the association of Unit 1 and 2 (plate:

2). Main reactor system of dia 4.2 cm, height 15.8 cm had the inlet

and the outlet of dia 0.2 cm each. (plate: 3).

76 Chapter 2

A UNIT III - Main reactor system -4.2 cm diameter × 16 cm height

B UNIT II- Hollow covering -4.2 cm diameter × 10 cm height

C UNIT I COMPONENTS - Perforated disc -4 cm diameter, 0.2 cm thickness, center hole-0.25 cm

D UNIT I COMPONENTS - Nozzle -0.1 cm opening

E UNIT I COMPONENTS - Sparger

F UNIT I COMPONENT –Aeration pipe -0.2 cm diameter ×14 cm height

Plate: 1 Components of multistage reactor

D

A

B

C

F

E


77

A Air regulator

B Outlet

C Filter perforated disc

D Small projection for support the filter system

E Nozzle for aeration

F Intlet

Plate: 2 Multistage aerobic reactor

A

B

C

D

E

F

78 Chapter 2

A Third stage column (Immobilized cells)

B Second stage column (Scrap granular rubber)

C First stage column (Air)

D Synthetic waste water for treatment

E Air pump

F Peristaltic pump

G Treated synthetic waste water

Plate: 3 Treatment of wastewater with aerobic three stage reactor

A

B

C

D

G

F

E


79

Performance of bioreactor was checked with synthetic

wastewater at individual stage at different flow rate of 5ml/hr, 7ml/hr,

9ml/hr and 10ml/hr with a peristaltic pump (Pharmacia). The % of

reduction in surfactant and COD were evaluated as mentioned before.

2.10.4 Primary treatment

Primary treatment was carried out by aeration. The % of

reduction in surfactant, and COD were evaluated at different flow rate

(5 ml/hours, 7 ml/hours, 9 ml/hours, 10 ml/hours) of synthetic waste

water.

2.10.5 Secondary treatment

Secondary treatment of synthetic waste water was carried out

by physical adsorption with either active carbon (Joseph Leslie

Dragger, Mumbai, Maharashtra, India) or scrap granular rubber (Super

Tyres, Kottayam, Kerala, India).

15 gram of active carbon was taken and packed into second

stage reactor. The ability of packed bed material in adsorbing SDS

and resulting in COD reduction were studied

Scrap granular rubber was processed in the following manner

for laboratory analysis. The raw material were washed first with tap

water and then with distilled water to avoid presence of any foreign

materials. Then the materials were dried, and sieved to get a mean

size of 1cm, 2cm, 3cm. In order to avoid finer material the sieved

materials were again washed thoroughly with distilled water. The

washed material thereafter were dried finally at 900 C for 10 hour and

80 Chapter 2

kept in desiccator at room temperature.The ability of packed bed

material in adsorbing SDS and reduction in COD were studied .

Scrap granular rubber was selected for further study.

Adsorption capacity of each sieved size (1cm, 2cm, 3cm) SGR and

respective COD reduction were recorded.

2.10.5.1 Treatment of the synthetic waste water with scrap granular rubber(SGR)

50 pieces of 1cm sieved SGR were packed in the second stage

reactor and the effluent was passed slowly from the bottom of the

reactor. The % of reduction in SDS and COD were evaluated at a flow

rate of 5 ml/hours, 7 ml/ /hours, 9 ml/hours, 10 ml/ /hours with a

peristaltic pump((Pharmacia)

2.10.6 Tertiary treatment

Tertiary treatment of synthetic waste water was carried out

individually with the stage of the reactor.immobilized cells.

Immobilized cells packed in the top column of the glass reactor (5 cm

length and 4cm diameter) were used for the tertiary treatment of

synthetic wastewater. Immobilized cells in beads packed to a height of

4 cm in the glass column carefully without trapping any air bubble. The

effluent was passed from the bottom of the reactor so that it slowly

rises through the immobilized bed.The performance of immobilized

cell in bringing SDS and COD reduction was studied at a flow rate of 5

ml/hours, 7 ml/ hours, 9 ml/ hours, and 10 ml/ hours with a peristaltic

pump ((Pharmacia).


81

2.10.7 Treatment of the synthetic wastewater with three stage reactor

Treatment of the synthetic wastewater was done with three

stages of reactor connected in series (three stage reactor) such as air,

scrap granular rubber packed reactor and immobilized cells packed

reactor. The effluent was passed slowly from the bottom and rising

through the first reactor (air).It slowly rising through the SGR in the

second stage of the reactor and then through the immobilized cells in

the third stage of the reactor .The experiment was conducted at

different flow rate of 5ml/hour, 7ml/ hour, 9ml/ hour and 10ml/ hour

with a peristaltic pump (Pharmacia) .The % of reduction in SDS and

COD were evaluated and a graph was plotted with % of reduction in

SDS and COD along Y –axis and flow rate along X –axis.

2.11 Determination of half life of the three stage reactor

Performance of the packed three stages packed bed reactor

was checked continuously for 108 hours and the time required for the

performance to become half of the maximum was calculated.

2.12 Statistical analysis

Values are means ± SE of at least three replicates.

Comparison between groups was performed using a Student’s t-test or

a one-way analysis of variance with post hoc analysis by Tukey’s test

(Miller and Miller, 2005).

chapter 2shodhganga.inflibnet.ac.in/bitstream/10603/15789/13... · drops of kovac’s reagent...

Documents