characterization of a yeast nuclear gene (mst1) coding for the

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1985 hy The American Society of Biological Chemists, Inc.

Vol. 260, No. 26, Issue of December 5, pp. 15362-15370,1965 Printed in U.S.A.

Characterization of a Yeast Nuclear Gene (MSTI) Coding for the Mitochondrial Threonyl-tRNAl Synthetase*

(Received for publication, March 18,1985)

Louise K. Pape, T. J. Koerner, and Alexander Tzagoloff From the Department of Biological Sciences, Columbia University, New York, New York 10027

The wild-type yeast nuclear gene MSTl complements mutants defective in mitochondrial protein synthesis. The gene has been sequenced and shown to code for a protein of 54,030 kDa. The predicted product of MSTl is 36% identical over its 462 residues to the Escherichia coli threonyl-tRNA synthetase. Amino- acylation of wild-type mitochondrial tRNAs with a mitochondrial extract from mstl mutants fail to acylate tRNA’f“’ (anticodon: 3’-GAU-5’) but show normal acylation of tRNA;”’ (anticodon: 3’-UGU-5’). These data suggest the presence of two separate threonyl- tRNA synthetases in yeast mitochondria. Antibodies were prepared against a trpEIMST1 fusion protein containing the 321 residues from the amino-terminal region of the E. coli anthranilate synthetase and 118 residues of the mitochondrial threonyl-tRNA synthetase. Antibodies to the fusion protein detect a 50-55- kDa protein in wild type yeast mitochondria but not in mitochondria of a strain in which the chromosomal MSTl gene was replaced by a copy of the same gene disrupted by insertion of the yeast LEU2 gene. The ability of the mutant with the inactive MSTI gene to charge tRNAZhr argues strongly for the existence of a second threonyl-tRNA synthetase gene.

Most of the yeast mitochondrial protein-synthesizing ma- chinery is imported from the cytoplasm. The components encoded in the mitochondrial genome include 24 tRNAs (l), both the 15 and 21 S rRNAs (l), and the ribosomal protein product of uarl (2,3). The majority of the ribosomal proteins and probably all the aminoacyl-tRNA synthetases are encoded in the nuclear genome, translated on cytoplasmic ribo- somes, and imported into mitochondria.

At present, data bearing on mitochondrial aminoacyl-tRNA synthetases are very fragmentary. Based on chromatographic and immunological properties, the mitochondrial synthetase that charges phenylalanine tRNA has been shown to be different from its cytoplasmic counterpart (4-6). Earlier studies on the mitochondrial leucyl-, methionyl-, and histidyl- tRNA synthetases also suggested that these differed from the cytoplasmic synthetases (7,8).

We report here the cloning and characterization of a nuclear gene ( M S T l ) which is proposed to code for a mitochondrial threonyl-tRNA synthetase of yeast. Yeast mitochondria have been shown to contain two different threonyl-tRNAs (9, 10). The tRNAFh’ has the anticodon 3’-GUA-5’ and is responsible for reading the leucine family of CUN codons as threonine

*This research was supported by National Science Foundation Grant PCM-8116680. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

(11). This is one of the three differences between the yeast mitochondrial and the universal code (3, 11, 12). The tRNAzh’ with a 3’-UGU-5’ anticodon recognizes the usual ACN codons for threonine (13). The synthetase encoded by M S T l has been found to acylate only the tRNA?.

MATERIALS AND METHODS’

RESULTS

Genetic Properties of mstl Mutants-The four mitochondrial threonyl-tRNA synthetase mutants examined in the present study have been assigned to the pet complementation group G69. The mutants do not complement one another in all pairwise combinations but are complemented by po testers and by representative mutants from other pet complementation groups (Table 11). Although the reversion frequency is less than lo-’, the mutants are highly unstable and readily convert to p- derivatives. Depending on the mutant, stationary phase cultures consist of 40-99% p - clones. This property is consistent with recent findings that mutations in nuclear genes of yeast specifying components of mitochondrial protein synthesis cause a secondary instability in mitochondrial DNA leading to a rapid production of deleted p- genomes (15).

Identification of the Mutated Threonyl-tRNA Synthetase- The mstl mutants have a respiratory-deficient phenotype as judged by their inability to grow on the nonfermentable substrate glycerol. When CllO was assayed in uiuo for mitochondrial protein synthesis only low levels of this activity were detected. The four mutants also exhibit a partial block in excision of the first intervening sequence from the cytochrome b pre-mRNA. The latter observation led us to initially propose that the wild-type gene may code for a protein involved in mitochondrial RNA splicing (39). Subsequent studies, however, indicated that the product of the wild-type gene M S T l codes for a protein homologous to. the Escherichia coli threonyl-tRNA synthetase (see below). The inability of mstl mutants to process the cytochrome b pre-mRNA, therefore, appears to be an indirect effect stemming from an insuffi- ciency of maturase encoded in the first intron of the short cytochrome b gene (40,41). The expression of this mitochondrial splicing factor has been shown to be dependent on a functional system of mitochondrial protein synthesis (40,41).

Yeast mitochondria have previously been shown to code for

Portions of this paper (including “Materials and Methods” and Tables I-IV) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are available from the JournaI of Biological Chemistry, 9650 Rockville Pike, Bethesda, MD 20814. Request Doc- ument No. 85M-787, cite the authors, and include a check or money order for $1.60 per set of photocopies. Full size photocopies are also included in the microfilm edition of the Journal that is available from Waverly Press.

15362

Characterization of Yeast Nuclear Gene MSTl 15363

two threonine tRNAs, each with a different anticodon (11, 13). The synthetase affected in mstl mutants was identified by analysis of the tRNA species charged by mitochondrial wild-type and mutant synthetase extracts.

Total wild-type mitochondrial tRNAs were charged with [3H]threonine in vitro using cholate or Triton X-100 extracts of wild-type and of mutant mitochondria as sources of aminoacyl-tRNA synthetases. The acylated products were separated by reverse-phase chromatography on an RPC5 column. The results of such analyses are presented in Fig. 1. In agreement with earlier findings yeast mitochondria have two different threonine tRNAs (9, lo), both of which are acylated with wild-type extracts. Extracts obtained from the different mstl mutants, however, charged tRNAThr but did not charge tRNAThT (data not shown for N191 and N619). These results confirm that the mutant phenotype is due to a mutation in an aminoacyl-tRNA synthetase responsible specifically for acylation of the mitochondrial tRNAThr. The wild-type gene has been designated MSTl (mitochondrial synthetase threonine).

Cloning of the MSTl Gene-The wild-type gene restoring respiratory competency to mstl mutants was selected by transformation of C11O/L1 (a,ku2-3,112,mst1-1) with a re- combinantplasmid library provided by Dr. K. Nasmyth (Med- ical Research Council Centre, Cambridge, England). This library was constructed by ligation of partial Sau3A fragments

'1

\ ( w t l

2400 C l l O

I N293

1

1 i I

400

200

30 40 50 60 J

Frac t i on

FIG. 1. Aminoacylation of the mitochondrial threonine tRNAs with extracts from wild type and from mstl mutants. The procedures for the preparation of mitochondrial tRNAs from wild-type yeast and of mitochondrial aminoacyl-tRNA synthetases have been described previously. Equivalent amounts of tRNA were charged with [3H]threonine in the presence of synthetase extracts from the wild-type strain D273-10B (top panel), from CllO (middle panel), and from N293 (bottom panel). Following extraction with phenol and alcohol precipitation, the acylated products were separated on a 0.6 cm X 60-cm column of RPC5 developed with 200 ml of a linear gradient 0.38-0.68 M in NaC1. Two-ml fractions were collected and the RNA precipitated with trichloroacetic acid in the presence of carrier tRNA. The precipitates were collected on Whatman GF/A filters and counted. The two threonine tRNAs eluted at the expected positions based on previously published results employing similar columns and solvents (9). tRNA? has been shown to recognize the CUN codon family (11) while tRNA? recognizes the normal ACN family of codons (13).

ZB S E oc a m r 7

Q oG69/T36

U

> 0 .-

EcoRI FIG. 2. Restriction maps of pG69/T1 and pG69/T36. The

thin arc of the YEpl3 vector represents pBR322 sequences including its origin of replication and the 0-lactamase gene. The solid arc represents a fragment of yeast nuclear DNA with the LEU2 gene, and the open arc represents yeast 2-p sequences with its origin of replication. The cloned fragments of nuclear DNA in pG69/T1 and in the smaller plasmid pG69/T36 are shown in the upper part of the figure. Only some restriction sites are indicated.

(5-20 kb2) of wild-type yeast nuclear DNA to the unique BamHI site of YEpl3 (23). Respiratory-competent and leucine-independent transformants were selected on minimal glycerol medium lacking leucine (22). Four independent respiratory competent clones (CllO/Tl-T4) were obtained from among a total of 8000 leucine-sufficient transformants indi- cating that the gene is represented once in every 2000 recombinant plasmids present in the library. Segregation tests showed that the gene conferring the respiratory competent phenotype in C11O/T1 was harbored on a plasmid. Growth of C11O/T1 in nonselective medium (YPD) induced a simulta- neous loss of leucine sufficiency and of respiratory competency in 220 out of 257 mitotic segregants. Two other transformants (CllO/T3 and T4) also carried the complementing gene on an autonomously replicating plasmid. Segregation tests on the fourth transformant CllO/T2 indicated that in this clone the gene had integrated into chromosomal DNA.

Restriction analysis of plasmid DNA purified from C110/ T1, T3, and T4 revealed identical inserts of approximately 6 kb (Fig. 2). This plasmid referred to as pG69/T1 was used to subclone the gene on a smaller fragment of nuclear DNA. The insert of pG69/T1 was partially digested with Sau3A to yield fragments averaging 1-3 kb in length. These were ligated to the BanHI site of YEpl3, and the new library was used to transform CllO/Ll. Out of 37 clones complemented for leu2 and mstl, eight contained identical inserts of 3 kb. The restriction map of a representative plasmid (pG69/T36) is shown in Fig. 2. The remaining 29 transformed clones had plasmids with larger inserts and were not studied further.

Sequence of MSTl and Derived Primary Structure of the Protein Product-The 3-kb insert in pG69/T36 was sequenced by the strategy shown in Fig. 3. Two nonoverlapping open reading frames of 1386 and 1236 bp were found in the

* The abbreviations used are: kb, kilobase(s); bp, base pair(s); Pipes, 1,4-piperazinediethanesulfonic acid; SDS, sodium dodecyl sulfate.

15364 Characterization of Yeast Nuclear Gene MSTl 2 00 bp U

N H 2 COOH I I I I

+-+ t-( *u

m + - l *I-+- --+++ ++ eH ”

t-+ +-I

!” - +I+” c- 4 k 4-

FIG. 3. Restriction fragments used to sequence the MSTl gene. The sequence of the gene and flanking regions was obtained from preparative BamHI, HindIII, AuaI, BamHI-HindIII, and BgZII- HindIII fragments. The restriction sites used for secondary cleavages and 5’ end labeling are shown by the arrows whose lengths also indicate the approximate distances read on the sequencing gels. The symbols used for the restriction sites are: W, BamHI; e, BglII; 0, HindIII; 0, AuaI; A, DdeI; 0, RsaI; A, Hinff 0, TaqI. The position of the open reading frame identified as the MSTl gene is shown by the open bar.

I I I I I

-> <- OF mstl

T 3 6 I , Y E S

T 4 0 Y E S

T 4 1 I I N O

T 4 2 I I NO

FIG. 4. Subfragments of the pG69/T36 insert used to test for complementation of CllOILl. The locations of the two open reading frames present in the nuclear DNA insert of pG69/T36 are indicated by the solid bars in the upper part of the figure. The arrows denote the direction of transcription of the two genes. The three subfragments shown by the thin lines were ligated to YEpl3 and tested for complementation of the mstl mutant. The AuaI fragment was filled with “Klenow fragment” and was ligated to the BamHI site of YEpl3 blunt-ended with “Klenow fragment.” The resultant plasmid pG69/T40 contained the entire MSTl reading frame and was competent in complementing the mstl mutant. The BamHI and the shorter HindIII-BamHI fragments were cloned, respectively, into YEpl3 linearized with BamHI and with BamHI plus HindIII. AS indicated in the figure, plasmids lacking the first 169 nucleotides (pG69/T41) or the first 491 nucleotides (pG69/T42) of the MSTl reading frame did not complement the mstl mutant.

sequence. The putative coding sequences occur in two different strands, each starting at opposite ends of the cloned fragment of DNA. Deletion analysis indicated that only the reading frame contained within the 1.9-kb AuaI fragment and spanning the unique HindIII and BamHI sites is capable of complementing C11O/L1 (Fig. 4). The fact that the AuaI fragment by itself complements the mstl mutant together with other evidence discussed later in this paper strongly suggests that the 1386-nucleotide-long reading frame starting with an ATG codon 142 nucleotides downstream of the cloning site corresponds to the MSTl gene.

The sequence of the wild-type MSTl gene and of the predicted protein is presented in Fig. 5. It codes for a 462- amino acid-long polypeptide with a molecular weight of 54,030 having a basic charge of +5. Unlike a number of yeast genes for highly expressed proteins that have a clear bias in codon usage (42), MSTl utilizes most codons (Table 111) suggesting

that the product is not an abundant protein. Homology of Mitochondrial and E. coli Threonyl-tRNA Syn-

thetases-The protein encoded in MSTl is homologous to the reported sequence of the E. coli threonyl-tRNA synthetase (43). The alignment shown in Fig. 6 is based on the Needle- man and Wunsch algorithm (38) designed to optimize for homology with the least number of deletions/insertions. The most conserved region of the mitochondrial synthetase starts from residue 47 through the end of the protein. In this region there are 158 identities out of a total of 416 residues. This represents 38% homology with only six deletions/insertions in the two sequences. The first 46 amino-terminal residues of the yeast sequence cannot be unambiguously aligned, either because of greater sequence divergence or because it includes a transit signal sequence that is absent in the E. coli synthetase. The presence of such a signal in the yeast protein is supported by the charge distribution along the polypeptide chain. As shown in Fig. 7, the first 45 residues include nine basic and no acidic amino acids. Since most of the known leader sequences of proteins imported into mitochondria are positively charged (44), it is not unlikely that this region of the synthetases serves a similar function.

One of the most interesting features of the yeast mitochondrial threonyl-tRNA synthetase is the absence of 205 amino- terminal residues that form part of the procaryotic enzyme. The function of this region, therefore, does not appear to be important in the tRNA-charging activity of the synthetase. Lestienne et al. (45) have found that translation of E. coli threonyl-tRNA synthetase mRNA is inhibited by addition of the synthetase in an acellular system. They have postulated that the mRNA sequence coding for the amino-terminal part of the E. coli enzyme can be folded into a tRNA-like structure involved in feedback inhibition of translation of the message (45).

In Situ Disruption of MST1-To confirm that the cloned MSTl gene identified from the DNA sequence codes for the tRNATh* synthetase, the chromosomal gene was substituted with an inactive copy in which the coding sequence between the BglII and BamHI sites was deleted and replaced with a 3- kb fragment of DNA with the yeast LEU2 gene (Fig. 8). A linear fragment of DNA with the disrupted MSTl gene and flanking sequences was used to transform the respiratory competent strain W303 carrying the double mutations leu2- 3,112. Two isogenic strains of W303 differing only in their mating types were used for the one-step gene disruptions (46).

Two respiratory-deficient transformants each prototrophic for leucine were isolated. Both failed to be complemented by mstl mutants (Table IV) suggesting that the integration event had led to a replacement of the wild-type MSTl gene by the disrupted copy. This was confirmed by Southern hybridization analysis of genomic DNA from the parental W303 and from one of the respiratory-deficient transformants W303Vmstl. The genomic DNA was separately digested with PstI and EcoRI. Following separation on 0.7% agarose, the DNA was transferred to nitrocellulose and hybridized with the 310-bp BamHI fragment containing part of the MSTl coding and 5’ flanking sequence. As seen in Fig. 8, the wild- type gene is contained on a 7-kb PstI fragment. In the transformant the same probe hybridizes to a new PstI fragment approximately 3 kb larger than that of wild type. Since there are no PstI sites either in MSTl or in LEU2, the increased size of the fragment in W303Vmstl is consistent with the presence of the LEU2 insert in the chromosomal DNA. The presence of the disrupted MSTl gene in the transformant was corroborated by the hybridization data obtained with the EcoRI digests. The wild-type lane shows the gene to be on

Characterization of Yeast Nuclear Gene MSTl

5'-GATCCTTTTAAAAAAAACTGAATAATCCATCTAGTTAAAGT -1 41

15365

+1 ATG AAA ATA CAA CTT GTA AGA TGG CAT TGT TCT CGC AAT GCT CTT TGG AAT CGT GCT TTC TAC TCT ACG AGA AAG Met Lys I l e Gln Leu Val Arg Trp His Cys Ser Arg Asn Ala Leu Trp Asn Arg Ala Phe Tyr Ser Thr Arg Lys

H i n f I

t 76 GCC A% AAC GCT TCG TCG GCG ACT CCA GCT ACT ATG ACA TCC ATG GTA T= AGG CAA GAT CTT TTC ATG Ala Thr Lys Asn Ala Ser Ser Ala Thr Pro Ala Thr Met Thr Ser Met Val Ser Gln Arg Gln Asp Leu Phe Met

DdeI H i n f I Dde I Bgl I1

+I51 ACA GAT CCA CTA TCT CCT GGA TCC ATG TTC TTT CTT CCA AAT GGT G D ATT TTC AAC MA TTG ATA GAG TTT Thr Asp Pro Leu Ser Pro Gly Ser Met Phe Phe Leu Pro Asn Gly Ala Lys I l e Phe Asn Lys Leu I l e Glu Phe

BamHl Ode1

t226 ATG AAG TTA C A A CAA AAG TTC AAA TTT GGT TTT AAT GAA GTT GTG ACG CCT TTG ATT TAC AAA AAG ACT CTT TGG Met Lys Leu Gln Gln Lys Phe Lys Phe Gly Phe Asn G1 u Val Val Thr Pro Leu I l e T y r Lys Lys Thr Leu Trp

H i n f I

Glu Lys Ser Gly His Trp Glu Asn Tyr Ala Asp Asp Met Phe Lys Val Glu Thr Thr Asp Glu Glu Lys GI u Glu t301 GAA AAG TCT GGT CAC TGG GAA AAT TAT GCT GAT GAC ATG TTT AAG GTG GAA ACT ACG GAT GAA GAA AAG GAG GAA

t376 TAC GGT TTA AAA CCG ATG AAT TGC CCA GGC CAT TGT CTG ATC TTC GGT AAA AAG GAT AGA TCG TAT A A C GAA CTT Tyr Gly Leu Lys Pro Met Asn Cys Pro Gly His Cys Leu I l e Phe Gly Lys Lys Asp Arg Ser Tyr Asn Glu Leu

+451 CCC CTA CGC TTC TCT GAT TTT TCA CCA CTA CAT AGA AAT GAA GCT TCT GGT GCA CTG TCG GGA TTG ACT AGA Pro Leu Arg Phe Ser Asp Phe Ser Pro Leu His Arg Asn Glu Ala Ser Gly Ala Leu Ser Gly Leu Thr Arg Leu

H ind I11

+526 K G AAG TTC CAT CAA GAC GAT GGT CAT ATC TTT TGC ACT CCT TCC CAA GTG AAA TCA GAA ATT TTC AAC TCT TTA Arg Lys Phe His Gln Asp Asp Gly His I l e Phe Cys Thr Pro Ser Gln Val Lys Ser Glu I l e Phe Asn Ser Leu

Ode1

+601 AAA TTA A E A C ATA GTT TAC AAC AAA ATT TTC CCC TTT GTT AAA GGA GGT TCT GGA GCA GAG AGC AAT TAT TTT Lys Leu I l e Asp I l e Val Tyr Asn Lys I l e Phe Pro Phe Val Lys Gly Gly Ser Gly Ala Glu Ser Asn Tyr Phe

Taq I

t676 ATA AAC TTT TCT ACA AGA CCG GAT CAC TTC ATT GGA GAC CTC AAA GTT TGG AAT CAT G- CAA E T C AAG I l e Asn Phe Ser Thr Arg Pro Asp His Phe I l e Gly Asp Leu Lys Val Trp Asn His Ala Glu Gln Val Leu Lys

Hinff DdeI RsaI

+751 GAA ATC TTG GAA -A GGC AAA CCG TGG AAA CTG AAC CCT AGT GAT GGT GCG TTC TAT GGT CCA AAG TTG GAT Glu I l e Leu Glu Glu Ser Gly Lys Pro Trp Lys Leu Asn Pro Ser Asp Gly Ala Phe Tyr Gly Pro Lys Leu Asp

H i n f I

I l e Met Val Thr Asp His Leu Arg Lys Thr His Gln Val Ala Thr I l e Gln Leu Asp Phe Gln Leu Pro Glu Arg +826 ATA ATG GTT ACG GAC CAT TTA CGC ARA ACT CAT CAA GTC GCT ACT ATT CAG TTG GAC TTT CAG CTA C- AGG

DdeI

+901 T E T TTG AAA TTC AAG GAT CAA GAC AAC TC- AAG AGG CCA ATT ATG ATT CAT AGA GCT ACT TTT GGT TCT Phe Asp Leu Lys Phe Lys Asp Gln Asp Asn Ser Tyr Lys Arg Pro I l e Met I l e His Arg Ala Thr Phe Gly Ser

Taq I RsaI H i n f I

I l e Glu Arg Phe Met Ala Leu Leu I l e Asp Ser Asn Glu Gly Arg Trp Pro Phe Trp Leu Asn Pro Tyr Gln Ala t976 A e A AGA TTT ATG GCT TTA CTG ATA GAT TCT AAT GAG GGC CGT TGG CCG TTT TGG TTG AAT CCT TAC CAA GCT

Taq I m miin-

Val I l e I l e Pro Val Asn Thr Lys Asn Val Gln Gln Leu Asp Met Cys Thr Ala Leu Gln Lys Lys Leu Arg Asn +lo51 GTA ATT ATT CCC GTC AAT ACG AAA AAT GTG CAA CAG CTA GAC ATG TGC ACT GCC TTG CAG AAA AAR CTA CGT AAT

+1126 GAA CTG GAA GCC GAC GAC ATG GAA CCA GTT CCT TTA AAT GAT TGG CAT TTC AAT GTT GAT C T C C ATA AGA AAC Glu Leu Glu Ala Asp Asp Met Glu Pro Val Pro Leu Asn Asp Trp His Phe Asn Val Asp Leu Asp I l e Arg Asn

Taq I

+1201 GAA CCC GTA GGG TAT AGG ATC AAG TCG GCC ATT TTG AAA AAC TAT TCC TAT TTA ATT ATC GTG GGT GAT GAG GAA Glu Pro Val Gly T y r a r g I l e Lys Ser Ala I l e Leu Lys Asn Tyr Ser Tyr Leu I l e I l e Val Gly Asp Glu Glu

+1276 =AG TTA CAG AAA TAC AAC A T T S GAA CGT GAT AAT AGA AAG AGT T Z G AAA CTT ACA ATG TCT CAA ATT Val Gln Leu Gln Lys Tyr Asn I l e Arg Glu Arg Asp Asn Arg Lys Ser Phe Glu Lys Leu Thr Met Ser Gln I 1 e

Rsa I Taq I Taq I

Trp Glu Lys Phe I l e Glu Leu Glu Lys Asn Tyr Lys Och +1351 TGG GAA AAA TTT ATT GAG CTG GAA AAA AAC TAC AAG TAA CTTAAAATATATGACAAACTTGCCCTGTAAATAAAAGGATACGATTTG

+I438 ATGTATAGCTGGATTCATACAGAGACTAGACTCATCCGCCCCACAGATGC ATTAATTCATGTATATTTCACATATTATACCATATGTAGTCATTAAACTA H i n f I H i n f I

FIG. 5. Nucleotide sequence of part of the DNA insert in gG69/T36. Only the sequence of t h e sense s t r a n d is shown. The amino ac id sequence encoded in the 1386-nucleot ide- long open reading f rame is ind icated above the DNA sequence.

15366

1. E . c o l i "

E. c o l i

E. c o l i

"

"

E. Y . mit. E. c o l i

Y. mit. E. c o l i

Y. mit. E. c o l i

Y . mit. E. c o l i

Y. mit.

"

"

"

"

E. @

Y. mit. E. coli Y . mit. E. w Y. mit. E. c o l i

Y . mit. E. c o l i

Y . mit. E.

Y. mit. E. c o l i

Y . nit. E. c o l i

Y. mit.

"

"

"

"

5. w Y . mit. E. c o l i

Y. mit. E. c o l i

"

"

Characterization of Yeast Nuclear Gene MSTl

M P V I T L P D G S Q R H Y D H A V S P M D V A L D I G P G L A K A C I '

I A G R V N G E L V D A C D L I E N D A Q L S I I T A K D E E G L E I ' o

I R H S C A H L L G H A I K Q L W P H T K M A I G P V I D N G F Y Y D ' 0 5

V D L D R T L T Q E D V E A L E K R M H E L A E K N Y D V I K K K V S ' * o

W H E A R E T F A N R G E S Y K V S I L D E N I A H D D K P G L Y F H ' 7 1

E E Y V D M C R G P H V P N M R F C H R F K L M K T A G A Y W R G D S , , ,

V R W H C S R N A L W N R A F Y S T R K A T K N A S S A P A T M T S * ' N N K M L Q ~ I Y G T A W O D K K A L N O Y L Q R L E E I A K R D H R r r ~

M K I Q L 5

M K L Q Q K F K F G F N E V V T P L I Y K K T L W E K S G H W E N Y A ' " V R S K L O E Y Q Y Q ~ K G ~ F M M D R V ~ T ~ D ~ K ~ , ~

DimK V E U D E[K E U G L v ] C L a G K K D R I"' T T S S E N R E Y C I K P M N C P G H V Q I N Q G L K . * s

I

V A m N N I I F E Y Q L G E G ] I E F T L Y b C I D R A 4 7 7 E I L E E S G K P W K L N P S D G A F Y G P K L D I M V T D H L R K T " I

N T K N V Q Q L D M C T A L Q K K L R N E L E A D D M E P V P L N D W 3 9 0 M N IUD S ~ S E Y vm T Q K B S N A 5 6 5

~ Q L Q [ Y N I ~ E ~ ~ N R K S F ~ T M S Q I W E " s z V E S G K V A V R T R R G K D L G S M D V N E V I E K L Q Q E I R S R 6 3 5

FIG. 6. Primary sequence homology of E. coli and yeast mitochondrial tRNA synthetases. The sequences of the mitochondrial (Y. mit.) and of the E. coli threonyl-tRNA synthetases (43) have been aligned by the MFALGO program. Positions with identical amino acids have been boxed.

posi t ive

n e g a t i v e II I I 1 1 1 1 1 I I I I I I I I 1 1 1 1 1 I I1 lllU I I1 I 111111 I U I I I

1 I I I I I I O 0 200 300 400

Amino Ac id Res idue

FIG. 7 . Charge distribution in the mitochondrial threonyl- tRNA synthetase. Arginine and lysine residues are denoted by full- length and histidine residues by half-length vertical lines above the horizontal. Vertical lines below the horizontal indicate the positions of aspartic acid and glutamic acid residues.

the expected 6.6-kb EcoRI fragment. In the transformant, the probe hybridized to a single fragment of 3 kb. Since the LEU2 gene has an internal EcoRI site, this fragment probably corresponds to the 5' end of MSTl plus part of the LEU2 insert. The results of these Southern hybridization analyses show that the respiratory-deficient transformant W303Vmstl car- ries a disrupted version of the gene which in wild type occurs in a single copy.

To ascertain whether the in situ inactivation of the identified MSTl gene abolished charging of tRNATh', a mitochondrial extract of W303Vmstl was used to acylate total wild- type mitochondrial tRNAs with [3H]threonine. As shown in Fig. 9, only the tRNATh' was acylated by the mutant extract, thus providing additional evidence that MSTl codes for an aminoacyl-tRNA synthetase specific for tRNATh'.

In a recent study we presented evidence that the mainte-

1 2 3 4

- 9.8kb - 6.6kb

- 4 . 5 k b

- 2.5kb

Y ic Y

[L 0 0 W

EcoRI FIG. 8. Southern hybridization analysis of genomic DNA

from the wild-type W303 and from the respiratory-deficient transformant W303Vmstl. Purified chromosomal DNAs from the two strains digested with PstI and with EcoRI were separated by electrophoresis on a 0.7% agarose gel. After transfer to nitrocellulose (47), the blot was hybridized with a nick-translated 310-bp BamHI fragment containing part of the MSTl coding and 5' flanking regions. The hybridization was done overnight at 65 "C in 6 X SSC, 10 mM EDTA, 0.5% SDS, 100 pg/ml sheared salmon sperm DNA, 5 X Denhardt's. Free probe was removed by two consecutive washes with 2 X SSC, 0.1% SDS, and four times with 5 mM Tris-C1, pH 8. The positions of the DNA size standards are marked in the margins. Lane 1, W303 DNA digested with PstI; lane2, W303Vmstl DNA digested with PstI; lane 3, W303 DNA digested with EcoRI; lane 4, W303Vmstl DNA digested with EcoRI. The location of the MSTl gene in the 6.6- kb EcoRI fragment of W303 is shown at the bottom of the figure. Also shown is the construction used for the in situ disruption. The MSTl gene and flanking regions are drawn with a solid line. The inserted fragment of DNA with the LEU2 gene is depicted by the broken line. The direction of transcription of the two genes is indicated by the arrows. The small bar corresponds to the probe used for the hybridization.

nance of wild-type mitochondrial DNA is dependent on a functional system of mitochondrial protein synthesis (15). Stringent mutations in nuclear genes coding for components of mitochondrial protein synthesis were found to induce deletions in mitochondrial DNA. This is also supported by the present studies. As already mentioned the mtl mutants convert to p- derivative clones at a high frequency. The instability of mitochondrial DNA is even more evident in the strains with the disrupted MSTl gene. Both W303Vmstl mutants consisted of 100% p- clones. Furthermore, such stringent mutants are unable to maintain wild-type DNA introduced through crosses with a respiratory competent karl strain (data not shown).

Identification of the MSTl Transcript and S1 Nuclease Mapping of the 5' Termini-The size of the MSTl transcript


400 7 1 30 0

200 E a 0 IO0

0 30 40 50 60 Fract ion

FIG. 9. Aminoacylation of mitochondrial threonine tRNAs with synthetases from W303Vmstl. Wild-type mitochondrial tRNAs were charged with [3H]threonine in the presence of a mitochondrial extract obtained from W303Vmstl. The acylated products were separated on RPC-5 as described in the legend to Fig. 1. The arrow shows the expected position of tRNAThr.

I 2 3

G +

G A 1 2 3 4 5

- 8 0 - T=-- f

+ I - i r =z I -5 - -

f 4 0 - I.@ “s

- 0.47 r m ” :e- -

was estimated by Northern hybridization analysis of RNA from CllO/T36, a transformant carrying the gene on an autonomously replicating plasmid and from CllO/T2 in which the MSTl gene had integrated into chromosomal DNA. Total yeast RNA was enriched for message by passage over an oligo(dT) column. The poly(A)+ fraction was denatured in glyoxal, separated on agarose, and blotted to diazobenzyloxymethyl paper. The Northern blot was challenged with the 310-bp BamHI fragment of the MSTl gene labeled by nick translation. This probe detected a single transcript of approximately 1550-1600 nucleotides in both transformants (Fig. 1OA). The stronger signal seen in CllO/T36 is probably due to the presence of the gene on a high copy plasmid.

To map the 5’ ends of the MSTl message, poly(A)+ RNA from CllO/T36 was hybridized to a 5’ end-labeled single- stranded DNA fragment. The BamHI fragment used as a probe contained 169 nucleotides of the coding region and 141 nucleotides of 5’ flanking sequence (see Fig. 5). Several S1- protected ends a t -116, -39, -33, and -28 were detected (Fig. 10B). Possible “Hogness” boxes (48) are found a t -133 (TAAAAAA), at -123 (TGAATAAT), and at -94 (TTAAAA). Whether these play a role in transcription is not clear at present. The fact that a recombinant plasmid with the AvaI fragment starting at -86 (Fig. 4) is capable of complementing mstl mutants indicates that sequences upstream of -86 are not essential for initiation of transcription. The present data also do not exclude possible additional transcriptional starts upstream of -141 in wild-type cells. Based on the length of the coding sequence, the message must have relatively short (160-220 nucleotide) 5‘- and/or 3’- untranslated regions.

Detection of the Threonyl-tRNA Synthetase in Yeast Mito- chondria-An immunochemical method was used to detect the MSTl product in yeast mitochondria. To obtain specific antibodies to the mitochondrial threonyl-tRNA synthetase, the BglII-Hind111 fragment internal to the MSTl gene was ligated in frame with the first half of the structural gene sequence of trpE in the E. coli high expression vector pATH2 (33). The recombinant plasmid should direct the production of a 50-kDa fusion protein of which the carboxyl-terminal 118 amino acid residues are encoded by the BglII-Hind111 fragment of MSTl. Ampicillin-resistant E. coli clones with the plasmid were verified to express a protein of the expected size following induction with indoleacrylic acid (Fig. 11).

The fusion protein was isolated by electrophoresis on preparative polyacrylamide gels and used to raise antibodies in rabbits. Whole serum obtained from 13-week immunized rab-

1- + 8 0 - ” A

FIG. 10. Characterization of the MSTl transcript. A, poly(A)+ RNA (12 pg) from the transformants CllO/T36 and CllO/ T2 was denatured in 1 M glyoxal, 50% dimethyl sulfate, 10 rnM NaP04, pH 7 (48) and electrophoretically separated on a 1% agarose gel. The RNA was transferred to diazobenzyloxymethyl paper and hybridized to the nick-translated 310-bp BarnHI fragment (see Fig. 9) according to the procedure of Alwine et al. (49). Lane 1, poly(A)+ RNA from CllO/T36; lune 2, poly(A)+ RNA from CllO/T2; lane 3, size standards consisting of 5’ end-labeled DNA fragments of known nucleotide lengths. Their sizes are marked in the margin. B, poly(A)+ RNA from CllO/T36 was hybridized to a 5’ end-labeled single- stranded fragment of DNA complementary to the RNA. This fragment extended from +173 to -141 of the sequence shown in Fig. 4. After 4 h a t 42 “C in 50% formamide, 0.4 M NaCl, 40 mM Pipes, pH 6.4, 1 mM EDTA, the mixture was diluted in S1 buffer and treated with different amounts of S1 nuclease (50). The reaction mixture was extracted with phenol, followed by ether, and the SI-protected hybrids were precipitated with alcohol following addition of an equal volume of 4 M ammonium acetate. Samples representing 33 pg of starting poly(A)+ RNA and 33 ng of 5’ end-labeled DNA were separated on a 10% polyacrylamide sequencing gel. For a control, the probe was mixed with Torula RNA (Sigma) and treated in a manner analogous to the experimental samples. The SI-protected ends were sized by comparison with neighboring lanes containing the 5’ end-labeled probe derivatized by the G- and G+A-specific reactions of Maxarn and Gilbert (31). Lane I, 60 units of S1; lune 2, 70 units of S1; lune 3, 80 units of S1; lune 4, probe plus Torula RNA digested with 60 units of S1; lune 5, probe plus Torula RNA digested with 70 units of S1 nuclease. The nucleotides are numbered according to the conven- tion of Fig. 4. Major SI-protected ends are indicated by arrows in the margin.

bits was used as a probe for the mitochondrial synthetase. Total mitochondrial protein from different strains of yeast was separated on a 12% polyacrylamide gel and assayed immunochemically after transfer to nitrocellulose. The results of these Western blot analyses are shown in Fig. 12. A prominent protein of 50-55 kDa is detected in mitochondria of two different wild-type strains (D273-10B and W303). The concentration of this protein is increased in strains of yeast in which the cloned MSTl gene is present on a multicopy plasmid. The protein was not seen in control strains that had a disrupted copy of MSTl. The overproduction of the 50-kDa protein in the transformants with pG69/T36 and its absence in mitochondria and in the postmitochondrial fraction of strains with the disrupted gene provide strong evidence of its identity as the mitochondrial threonyl-tRNA synthetase. Al-

15368 Characterization of Yeast Nuclear Gene MSTl

I 2 3 4 A B

93 kDa - 1

68 kDa - 1

20 kDa-

FIG. 11. Expression of the trpEIMST1 fusion protein in E. coli. E. coli transformants harboring either pATH2 or pATH2 with part of the MSTI sequence (BglII/HindIII fragment) fused to the trpE gene were grown as described under “Materials and Methods.” E. coli RR1 without plasmid was grown under identical conditions. Cells were harvested after several hours of induction with indoleacrylic acid and fractionated into total soluble and insoluble protein (34). The insoluble protein fraction was depolymerized in SDS and separated on a 12% polyacrylamide gel prepared according to Neville (52). Following electrophoresis the gel was stained with Coomassie Blue. Lane 1, molecular weight standards; lane 2, insoluble protein from E. coli RR1; lune 3, insoluble protein from E. coli RR1 transformed with pATH2; lane 4, insoluble proteins from E. coli RR1 transformed with pATH2 containing the M S T l insert. The sizes of the molecular weight standards are marked in the margin. The product of the truncated trpE gene in pATH2 appears as a diffuse band in the 35-kDa range of the gel (lane 3). The trpE/MSTl product is the heavily stained band above the 43-kDa marker in lune 4.

though some other proteins cross-reacted with the antiserum, these were also present in the strains with the disrupted gene. It is not clear whether these additional bands are due to nonspecific adsorption of the antibody, insufficient purity of the antibody, or whether they have related antigenic deter- minants. The antiserum to the fusion product was also used to test for the presence of the’ synthetase in several mstl mutants. The results shown in Fig. 12B indicate that the two mutants CllO and N619 have a protein of the same size as seen in wild type. The mutants, therefore, are most likely to be of the missense type.

DISCUSSION

The respiratory-deficient phenotype of pet mutants assigned to complementation group G69 has been ascribed to mutations in a nuclear gene ( M S T l ) which is proposed to code for an aminoacyl-tRNA synthetase that charges one of the two threonine tRNAs of yeast mitochondria. This is based on the findings that 1) the deduced amino acid sequence of the MSTl product is 36% identical to the E. coli threonyl- tRNA synthetase (43) and 2) mstl mutants as well as the deletion mutant W303Vmstl are unable to acylate the mitochondrial tRNATh’. The fact that the mutants do charge tRNAThr further suggests the existence of a separate synthetase specific for the latter tRNA substrate.

The primary translation product of MSTl is 462 amino acids in length and has a molecular weight of 54,030. Since

1 2 3 4 5 6 7 8 9

FIG. 12. Western blot analysis of yeast mitochondrial threonyl-tRNA synthetase in wild-type yeast and in mstl mutants. A, yeast were grown in either rich 2% glucose or 2% galactose medium. Mitochondria were prepared, and 60 pg of total mitochondrial protein were separated on a 10% polyacrylamide gel (54). The proteins were transferred to nitrocellulose and challenged with antiserum. Bound antibody was visualized by secondary binding of ‘251-protein A and exposure to Kodak XAR-5 film. The conditions for electroblotting and immunodetection were those of Schmidt et ul. (53). Lune 1, D273-10B (wild-type) grown in galactose; lane 2, C110/ T36 grown in 2% galactose; lane 3, W303 (wild-type) grown in 2% glucose; lanes 4 and 5, two independent clones of W303 with the MSTl disruption grown in 2% glucose; lunes 6 and 7, postmitochondrial proteins from the strains represented in lanes 4 and 5. The arrow shows the position of the 50-55-kDa protein present in mitochondria of wild-type and of the CllO/T36 transformant but absent in the clones with the disrupted gene. B, mitochondrial proteins (60 pg) from the mstl mutants CllO and N619 were separated on a 10% polyacrylamide gel prepared according to Laemmli (51). The proteins were electroblotted to nitrocellulose and treated with antiserum to the fusion protein as indicated. The antiserum reacts with a 50-55- kDa protein present in mitochondria of CllO (lane 8) and N619 (lane 9).

part of the amino-terminal sequence may be a signal peptide, the mature protein is likely to be 2-5 kDa smaller, An alignment of the yeast and E. coli (43) proteins requiring only 6 gaps shows 159 identical residues out of 436 residues in the E. coli sequence. Several regions of the two synthetases exhibit particularly high sequence conservation. The most striking homology is found between residues 99 and 188 where there are 54 identities (60%) and an additional 21 conservative substitutions (30%). Such highly conserved regions are usu- ally the hallmark of catalytic and/or substrate-binding sites in proteins sharing common functions. Computer searches for possible sequence similarities with other aminoacyl-tRNA synthetases have uncovered a stretch of 38 amino acids (residues 122-159) with significant homology to a short region of the E. coli glutaminyl-tRNA synthetase. The two sequences have 12 identical residues and 10 conservative substitutions. This homology occurs in a part of the glutaminyl-tRNA synthetase believed to be the start of an ap-fold involved in binding of the adenine nucleotide (55).

The most significant difference between the E. coli and the


mitochondrial threonyl-tRNA synthetases is the absence in the latter of some 200 amino acids at the amino-terminal end. Several lines of evidence indicate that the difference in the lengths of the two proteins is real and not due to a sequencing error. Plasmids carrying yeast nuclear DNA inserts with only 141 nucleotides upstream of the assigned initiation codon of MSTl are competent in complementing mstl mutants. Sec- ondly, the size of the mRNA and S1 nuclease mapping of the 5‘ ends are consistent with the length of the M S T l reading frame. Finally, antibodies to the synthetase react with a mitochondrial protein of approximately 50 kDa.

The ability of the truncated mitochondrial synthetase to acylate its tRNA substrate indicates that a sizable part of the E. coli synthetase, comprising approximately 200 amino-terminal residues, is not required for the acylation reaction. Recent studies on the bacterial alanyl-tRNA synthetase have allowed several domains of the enzyme to be identified (56). These include regions necessary for formation of the aminoacyl adenylate, transfer of the activated amino acid to the tRNA acceptor, and a third domain responsible for polymer- ization of the monomer to a tetramer (56). Since these functions can be artificially dissected, they appear to reside in nonoverlapping sections of the polypeptide chain. I t is con- ceivable that certain regions of aminoacyl-tRNA synthetases other than the basic catalytic core can be dispensed with and not impair overall enzymatic function. The mitochondrial

synthetase may be an example of a naturally imposed dissection. Unfortunately, the threonyl-tRNA synthetase of E. coli has not been investigated from this standpoint, and the function of the 200 amino-terminal residues is not known at present. There is evidence, however, that the first hundred nucleotides of the coding sequence in the bacterial message may be involved in attenuation of translation (45).

As already mentioned, the synthetase encoded in MSTl acylates only tRNA?. This tRNA is of special interest because it recognizes the CUN family of codons that normally code for leucine (11). The tRNA is also of interest from a structural standpoint, being the only known example with an asymmetrically placed anticodon (11,57). Characterization of the MSTl gene and of its translation product has enabled us to enlarge the body of information upon which to speculate on the evolutionary origin of the tRNA and of the synthetase. Given the extensive homology of the mitochondrial enzyme to the threonyl-tRNA synthetase of E. coli, it seems reason- able that the MSTI gene was derived from a duplicated copy of another yeast gene also coding for a threonyl-tRNA synthetase. The substrate for the latter synthetase probably was and remains tRNAThr with the conventional 3’-UGUd’ anticodon. It is also possible that the gene coding for the yeast cytoplasmic threonyl-tRNA synthetase duplicated and gave rise to the MSTl gene.

Acknowledgments-We wish to thank Dr. Russell Doolittle, whose data base and help were invaluable in initially finding sequence homologies.

REFERENCES 1. Dujon, B. (1981) in The Molecdur Biology of the Yeast Saccharomyces

Broach, J. R., ed) pp. 505-635, Cold Spring Harbo; Laboratory, Cold cereuisiae. Life Cycle and Inheritance (Strathern, J. N. Jones, E. W., and

Spring Harbor, NY 2. Douglas, M. G., and Butow, R. A. (1976) Proc. Natl. Acad. Sei. U. S. A. 73,

1083-1086 3. Hudspeth, M. E., Ainley, W. M., Schumard, D. S., Butow, R. A,, and

Grossman, L. I. (1982) Cell 30 , 617-626

4. Diatewa, M., and Stahl, A. J. C. (1980) Biochem Biophys. Res. Commun. 94,189-198

5. Diatewa, M., and Stahl, A. J. C. (1981) Nucleic Acids Res. 9,6293-6304 6. Schneller, J. M., Schneller, C., and Stahl, A. J . C. (1976) in Genetics and

Biogenesis of Chloroplasts and Mitochondria (Bucher, T., Neupert, W., Sebald. W.. and Warner. S.. e&) UP. 775-778, ElsevLeriNorth-Holland . . . ” Press, Amsterdam

7. Boeuslawski. G.. Vodkin. M. H.. Finkelstein. D. B.. and Fink. G. R. (1974)

8.

10. 9.

11. 12.

- ~e ~~

Biochem&$l3,46594667 ’

Acids Res. 3,1151-1165

. ,

Schneller, J. M., Schneller, C., Martin, R., and Stahl, A. J. C. (1976) Nucleic

Macino, G., and Tzagoloff, A. (1979) Mol. Gen. Genet. 169,183-188 Martin, N. C., and Rabinowztz, M. (1978) BcochemBtry 17,1628-1634 Li, M., and Tzagoloff, A. (1979) Cell 18.42-53 Macino, G., Comzzi, G., Nobrega, F. G., Li, M., and Tzagoloff, A. (1979)

Proc. Nutl. Acud. Sei. U. S. A. 76. 3784-3785 13. Bonitz, S.~G., Berlani, R., Coruzzi, G., Li, M., Macino, G., Nobrega, F. G.,

Nobrega M. P., Thalenfeld, B. E., and Tzagoloff, A. (1980) Proc. Natl. Acad. Sc;. U. S. A. 77,3167-3170

14. Tzagoloff, A., Akai, A., and Foury, F. (1976) FEBS Lett. 65,391-395 15. Myers A. Pa e L K and Tza oloff, A. (1985) EMBO J. 4,2087-2092 16. ten Berge,’A. &:A:, Z&tewelle, b., and Needleman, R. B. (1974) Mol. Gen.

Genet. 131,113-121

Acad. Sci.’ U. S. 2. 78,6354-6358

90

8228-8235

17. McGraw, P., and Tzagoloff, A. (1983) J. Biol. Chem. 258,9459-9468 18. Orr-Weaver T. L. Szostak, J. W., and Rothstein, R. J. (1981) Proc. Natl.

19. Wolf, K., Dujon, B., and Slonimski, P. P. 11973) Mol. Gen. Genet. 125,53-

20. Tzagoloff, A,, Akai, A., and Needleman, R. B. (1975) J. Biol. Chem. 250,

21. Beggs, J. D. (1978) Nature 275,104-109 22. Dieckmann, C. D., and Tzagoloff, A. (1983) Methods Enzymol. 9 7 , 355-

23. Nasmyth, K. A., and Reed, S. I. (1980) Proc. Natl. Acad. Sei. U. S. A. 77,

24. Ito, H., Fukuda, Y., Murata, K., and Kimura, A. (1983) J. Bacteriol. 153 ,

26. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Moleculor Cloning, 25. Birnboim, H., and Doly, J. (1979) Nucleic Acids Res. 7,1513-1523

Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 27. Laughon, A., and Gesteland, R. F. (1982) Proc. Natl. Acad. Sci. U. S. A.

79,6827-6831 28. Faye, G., Kujawa, H., and Fukuhara, H. (1974) J. Mol. Biol. 88,185-203 29. Baldacci, F., Carnevali, F., Frontali, L., Leoni, L., Macino, G., and Palleschi,

30. Pearson, R. L., Weiss, J. F., and Kelmers, A. D. (1971) Biochim. Biophys.

31. Maxam, A. M., and Gilbert, W. (1977) Proc. Nutl. Acad. Sci. U. S. A. 74,

32. Vleira, J., and Messin J (1982) Gene 19,259-268 33. Dieckmann, C. D., anfTiagoloff, A. (1985) J. Biol. Chem. 260,1513-1520 34. Spindler, K. R., Rosser, D. S. E., and Berk, A. J. (1984) J. Virol. 49 , 132-

35. Kleid D. G. Yansura D. Small B. Dowbenki D. Moore D. M Grubman 141

M. b., MLKercher, P. 6. Morgai, D. O., Ro$ert$on, B. H., andBachrach: H. L. (1981) Science 21k, 1125-1129

36. Woodbury, N. W. and Doolittle, R. F. (1980) J. Mol. Euol. 15,129-148 37. Doolittle, R. F. (lb81) Science 214,149-159 38. Needleman, S. B., and Wunsch, C. D. (1970) J. Mol. Biol. 48,443-453 39. Dieckmann C . L. Bonitz S. G., Hill J., Homison G., McGraw, P., Pape

L., Thal&feld,’B. E., &d Tzagodff, A. (1982) ’in Mitochondrial Gene; (Slonimski, P. P. Borst, P., and Attardi, G., e&) pp. 213-223, Cold

40. Anziano, P. Q., Hanson, D. K., Mahler, H. R., and Perlman, P. S. (1982) Spring Harbor PI&, Cold Spring Harbor, NY

41. De La Salle H., Jac , C and Slonimski, P. P. (1982) Cell 28,721-732 Cell 30,925-932

42. Bennetzen, b. L., an8 Hill, B. D. (1982) J. Biol. Chem. 257,3018-3025 43. Mayaux, J.-F., Fayat, G., Fromant, M., Springer, M., Grunberg-Manago,

M., and Blanquet, S. (1983) Proc. Nutl. Acad. SCI. U. S. A. 8 0 , 6152- 6156

44. Honvich, A. L., Fenton, W. A,, Wllliams, K. R. Kalousek, F., Kraus, J. P., Doolittle, R. F., Konigsberg, W., and Rosegberg, L. E. (1984) Science 224.1068-1074

360

2119-2123

163-168

C. (1975) Nucleic Acids Res. 2,1777-1785

Acta 228,770-774

560-564

45. Lesgenne, P., Plumbridge, J. A., Grunberg-Manago, M., and Blanquet, S. (1984) J. Biol. Chem. 259,5232-5237

47. Southern, E. (1975) J. Mol. Biol. 98,503-517 46. Rothstein, R. J. (1983) Methods Enzymol. 101,202-211

48. McMaster, G. K., and Carmichael, G. G. (1977) Proc. Natl. Acad. Sci. U. S.

, ~ ” _

A. 74. 4825-A528 49. AGine-J. C. Kemp D. J., and Stark, G. R. (1977) Proc. Natl. Acad. Sei.

50. Berk, A. J., and Sharp, P. A. (1978) Proc. Natl. Acad. Sci. U. S. A. 7 5 ,

, - ”- - - - - U. S.’ A. 74,535015354

1314-1 ?7Q 51. Breatbnach, R., and Chambon, P. (1981) Annu. Reu. Bwchem. 50, 349-

- - . - - - , !x32

52. 53.

54. 55.

56. 57.

Neviile, D. M., Jr. (1971) J. BioL Chem. 246,6328-6334 Schmidt, R. J., Myers, A. M., Gillham, N. W., and Boynton, J. E. (1984)

Laemmli, U. K. (1970) Nature 227,680-685 Webster, T., Tsai, H., Kula, M., Mackie, G. A., and Schimmel, P. (1984)

Jasin, M., Regan, L., and Schimmel, P.jl983) Nature 306,441-447 Slbler, A.-P., Dirheimer, G., and Martln, R. P. (1981) FEBS Lett. 132 ,

Mol. Biol. Euol. 1, 317-334

Science 226,1315-1317

344-348

Continued on nextpage.

15370 Characterization of Yeast Nuclear Gene MSTl TABLE I

Names and Genotypes Of g. cerevisiae strains

Genotype

Characterization Of a yeast nuclear gene (MST1) coding far SUPPLEMENTAR: MATERIAL TU

the mitochondrial threonyl-tRNAl sy-tase Louise K. Pap, T. J. Koerner, and Alexander Tzagoloff'

MATERIALS AND METHODS

strain ~

(141 (151 I151

N619 x CBll this study

this stud"

D273-10B/Al

BllO CllO

N619 -619 N293 aN293 N191 aN191

CBll CllO/Ll

Strains and media: Table I lists the genotypes and sources of the yeast strains used In thls study. The pet mutants were isolated by mutagenesis of the wild-type haploid strain s. cerevisiae D273-108/Al With either nitroso- guanidine or EMS as detailed Frevlously (Z0I0): E. 'coli RR1 was used for amplification of plasmid DNA and for expressLon-of- trpE/XSTl fusion N29s X m i l

this study N191 Y CBll CllO x LL2 (161 (171

R. Rothstein

R. aothstein

this study

this study

(191 (201

(18)

product. yeast were routinely grown either in liquid or on solid media with the

YPEG (3% glycerol, 2% ethanol, 2% peptone and 1% yeast extract). WU ( 2 % glu- following compositions: YPD ( 2 % glucose, 2% peptone, 1% yeast extract),

n ~ 6 7 % veaet nitroeen base w/o amino acids IDifcol). solid media con- LLI W303-1B LLZO

of 20 ug/ml : E . coli was grown-either on L-medium (1% bacto tryptone, 0 . 5 % yeast extract,-O.~aCl, 0.1% glucose1 or 1.75% Antibiotic Medium #3 1Difco). solid media contained 1.5% agar. Amvicillin or tetracycline re- P303-1A

W303Vmstl

w303Vmstl

&tiik-trai;formants were selected in-the presence Of 40 ug/ml bf the antibiotic.

yeast. The procedure ok Beggs (21) as modified by Dieckmann and Tzago- Transformations of yeast: TWO different methods were used to transform

loff 122) was used to initially select PET genes from the recombinant plas- mia lihrarv. The nrioinal mstl transformants CllO/Tl-T4 were obtained from

51p0 KL14-4Bpo ci, p , auxotroph ' ' " '

""" ~. single transformati& in W% 2 x lo9 cells w e r e transformed with 20 ug

of DNA. This library (23) was kindly provided by Dr. X. Nasmyth. some

~i~~~ et (24) except that the washed cells were incubated in 0.3 M LiCl transformations involving uniform plasmid DNA were done by the method Of

for 2-4 hours: 6 volumes of 50% PEG-4000 were added to the cells.

TABLE IT

Genetic Properties of m E Mutants

Stabilitya

33% 1% 4% 59%

Dubliehea procedures were used for zsoLat=on or plasmLd UNA 725,%l, puri-

enrichment of poly(A)+ RNA 1261, nick translation of double-stranded UNA fication of yeast nuclear DNA (15). isolation of total yeast RNA (271,

I ? f i ) fillino in of 3' recessed ends on double-stranded DNA with 3rKlenow

Preparation Of DNA, RNA, restriction analysis and labeling of DNA: + +

CllO N191 N293 N619 KL14-480' +

+ +

+ + + isnlatea from veast accordinv to tne nrocedure of ~ a ~ e et a1 (281. TO ex- Aminoacylation and analysis of mitochondrial tRNAS: Mitochondria were

The RNA was precipitated from the aqueous phase by adjusting the concen- 2% sodium dodec$l sulfate and extracted twice with water Saturated phenol.

tration of pota5siUm acetate to 0.2 M and addition of 2.5 volumes Of ethanol. The nucleic acids were dissolved in 10 mM Tris-Acetate pH 7.5 and

w=c Aialvaod for 3-6 hours aoainst 1 mM maanesium acetate followed by a high molecular weight RNA was precipitated with 2 M LiCl. The Supernatant

__",_" ." ~ . second ethanol precipitation. Mitochondrial aminoacyl tRNA synthetaies were extracted either with 1% potassium cholate or 0.3% Triton X-100 according to the procedure of Baldacci et a1 (29). Aminoacylation y a y s were performed as described by MaCino and Tzagoloff ( 9 ) using L-I HI Threonine (2.9 Ci/mol New England Nuclear Corp.. Mass.). The acyl.ated products were SeparatLd on a 0.6 x 60 cm RPC5 column by elution with a linear gradient of 0.38 to 0 68 M NaCl ( 9 301. Column fractions were precipitated with tri-

scintillation counter. chlaroacetic acid in t6e presence of carrier RNA and counted in a liquid

~~i~ ~ ~ ~ ~ ~

DNA sequencing: CsC1-purified pG69/T36 plasmid DNA was digested with RamH1. and the 0.3 and 2.7 kb framents were separated on and eluted from 1%

aStability refers to the percent of p+ vegetative progeny in stationary phase cultures of each mutant grown in liquid YPD medium.

TABLE 111

codon usage in ME ucu Ser 13 UAU Tyr 7 UGU Cys 2

UCA Ser 3 UAA Ter 1 UGA Ter 0 ucc Ser 4 UAC Tyr 8 UGC CYS 3

UCG Ser 6 UAG Ter 0 UGG Trp 10

UUU Phe 15 -&&. After secondary digestions of the 2.7 kb fragment with Tag1 or HinfI, the DNA wa treated with calf alkaline phosphatase and labelZT5t + h e n n a = w i t h ~ V - ~ ~ P I ATP 1,5000 Ci/mol. ICNI in the Presence of T4 Poly-

UUC Phe 16 UUA Leu 9 UUG Leu 10

_. . - - -. . _ _ . . - .. . , , . I . ~ .~~~ nucleotide kinase. The single-stranded fragments were seharated on 4% airyi- amide gels, eluted and sequenced according to the method of Maxam and Gil- bert (31). The internal BamHl site w a s crossed by sequencing the 353 hp BglII-Hind111 fragment. n t h e r set of sequencing reactions was performed

were preparatively isolated, d i g m i m m H 1 , or with DdeI together with t h e pUCl8 (321 vector. The two HindIII-EcoRI fragmexcarrying the insert

RSLI and sequenced as above. Most of the D m q u e n c e wasconfirmed on both FE%ds.

isolated from a subclone of a 1.8 kb AvaI fragment cloned into

cuu Leu 7 cuc Leu 3 CUA Leu 7 CUG Leu 6

AUU Ile 15 AUC Ile 7 AUA Ile 7 AUG Met 14

ccu Pro 7 CAU His 10 CGU Arg 4 ccc Pro 4 CAC His 2 CGC A r g 3 CCA Pro 8 CAA Gln 12 CGA Arg 1 CCG Pro 4 CAG Gln 7 CGG Arg 0

ACU Thr 11 EAU A m 17 AGU Ser 2 ACC Thr 0 AAC Asn 12 AGC Ser 1 ACA Thr 4 AAA Lys 23 AGA Arg lo ACG Thr 5 AAG Lys 18 AGG Arg 5

H i n d I H the F x i Expression and purification of the trpE/MSTl fusion protein: The BglII-

m i o n Vector PATH2 (33) linearized with B X l and HindIII. The r i g z n products were used to transform E. coli RR1, s i n g m c i l l i n resist-. m n t transformant verified to harEojor= Correct plasmid was grown under Con-

GUU Val 7 GCU Ala 12 GAU Asp 17 GGU Gly 12 GUC Val 2 GCC Ala 4 GAC Asp 11 GGC Gly 3 GUA Val 6 GCA Ala 2 GAA Glu 22 GGA Gly 5 GUG Val 5 GCG Ala 2 GAG Glu 9 GGG Gly 1 diii%S~&&&uily &in to induce optimal produ>tion of the^ fusion pro-

tein (341. The insoluble protein fraction containing most of the overex-

material was solubilized in 2 % SDS and 4 mg each was separated on 12% pressed protein was prepared by the method of Kleid et a1 (351. This

polyacrylamide slab gels ( 2 m thiik, 44 cm wide and 18 cm high). Fallowing brief staining with Coomassie blue, the region of the gel with fusion pro-

we$ orecinitated 3 successive times with 5 volumes of ice-cold acetone and tein was excized and electroeluted in an ISCO gel concentrator. The protein

TABLE IV

Complementation Test W303Vmstl x m& Mutants

d&blved>in 10 mM Tri.5-C1 pH 8 50 mM NaCl 1 mM EDTA, 0.1% SUS. Rabbit antibodies were prebared by Mrs: P. Hohbs (Pocono Rabbit Farm,

Pennl. Each of two adult rabbits was injected with 500 ug of the purified fusion protein in complete Freund's adjuvant. Half of the sample was fed intraveneously and the other half was injected subcutaneously. The rabbits _re ni-ipn hooe+pv iniections of 200-300 Of Drotein in incomplete Freund's

E N S N X N Z aW303Vmstl a51 o o + * + +

uW3030mstl aKL14-48 p o + + + found by the SEARCH program (36) with the N E W ~ o l y p e ~ t i ~ a ~ s e (371

Computer analysis: The homology between MSTl and E. coli ThrRS w a s

maintained by Russell F. DOOlittle (UCSD). The alignment was computed with the MFALGO program. The algorithm used was based on the One introduced by Needleman and Wunch (38) and has been previously described 136).

See legend t3 Table I1 for method Of complementation test.

characterization of a yeast nuclear gene (mst1) coding for the

Documents