characterization of the hydrophobic domain of pils, a
TRANSCRIPT
![Page 1: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/1.jpg)
University of Calgary
PRISM: University of Calgary's Digital Repository
Graduate Studies Restricted Theses
1999
Characterization of the hydrophobic domain of PilS, A
pseudomonas aeruginosa pilin gene trascriptional
regulator
Ethier, Julie
Ethier, J. (1999). Characterization of the hydrophobic domain of PilS, A pseudomonas aeruginosa
pilin gene trascriptional regulator (Unpublished master's thesis). University of Calgary, Calgary,
AB. doi:10.11575/PRISM/11876
http://hdl.handle.net/1880/25002
master thesis
University of Calgary graduate students retain copyright ownership and moral rights for their
thesis. You may use this material in any way that is permitted by the Copyright Act or through
licensing that has been assigned to the document. For uses that are not allowable under
copyright legislation or licensing, you are required to seek permission.
Downloaded from PRISM: https://prism.ucalgary.ca
![Page 2: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/2.jpg)
UNIVERSITY OF CALGARY
Characterization of the Hydrophobic Domain of PilS, A Pseudomonas aemginosa
Pilin Gene Transcriptional Regulator
Julie Ethier
A THESIS SUBMllTED TO THE FACULTY OF GRADUATE STUDIES [N
PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF
MASTER OF SCIENCE
DEPARTMENT OF MICROBIOLOGY AND INFECTIOUS DISEASES
CALGARY, ALBERTA
DECEMBER, 1999
0 Julie Ethier 2999
![Page 3: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/3.jpg)
National Library u*l of Canada Biblioth&que nationde du Canada
Acquisitions and Acquisitions et Bibliographic S e ~ ~ c e s services bibliographiques
395 Wellington Street 395, cue Wellington OtEawaON KIA- -ON KIAOW Canada Canada
Your& Vomd-
owe, Morrw~mrsnco
The author has granted a non- L'auteur a accorde une licence non exclusive licence allowing the exclusive pennettant a la National h'brary of Canada to Bibliotheque nationale du Canada de reproduce, Ioan, dktri'bute or sell reproduke, preter' distri'buer ou copies of this thesis in microform, vendre des copies de cette these sous paper or electronic formats. Ia fome de mrmcrofiche/f3m, de
reproduction sar papier ou sur format electronique.
The author retains ownership of the L'auteur conserve la propriete du copyright in this thesis. Neither the droit #auteur qui protege cette these. thesis nor substantid extracts fiom it Ni Ia these ni des extraits substantiels may be printed or otherwise de ceIIe-ci ne doivent &re imprim& reproduced without the author's on autrement reproduits sans son permission. autorisation.
![Page 4: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/4.jpg)
ABSTRACT
In Pseudomas aemgimsa, synthesis of pilin, the major protein subunit in pili,
is regulated by a two-component signal transdudion system in which PilS is the
sensor kinase. PilS is composed of three domains: an N-terminal hydrophobic
domain, a central cytoplasmic linker region and the C-terminal transmitter region
conserved among many other sensor kinases. The signal that activates PilS and
consequently pilin transcription remains unknown. The membrane topology of
the hydrophobic domain was determined using the lac2 and phoA gene fusion
method. We propose a model in which the hydrophobic domain forms six
transmembrane helices, while the N- and C-termini of PilS are cytoplasmic. We
also provide evidence that shows that all six transmembrane segments are
required for PilS function and signal transduction, but not for membrane
anchoring or polar targeting.
iii
![Page 5: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/5.jpg)
ACKNOWLEGOEMENTS
1 would first like to thank Dr. Boyd, my supervisor. 1 a m very grateful for her
confidence in me, her patience and for the opportunities she has given me. I
also wish to thank the members of my supervisory committee, Drs Woods,
Schryvers and Turner, for their advice and expertise. I must also acknowledge
Dr. Schryven for generously allowing me use equipment and material from his
laboratory. I thank Dr. Boyd, Guillaume Gagnon and Michael Shepel for
constructing some of the plasmids used in this study; Michael Schoel for his
technical assistance with the fluorescent microscope and Dr. Mike Surette for
allowing me to use his fluonmeter.
I also thank my fellow students in Dr. Schryvers' laboratory, Leanne. Henry and
Shane as well as the other members of his laboratory for making the past three
years a lot of fun. Finally, on a more personal note, I want to thank my mother,
my brother, my friends and famiIy and Kurt.
![Page 6: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/6.jpg)
TABLE OF CONTENTS
Approval page ..... ........................ .. ... ..... . . . . ................................. ii
*.. Abstract ...............................................-........... C ~ . ~ ~ ~ ~ ~ ~ ~ . ~ ~ C ~ . ~ ~ C ...-.......*......... III
Acknowledgments .....................................~........................................... iv
Table of content ................................ . C . . C ~ C . ~ . ~ C .........................-...*...-......... v
List of Tables .... .... C.C...C .....................--. . C C C C C C C ....... CIC.... x
List of Figures ...................... ........... . . ..... . .....................*..... . ............ .. xi
. . List of abbrev~atlons ........ .. ........... ..... ................................ xiv
Chaoter 1. INTRODUCTION ................... .t..~~~C~C.~.~~.C.... ........................ 1
Cha~ter 2. LITERATURE REVIEW ................................................... 4
2.1 Pseudomonas aemginosa virulence and pathogenesis .............. 4
2.1 .I Extraceliular virulence factors ................... .. ..... CC....CCC..... 4
2.1.2 Adherence and colonization . ..... ...... .... ......*... ... -.-- ...--. -. . . . 5
2.1.2.1 Non-pilus adhesins ..........- .... ....................... 5
2.1 1.2 Type N piii as an adhesin .....................-....*...-......... 6
2.1.3 Cytotoxicity, invasion and immune response ....-...-............ 8
2.1 -4 Model of P. aeruginosa infection in CF lungs ..... ... ...... .. . . . . 1 0
*.
2.2 Type IV prl~ ........................................ CCCC. ..................................... 12
2.2. I Biogenesis .-................................................... C.C...C. ...........- 12
22.2 Function .................................. .-.--. ....................... 14
![Page 7: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/7.jpg)
2.2.3 Regulation ........................................................................ 18
2.3 Twocomponent signal transduction systems ............................. 19
2.3.1 Definition. structural characteristics and mechanism ......... 19
2.3.2 Use of two-component systems in bacteria ................... .... 22
2.3.2.1 EnvZ-OmpR and osmoregulation ............................. 22
2.3.2.2 The chernotaxis system ............................................ 26
2.3.2.3 NW-NtrC and nitrogen regulation ............................ 27
2.3.3 The PiIS-PilR system of P . aemginosa .............................. 29
2.3.3.1 PilR, the response regulator ..................................... 29
2.3.3.2 Function of PilS, the sensor kinase .......................... 30
2.3.3.3 Structural features of PilS ......................................... 31
......................................... 2.4 Structure of inner membrane proteins 32
2.4.1 Topology: definition and classification ............................... 32
2.4.2 Implications of sequence modifications ............................. 34
........................................ 2.4.3 Mechanisms of protein insertion 35
2.4.3.1 Secdependent pathway ........................................... 35
2.4.3.2 Signal recognition particle pathway .......................... 37
........................................ 2.4.3.3 Sec-independent pathway 38
2.5 Topological study of inner membrane proteins ........................... 39
2.5.1 Statistical prediction of a protein's topology ....................... 39
2.5.1 -1 Amino acid distribution and the positive inside rule .. 39
2.5.1 -2 Hydrophobicity plots and prediction .......................... 41
![Page 8: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/8.jpg)
2.5.2 Experimental determination of a topology .......................... 42
25.2 . e n fusions ....................................................... 42
2.5.2.2 Other approaches ..................................................... 43
Chapter 3 . MATERIALS & METHODS .............................................. 45
3.1 Media and supplements ....................... ... ................................ 45
3.2 DNA manipulations ..................................................................... 45
3.2.1 DNA linker insertion ........................................................ 46
3.2.2 Alkaline phosp hatase treatment ........................................ 46
3.2.3 DNA transformation in P . aenrginosa ................................ 47
................. .........*.*.*................................ 3.3 Mutagenesis of pits .. 47
3.3.1 PCR mutagenesis ........... .. .......................................... 4 8 .
3.3.2 Quikchangem mutagenesis ....................................... 40
3.4 Construction of the pilS internal deletions ................................... 50
3.4. I Full-length deletions ........................................................... 50
3.4.2 Truncated deletions ........................................................... 51
3.5 Construction of the gene fusions ................................................. 52
3.5.1 The reporter vectors .......................................................... 52
................................ 3.5.2 Fusions of piIS to lacZ, phoA and gfp 53
............................................ 3.6 Construction of the promoter fusion 53
3.7 Hybrid protein analysis ................................................................ 54
3.7.1 Western immunoblotting of the hybrid proteins .................. 54
3 7.2 Alkaline p hos p hatase and 8-9 alactosidase assays ............ 55
![Page 9: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/9.jpg)
3.7.3 Fluorescence assays ................... .... ........................... 55
.............. 3.8 Cell fractionation .. ......................................................... 56
3.9 Microscopy .................................................................................. 57
.......................................... Cha~ter 4 . TOPOLOGICAL MODEL OF PilS 58
4.1 Results ............................................... ......... ......... 58
4.1 -1 Topological predictions .................................................. 58
....................................... 4.1 -2 Construction of the gene fusions 58
4.1.3 Analysis of the hybrid proteins ........................................... 59
............................ 4.1 -4 Enzymatic activity of the hybrid proteins 61
4.1 -5 PilS possesses six TM segments ...................................... 62
4.1 -6 Orientation of the TM segments ......................................... 64
4.1 .6.1 FulClength deletion hybrid proteins ........... .. ............ 64
................. 4.1.6.2 Truncated deletion hybrid proteins ........ 67
4.1 -7 Cellular localization of the PilS-LacZ hybrids ..................... 68
................................................................................ 4.2 Discussion 6 9
.................................... Cha~ter 5 . ROLE OF THE PilS TM SEGMENTS 79
5.1 Results ........................................................................................ 79
............................................. . 5.1 1 Construction of the plasmids 79
5.1 -1 . 1 The internal helix deletions ....................................... 79
.......................................... 5.1 .1.2 The piM promoter frrsion 79
5.1 .1.3 The PilS-GFP fusions .. ....... ,. .................................... 80
5.1 -2 CelIular localization of the PIS-GFP hybrid proteins ................ 81
![Page 10: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/10.jpg)
5.1.2.1 Ep ifiuorescence microscopy ................................... 8 1
5.1.2.2 Cell fractionation of the nonpolar PilS-GFP ........... .. 83
5.1.3 PilS hrnction assays ........................................................... 85
.................................... 5.1 .3.1 Experimental considerations 85
5.1.3.2 Kinase and phosphatase function of mutant PilS ..... 87
5.2 Discussion .,,.. .............................................................................. 91
Chapter 6 . CONCLUSlONS AND FUTURE DIRECTIONS ..................... 98
........................................................ Cha~ter 7 . TABLES AND FIGURES 100
Chaoter 8 . LITERATURE CITED ............................................................. 175
![Page 11: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/11.jpg)
Table I.
Table 2.
Table 3-
Table 4.
Table 5.
Table 6.
Table 7.
Table 8.
Oligonucleotide primers used in this study
Strains and plasmids used in this study
Enzymatic activity of the PiIS-Lac2 and PilS-PhoA
hybrid proteins
Colony phenotype of the fuIClength deletion hybrid
proteins
Enzymatic activity of the PilS-Lac2 and PilS-PhoA
deletion hybrid proteins
Effect of the presence of the translational initiation
region FIR) on GFP fluorescence
Phosphatase activity of the PilS mutants
Kinase activity of the PilS mutants
![Page 12: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/12.jpg)
LIST OF FIGURES
Figure f.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.
Figure 7.
Figure 8.
Figure 9.
Figure 10.
Figure 11.
Figure 12.
Figure 13.
Figure 14.
Schematic representation of the mechanism of pilA
-gene transcriptional activation
Predicted top0 logical model of PilS
Classification of inner membrane proteins
Sec-dependent translocation and insertion mechanism
The signal recognition particle (SRP) pathway
Sec-independent insertion of the M I 3 procoat protein
Theoretical principle of the gene fusion approach to
study topology
Rationale for the construction of the fusion pfasmids
Diagram of the reporter vectors
Schematic representation of the PilS-Lac2 and PilS-
PhoA hybrid proteins
Schematic representation of the Pits-Lac2 and PilS-
PhoA deletion hybrid proteins
Schematic representation of the fulClength deletions of
PilS and PIS-GFP hybrid proteins
Hydrophobicity profile of PilS as determined by the
Km and DoolittIe scale
Amino acid sequence of PiIS
![Page 13: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/13.jpg)
Figure 15. Western imrnunoblot of the PilS-La& and PilS-PhoA
hybrid proteins
Figure 16. Qualitative pilin assay in strains carrying the fusions to
full length PiIS
Figure 17. Enzymatic activity of the PilSLacZ and PilS-PhoA
hybrids in P. aemginosa
Figure 18. Enzymatic activity of the PilSLacZ and PilS-PhoA
hybrids in E. coli
Figure 19. Summary of the gene fusion results and topological
model of PiIS
Figure 20. Enzymatic activity of the fusions TM1, TM1 C and
TMl Alinker
Figure 2q. Western immunoblot of the fusions TM1, TMIC and
TMI Alinker
Figure 22. Enzymatic activity of the PiiS-Lac2 and PilS-PhoA
deletion hybrids in P. aenrginosa
Figure 23. Enrymatic act-vity of the PilS-Lac2 and PilS-PhoA
deletion hybrids in E. coii
Figure 24. Predicted topological models of the ATMI and ATM2
deletions
Figure 25. Cell fiactrionation of the PilSLacZ hybrids showing
positive activity
xii
![Page 14: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/14.jpg)
Figure 26. Sequence comparison of the junction of the pilA
promoter and g@ gene in pGG103A and pJE411 ?61
Figure 27. Epifl uorescence microscopy images of the Piis-GFP
fusion proteins 163
Figure 28. Cell fractionation of the non-polar PilS-GFP hybrids 165
Figure 29. Summary of the cellular localization, kinase and
phosphatase assay results of the PilS mutants 1 67
Figure 30. Preliminary testing of the kinase and phosphatase
functions of PilS mutants under different induction
conditions
Figure 31. Phosphatase assay of the PilS mutants
Figure 32. Kinase assay of the PilS mutants
![Page 15: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/15.jpg)
LIST OF ABBREVIATIONS
a. a.
AlF
Amp plac
bp Carb CF
CFTR
CIAP
GFP
GSP
IL
CPTG
K
kDa
LacZ
M
MCP P
PBS
PCR
PhoA
PMN
RBS
S
SD
SDS-PAGE
Amino acids
Anti-internalization factor
Ampicillin
beta-lacbmase
Base pairs
Cahenicillin
Cystic fibrosis
Cystic fibrosis transmembrane regulator
Calf intestinal alkaline phosphatase
Green fluorescent protein
General secretory pathway
I nte rteu kin
Isopropy CP-D-thiogalactoside
Kinase
Kilodaltons
Pgalactosidase
Membrane
Methyl-accepting chemotaxis protein
P hosphatase
P hosp hate-buffered saline
Polymerase chain reaction
Alkaline phosphatase
Polymorphonuclear
Ribosome-binding site
Soluble
Sodium dodecyl sulFate polyacrylarnide gel electrophoresis
SRP Signal recognition particle
![Page 16: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/16.jpg)
str
TBS
Tet
TIR
TM UAS
Xg al
XP
Streptomycin
Tris-buffered saline
Tetracycline
Translational initiation region
Transmembrane
Upstream activation sequence
5-b rom~chloro-3-indoly l g alacto pyranoside
5-brom~chloro-3-indoIylphosp hate
![Page 17: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/17.jpg)
Chanter f . lNTRODUCT10N
Pseudomonas aemginosa is an ubiquitous Gram-negative bacillus capable of
surviving in harsh and nutritionally scarce environments. Despite its wide and
varied array of colonizing and virulence factors, P. aenrginosa rarely infects
healthy individuals where the body's immune system is able to efficiently clear
the bacterium before initiation of an infection. However, P. aeruginosa is an
important nosocomial and opportunistic pathogen and should be considered a
great threat for individuals with an imrnunocompromized immune system, such
as AIDS, cancer, transplant and bum patients (1 50). Cystic fibrosis (Cf) patients
are particularly susceptible to chronic, and eventually fatal, lung infections by P.
aemghiosa (59).
The type 1V pili produced by P. aemginosa are the principle agents responsible
for bacterial adhesion to epithelial cells (164). More than 30 gene products are
required for the synthesis, assembly, function and regulation of these polar
appendages [reviewed in (I, 30,97)]. Transcriptional regulation of pilA, the gene
encoding the structural subunit pilin, is mediated by two factors: RpoN, the
alternative sigma factor 054 (75,146), and a two-component signal transduction
system composed of PilS and PilR (t6,66,76).
![Page 18: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/18.jpg)
The sensor histidine kinase of a two-cumponent regulatory system senses an
environmental activating signal and stimulates the response regulator through a
phosphorelay mechanism. The activated response regulator then stimulates the
appropriate adaptive response by activating gene transcription or chemotaxis
(42). Two-component systems have been identified in several organisms where
they regulate many viruience factors and survival mechanisms. Signals detected
by bacterial sensor proteins include changes in osmolarity, salinity, temperature,
pH, availability of nutrients and levels of nitrogen or oxygen (41, 134).
PilS and PilR form a two-component system required for pilin expression in P.
aemqiiosa. PilS senses an unknown signal and autophosphorylates, PilR
receives the phosphate from PilS and binds to four upstream activating
sequences (UAS) upstream of the pilA transcriptional start (79). The PilR
complex then interacts with RpoN and the RNA polymerase to initiate piiin
transcription (Figure 1 ).
PilS is both a PilR kinase in the presence of the activating signal, and a phospho-
PilR phosphatase when the signal is missing (17). The signal(s) that determine
whether PilS will be a kinase or a phosphatase are unknown, but the
phosphatase activity can be mimicked by overexpression of PBS. Also, high
concentrations of PiIS in the cell inhibit pilin expression in a dose-dependent
manner (17). PilS is a polarfy Iocalked protein composed of three regions
![Page 19: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/19.jpg)
(Figure 2): an N-terminal hydrophobic domain, a central linker domain and a C
terminal kinase domain. The N-terminal 177 amino acids of PilS are predicted to
form six transmembrane (TM) helices that anchor the 59 kDa protein to the inner
membrane. The TM helices are connected by short hydrophilic periplasmic and
cytoplasmic loops. The stimulus is detected via the N-terminal domain or the
central linker region, or possibly both domains.
The specific aims of this study are two-fold. First, 1 intend to prove or disprove
that the N-terminal hydrophobic moiety of PilS is embedded within the membrane
and composed of six TM helices as predicted by computer analysis. Second,
with the topological mode[ of PilS elucidated, I will determine which helices, if
any, are required for PilS function, membrane anchoring and polar localization.
Determination of the accurate topological model of PilS would provide valuable
information concerning the activating signals with which it interacts to stimulate
pilin transcription. Internal helix deletion studies of PilS would contribute to our
understanding of its ftrnction as a kinase and phosphatase as well as the
implications of cellular localization on function. Wrth a better understanding of
the signal transduction event leading to initiation or repression of pilin
transcription, it may eventualIy be possible to control pilin expression. A non-
piliated strain of P. aemghosa would be less efficient at colonizing the lungs of
CF patients and delay or prevent the onset of a chronic infection.
![Page 20: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/20.jpg)
Chapter 2. LlTERATURE REVIEW
2.1 Pseudomonas aemainosa virulence and pathoaenesis
2.1 .I ExtracelIular virulence factors
The virulence factors produced by P. aemginosa can be divided into two
categories: secreted or extracellu lar virulence factors, and cell-associated factors
or adhesins. The extracellular products secreted by P. aenrginosa include
exotoxin A, exoenzyme S (ExoS), exoenzyme T (ExoT), exoenzyme U (ExoU),
phospholipase C, rharnnolipid, elastase, alkaline protease and the siderophores
pyochelin and pyocyanin. Exotoxin A and ExoS are ADP-ribosyl transferases
that inhibl protein synthesis and cause local tissue damage. These two toxins
are also involved in bacterial invasion and dissemination. ExoT is also an ADP-
ribosyI €ransferase, but its activity is much weaker than that of ExoS. ExoU is a
potent cytotoxin responsible for acute cytotoxicity and epitheliai injury, however
its mechanism of adion remains unknown. Phospholipase C and rharnnolipid
are hemolysins that break down lecithin and other phospholipids found in the
lung surfactant and epithelial cell membranes. Phospholipase activity and
cellular injury fadfitate adherence to epithelial cells by exposing new receptors to
bacteria[ adhesins. Elastin, a component of blood vessels and lung tissue, is
destroyed by elastase resuking in pulmonary hemorrhage. In addition to elastin.
elastase also degrades fibrin, collagen, human immunogIobulins A and G and
![Page 21: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/21.jpg)
5
other components of the immune response. Alkaline protease, better known for
its involvement in eye infections, also degrades immunoglobulins and neutralizes
polymorphonuclear leukocytes (PMNs). For reviews on the virulence factors of
P. aemginosa, see references (50,55,61, 126, 150, 163).
The exopolysaccharide alginate is another important virulence factor secreted by
P. aemginosa. The conversion of a non-mucoid phenotype to an alginate-
producing rnuwid phenotype and the formation of microcolonies are
unmistakable characteristics of the presence of a chronic respiratory infection.
Alginate plays many roles in the pathogenesis of P. aeruginosa [reviewed in
(6011. Briefly, it reduces the proficiency of the immune response towards the
intruding pathogen by blocking the phagocytic activity of macrophages and
neutrophits and suppressing opsonization and neutrophil chemotaxis. Alginate
also efficiently neutralizes reactive oxygen intermediates and hypochlorite
released from phagocytic cells. Although alginate is not considered a major
adhesin, it does facilitate attachment of bacteria to the epithelium and solid
surfaces aiding in the formation of biofilms.
2-1.2 Adherence and cotonitation
2.1.2.1 Non-pilus adhesins
The first step in establishing an infedion is adherence of the bacteria to the
epithelial cells which, with P. ae~gfnosa, is mediated by type N piii and other
![Page 22: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/22.jpg)
non-pilus adhesins. The abnormally thick mucus and deficient mucociliary
clearance in CF lungs as well as epithelial cell damage also promote colonization
at this site (168).
The flagellum is the main non-pilus adhesin although its principal functions are
motility and chemotaxis. Mutants defective in fliC, the flagellin structural gene.
show reduced binding to human airway epithelial cells and decreased virulence
in a mouse model of pulmonary infection (49). Purified flagellin binds to the
gangliotetraosyl ceramide GM1 and its asialylated form, asialoGM1, commonly
found on epithelial cell membranes (49). Adherence to purified respiratory mucin
is not impaired in mutants lacking Ragellin andlor pilin (1 19, 131) suggesting that
other adhesins, in addition to pilin and flagellin, are responsible for binding to
mucin. Like pilin and flagellin, these non-pilus adhesins are under the regulatory
control of RpoN (119). The flagellar cap protein FIiD and other proteins involved
in the regulation and assembly of the flagellar apparatus were also shown to be
required for bacterial binding to respiratory much (5, 117). The
exopolysaccharide produced by muwid strains is also considered a non-pilus
adhesin (95, 118).
2.1.2.2 Type N pili as an adhwin
The primary adhesin in P. aeruginosa is the type 1V pilus. Although pili do not
play a major rok in adhesion to mucin, their role in adherence to epithelial cells
has been well documented (38.1 19.120.164).
![Page 23: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/23.jpg)
![Page 24: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/24.jpg)
2.1.3 Cytotoxicity, invasion and immune response
P. aemghnosa is generally considered an extracellular pathogen, however
bacterial internalization by epithelial cells has been reported in tissue culture and
animal models (24.27,53. l lo, 11 I). These experiments were conducted using
various cell lines and both clinical isolates and laboratory strains of P.
aeruginosa.
P. aeruginosa is capable of both invasion and cellular killing. It is possible that
epithelial cell damage is a prerequisite for invasion and dissemination of P.
aemgimsa to deeper tissues. It was proposed that the presence or absence of
an invasion inhibitor determine if the bacterium will kill or invade, respectively
(27,63). The Type Ill secretion system is required for cytotoxicity as mutants
with defects in some components of the Type Ill secretion machinery are non-
cytotoxic but internalized by epithelial cells (63). It is likely that this system is
required for secretion of cytotoxins and the still unidentified anti-internalization
factor (AIF) (63). A defective Type III system would prevent secretion of the
cytotoxins and AIF, leading to bacterial internalization and non-cytotoxicify.
Invasion may be independent of or negatively regulated by ExsA, since ExsA
mutants are noncytotoxic and internalized (52). ExsA is a transcriptional
acfivafor that regulates expression of the exoenzyme S regulon, which encodes
the components and secrekd products (ExoS, EoT, ExoU) of Type Ill secretion
![Page 25: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/25.jpg)
9
(55). The Type Ill machinery of P. aemginosa is very homologous to that of the
well described Yersinia Type Ill system.
Factors responsible for macrophage apoptosis are also secreted via the Type Ill
secretion system. Bacterial ingestion is not required for induction of apoptosis
(62). ExoU, a cytotoxin regulated by ExsA and expressed in the absence of
ExoS and ExoT (51), is not involved in induction of macrophage apoptosis but
causes necrotic death of macrophages (62).
Interaction of P. aemginosa pili with the receptor asialoGM1 was recently shown
to promote either cytotoxicity or internalization of the bacterium into epithelial
cells, depending on the strain type (27). It is likely that pili-mediated adherence
to epithelial cells and Trpe Ill secretion act together to promote epithelial cell
damage. It is possible that the initial binding of the pilus to the cell and
subsequent retraction of the piIus would allow a close and tight contact between
the pathogen and the epithelial cell, thus activating Type Ill secretion of cytotoxic
substances (ExoS, ExoT, ExoU) and AIF. In addition, mutants lacking PilT, a
protein proposed to catalyze pilus retraction, show reduced epithelial cell
cytotoxicity in vitb (26).
In a healthy lung, potentially infectious P. aemginosa can be cleared by cellular
ingestion and desqrramation. However, in cells lacking a functional CFTR, this
![Page 26: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/26.jpg)
20
defense mechanism fails and the bacteria remain in the airway lumen where they
secrete their virulence factors, cause tissue damage and elicit an inflammatory
response (1 10)- This damaging inflammation is characterized by increased
numbers of PMNs and elevated production of interleukin-8 (11-8) as well as the
presence of other proinflammatory cytokines in the bronchoaiveolar lavage fluid.
The inflammatory response persists even after reduction in bacterial load
because of the accumulated exoproducts (1 01). 11-8 production by epithelial
cells and complement activation attract PMNs to the respiratory epithelium.
These cells release lysosornal enzymes and proteases such as elastase which
break down immunoglobulins and immune complexes (70).
2.1.4 Model of P. aemginosa infection in CF lungs
P. aemginosa needs to break the host first-line defenses in order to initiate
infection. The impaired mumciliary clearance mechanism and altered mucus
composition of CF lungs provide the break needed for colonization by the
bacteria. The flagellum may be important in the first stage of colonization by
mediating motility toward the susceptible epithelium and facilitating dissemination
of the organism (49). Non-mucoid P. aemgiiosa adhere to host respiratory
epithelial cells and rnucin by the type N pili and other non-pilus adhesins.
Proteases and phospholipase C promote adhesion by damaging the epithelium
thereby exposing more receptors to the adhesins (39, t 50).
![Page 27: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/27.jpg)
A chronic infection is established soon after the initial step of colonization.
Secretion of the many extracellular virulence factors helps the bacteria obtain
nutrients and evade the immune system. Siderophores are secreted to increase
intake of iron, an essential nutrient Exotoxin AT ExoS and elastase also
contribuie to nutrient intake by mediating host cell destruction and consequently
release of iron and nutrients (61). Protease and elastase inactivate the cytokines
g amma-interferon and tumor necrosis factor, as well as break down complement
components and immunoglobulins (39). Host production of 11-8 induced by
bacterial adherence to epithelial cells increases the number of neutrophils in lung
tissue (1 01). The prolonged inflammatory response and secretion of proteases
and oxidative radicals by neutrophils is responsible for most of the tissue damage
observed in CF lungs (70).
Once the infection is well established, a number of adaptive changes occur to the
colonizing strains. Most notable is the conversion ftom the non-mucoid colony
phenotype to the mucoid phenotype characterzed by the production of the
exopolysaccharide afginate. Alginate takes over as the primary adhesin and is
very effective at protecting the bacteria1 cell from the immune system and its
environment by allowing the formation of microcolonies (60). Other changes
sometimes include loss of flagellum and pili, production of a rough
IipopoIysaccharide and reduction in exoproduct secretion. All of these
![Page 28: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/28.jpg)
phenotypic modifications render the cell non-rnotiie, more resistant to
p hagocytosis and serum-sensitive (non-typeable).
2.2.1 Biogenesis
Type IV pili are long fibrous organelles localized to one pole of the bacterial cell.
They are primarily composed of one major subunit, pilin, assembled in a helical
structure with approximately five subunits per turn (54). P. aeruginosa pilin
belongs to the type IV family of bacterial pilins, which also includes pilins from
Neissenia gononhoeae, N. meningBdis, Moraxelia sp., Myxococcus xanthus,
Legionella pneumophila, Aemmonas hydrophila and Dichelobacter nodosus
(138). This class of pilin is characterized by a conserved hydrophobic N-
terminus and a unique C-terminal domain where the antigenic and functional
differences among species reside (97, 138). Like all pilins of this class, P.
aemginosa pilin (PiIA) is first synthesized as a prepilin precursor. The
bifunctional enzyme PilD then cleaves off a short leader peptide from the
precursor and methylates the first amino acid of the mature protein, a
phenylalanine (87, 104). Therefore, type IV pili are sometimes referred to as N-
methylphenylaianine (MePhe) pili.
![Page 29: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/29.jpg)
13
Similarities between the type IV pili produced by various bacterial species are not
limited to the amino acid sequence of the pilin protein. Indeed, homologies and
similarities are seen in many other pilus assernbLy and functional components
such as the leader peptidase, putative nucleotide-binding proteins, outer
membrane proteins and regulatory components.
As well, many pilus synthesis components have hornologues in the Type I1
secretion system (general secretion pathway, GSP), most notable being PilD,
also described as XcpA, a protein required for Type I1 secretion (67). P.
aeruginosa utilizes the Type II secretion pathway to deliver its exotoxins,
elastase and alkaline protease to the extracellular milieu. Type I1 secretion is a
two-step process where the protein first traverses the inner membrane with the
help of the Sec apparatus and then crosses the outer membrane by a separate
mechanism (1 16) For P. aenrginosa, the second translocation step is mediated
by the Xcp proteins. Five of the Xcp proteins (XcpT, U, V, W and X) contain an
N-terminal sequence (including a cleavable signal peptide) homologous to that of
the pilin subunit and are therefore referred to as pseudo-piiins. Other
components of the GSP also show homoiogy to pilus synthesis components,
suggesting that the mechanism of pilus assembly may be related to that of
protein secretion (88, 123).
![Page 30: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/30.jpg)
The toxin-coreg ulated pili of Vibrio cholerae and the b und le-forming pili of
enteropathogenic Eschefichia coli are examples of the group B of type IV pilins
characterized by a longer leader sequence and less conserved cleavage site
(1 38).
The synthesis, assembly, function and regulation of pili involves more than 30
gene products [reviewed in (1,30,97)]. These genes are organized in a number
of foci of different sizes located throughout the genome. In P. aemginosa, there
are approximate[y 19 biosynthesis genes @iM, 8, C, D, E, F, M, N, 0, P, Q, V,
W, X, Y7, Y2, Z, fimTand fimU). two functional genes (pilland pi/@, eight
chernotaxis gene homologues @ilG, H, I, J, K, L, chpA and chpB) and fve
regulatory genes ON, pilS, piiRp fimS and aIgR). The exact role of many of
these proteins in the production and assembly of a functional pilus remains
unknown or unclear. The better studied and characterized products are PiIA, the
structural component, and PI'ID, the leader peptidase.
2,2.2 Funcfion
P I play many different roles in the biological processes of bacteria and host-
pathogen interactions. As mentioned in a previous section, one of the primary
functions of pili is adherence to epithelial cells. Other equally important roles
assigned to pili include interference with the immune system. DNA uptake
(natural competence) and movement through Mching motifity and social gliding.
![Page 31: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/31.jpg)
15
A new role for type N pili was recently described for pathogenic Neisseria.
Kallstrom et a1 showed that binding of Neisseria pili to its eukaryotic cell receptor
leads to release of Ca* from host intracelluiar stores (80). This increase in
cytosolic levels of Ca* is needed for tighter association of the bacterium to the
host cell and possibly internalization of the bacterium into the host cell.
In a site where antibody and complement levels are low such as the
bronchopulmonary tract, non-opsonic phagocytosis may be an important
mechanism of defense against pathogens like P. aenrginosa. However, non-
piliated or depiliated strains of P. aenrginosa are resistant to phagocytosis by
neutrophils and macrophages in a serum free environment (89, 132). Also,
piliated strains induce production of the neutrophil chemoattractant 11-8, which
contributes to the damaging lung inflammation seen in CF patients (37). In a
mouse model of pulmonary infection, piliated strains are more virulent and
invasive than non-piliated strains and are better capable of initiating a massive
inflammatory response (141).
HorizontaI exchange of chromosomal material is an important factor in the
evolution and epidernioiogy of Neisseria species. One consequence of genetic
exchange between bacterial cells is the antigenic variation observed for pilin and
Opa proteins. This phenomenon represents an important mechanism for
evading the immune system and modming the adherence properties of the
![Page 32: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/32.jpg)
bacteria. The natural ability of N. gononhoeae to transform DNA and its link to
type IV pili synthesis has been well studied. All of the gene products involved in
type IV pilus synthesis, including the pilin gene pilE, are required for DNA uptake
and translocation of DNA into the cytoplasm (57). A similar association between
natural competence and pilus synthesis was recently reported in L. pneumophila
(1 36). However, P. aemginosa is unable to naturally transform DNA regardless
Twitching motility allows bacteria like P. aemginosa and N. gononfioeae to move
on solid surfaces or on top of agar. Social gliding, best described in M. xanthus,
is a motion smoother than twitching motility and is directed along the axis of the
bacterium. These motility characteristics make it possible to determine if a strain
is piliated or not by observing colony morphology on soft agar plates. The
presence of a large growth diameter and swarming pattern on an agar plate is a
sign of the organism's motility.
In M. xanthus, two sets of genes control the gliding motion, the adventurous (A)
motiIi&y genes and the social (S) motility genes. Type lV pili are required for S-
motility but not for A-motility (165). As well, close cell proximity and high cell
density are important for S-motility. Defects at any stage of pilin synthesis and
pilus an assembly result in a non-motile phenotype (157). In addition, the PiK
protein. not required for pilus assembly, is essential for social motility (t66).
![Page 33: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/33.jpg)
97
In a fashion similar to social gliding in M. xanfhus, type IV pili are required for
twitching motility in P. aemginosa (1 8), but the presence of a structurally normal
pilus is not the only criteria for the bacterium to exhibit twitching motility.
Mutations in the p i r gene lead to the synthesis and assembly of a normal but
inactive, or non-retractile, pilus and the presence of a non-rnotiie phenotype.
Pilus extension and retraction is therefore proposed as the mechanism for
twitching motility. The PilT and PilB proteins contain nucleotide-binding domains
that could provide the energy necessary for retraction and extension of the pilus,
respectively [reviewed in (1 57)]. Also, p i ' mutants exhibit reduced virulence in
mouse models of acute pneumonia, suggesting a role for twitching motility in the
infection process (26). The pi= H, It J, K, L locus encodes homologues of the
chemotaxis (Che) proteins of enteric bacteria. Defects in one of these genes can
block the production of pili or modify the Witching motility patterns, suggesting
the presence of a signal transduction system similar to the chemotaxis system in
the regulation of twitching motility [reviewed in (30, 1 5771. Another regulatory
system composed of AlgR and FimS is involved in regulation of twitching motility
and pilus production, but not pilin transcription. AlgR is a response regulator
involved in alginate regulation, and FimS is one of the sensor kinases that
p hosphorylate AlgR (88).
![Page 34: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/34.jpg)
2.2.3 Regulation
In P. aemginosa, transcription of pilA, the structural component, is regulated by
two factors: RpoN, the alternative sigma factor a54 (75, 146); and a two-
component signal transduction system composed of PilS and PilR, a a540
dependent transcriptional activator (16,66,76). Absence of either RpoN or the
transcriptional regulatory factors PilS and PilR results in a strain unable to
express pilin (76).
The E d 4 complex formed by a54 and the RNA polymerase core enzyme
recognizes and binds to -24-12 bacterial promoters to initiate transcription.
E d 4 forms a closed promoter complex but is isomerization incompetent and
unable to form open transcriptional complexes wlhout a positive regulator.
Sigma-Mependent regulators possess a nucleotide-binding domain and
ATPase activity. ATP hydrolysis provides the necessary energy for isomerization
of the promoter complex (I 30).
Similar regulatory systems have been described for M. xanfhus (1 66). MoraxeIla
sp- (64) and N. gononfioeae (1 39,140) pilin transcription. Indeed, homologues
of PilS and PilR of P. aemginosa have been identifed as transcriptional
activators of the m e p e n d e n t promoter of the pifA homologue in M. xanfhus
($65,166)- In addition, PilS and PilR of P. aemginosa can replace the
transcriptional actbatom of Moraxella lacunafa to activate pi1 in transcription (64).
![Page 35: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/35.jpg)
19
Interestingly, some strains isolated from chronically infected CF patients are
nonmotile and resistant to phagocytosis by macrophages due to €he loss of
flagellum or piii (89). This change in phenotype suggests that pili are no longer
necessary or advantageous to the organism at this stage of infection since the
bacteria are well established on the mucosa. It is possible that other agents such
as the exopolysaccharide alginate take over the role of primary adhesin after
conversion to a muwid phenotype (120)-
2-3 Two-corn~onent sianal transduction svstems
2.3.1 Definition, structural characteristics and mechanism
In order to survive and proliferate, bacteria must constantly be aware of their
environment and adapt to various nutritional and environmental stresses such as
osmolarity, salinity, temperature, pH, availability of notrients and levels of
nitrogen or oxygen. One common response to these changes is chernotaxis
towards more favorable surroundings by modification of the organism's motility.
Another adaptive response is amation or repression of genes coding for
adaptive or virulence facton. Bacteria can sense external stresses by three
systems: the classical Alpdependent metabolite regulated kinaselp hosp hatase
system; the phosphoenolpyruvate:sugar phosphotransferase system; and the
sensor kinase-response regulator system [reviewed in (I 2411. Sensor kinase-
![Page 36: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/36.jpg)
20
response regulator systems are commonly referred to as two-component
systems or histidyl-aspartyl phosphorelay systems.
Sensor kinases generally are composed of two domains: a variable N-terminal
region that serves as the input or sensing domain; and a highly conserved C-
terminal catalyti-c region known as the transmitter domain. The input domain of
many histidine kinases is characterized by hydrophobic segments that span the
inner membrane. This would suggest that these sensors are membrane
receptors that perceive external or transmembrane signals. In many cases, two
TM segments are connected by a Iarge periplasmic loop through which the
external stimulus is sensed. In other cases, however, four, six and even eight
TM segments joined by cytoplasmic and periplasmic loops of varying length can
be found. The input domain is quite variable and its sequence and structure are
likely related to its specific sensory function. On the other hand, the transmitter
domain features four extremely conserved motifs (the N, GI, G2 and F boxes) in
addition to the H block, which carries the histidine residue that is the site of
phosphorylation. Blocks GI (DXGXG) and G2 (GXGXG) are glycine-rich
segments resembling those found in nucleotidebinding proteins and other
kinases. The F box is commonly found between the two G boxes, and the N box
is found upstream ofthe first G box.
![Page 37: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/37.jpg)
21
Like the sensor kinase, the response regulator component of a two-component
system can be divided in Wo functional domains. First, the N-terminal receiver
domain is the most conserved region of the protein. It is characterized by an
aspartate residue that is phosphorylated, two other aspartate residues located N-
terminal of the site of phosphorylation, a threonine and a lysine. All of these
conserved amino acids are located within an acidic pocket that is essential for
phosphorylatian. second; the C-terminal effector or output domain contains the
DNA-binding or regulatory domains of the regulator. Similarities within this
region are also the criteria for assigning a response regulator to a particular
subfamily. For example, members of the NtrC subfamily of response regulators
possess a central ATPase domain. For reviews on the structural and functional
features of histidine sensor kinases and response regulators see references (42,
108, 134,135).
Detection of a specific environmental stimulus by the input domain of the sensor
leads to the dirnerization and autophosphorylation of the transmitter domain. The
catalytic domain of one monomer mediates transfer of the gamma-phosphate
group from ATP to the conserved histidine residue of the other monomer. The
phosphate group is then transferred from the phosphohistidine to the conserved
aspartate residue on the regulator. The phosphotmnsfer event causes a
conformational modification of €he response regulator that allows the effector
domain to exert the appropriate response. The dephosphoryiated receiver
![Page 38: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/38.jpg)
domain exists in such a conformation that it prevents interaction of the effector
with its target, but this inhibition is relieved by the phosphorylation-induced
conformational change. Phosphotransfer between low-molecular-weight
phosphodonors, such as acetyl phosphate, carbamyl phosphate or
phosphoramidate, and the aspartate residue of the receiver can occur with low-
affinity in the absence of a phosphohistidine. This suggests that response
regulators are themselves enzymes capable of catalyzing the phosphotransfer
reaction. The regulator continues to deliver the output signal until
dephosphorylation of the receiver module. In some systems, auxiliary proteins
are required for phosphatase activity, while in other systems the kinase
component is capable of exerting this phosphatase activity [reviewed in (42,
1 35)J.
2.3.2 Use of two-component systems in bacterial v i~ lence and survival
Two-component systems have been identified in several microorganisms where
they regulate many virulence factors and survival mechanisms. As mentioned
previously, signals detected by bacterial sensor proteins may include changes in
osmolarity, salinity, temperature, pH, availability of nutrients and levels of
nitfogen or oxygen [reviewed in (41,134)).
2.3.2.1 Envt-OmpR and osmoregulation
E. cuii responds to variations in medium osmohrity by modifying the porin
content of its outer membrane. In a low-osmolam environment, the porin OmpF
![Page 39: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/39.jpg)
23
predominates in the outer membrane, while in a highosmolarity milieu, the
smaller-sized pon'n OmpC dominates. Regulation of ompF and ompC gene
expression is mediated by the two-component system composed of the histidine
kinase EnvZ and the response regulator OmpR (42,100). EnvZ is an inner
membrane protein that senses external osmotic changes. In response to those
changes, EnvZ autophosphorylates and is then capable of phosphorylating
OmpR. In addition to its autokinase and OmpR kinase activities, EnvZ acts an
OmpR phosphatase (42). The levels of phosphorylated OmpR (OmpR-P)
determine which gene will be activated. When OmpR-P levels are [ow,
transcription of ompF is activated by binding of OmpR-P to high affinity sites in
the ompF promoter. However when OmpR-P levels are high, ompF transcription
is repressed and ompC transcription is activated (42).
EnvZ possesses two TM helices that anchor the protein into the inner membrane,
a large periplasmic domain that perceives the activating signal, a cytoplasmic
linker region and a cytoplasmic transmitter domain that contains the
phosphorylation site (His-243) (42). Depending on the osmolarity conditions,
EnvZ is present either in the phosphatase-dominant or kinasedominant
conformational states (1 14). Under low-osmolari€y conditions, the phosphatase
activity prevails leading to dephosphorylation of OrnpR-P and subsequent
activation of ompFgene transcription. In contrast, in a high osmotic
environment. EnvZ exists in the kinasedominant state and increases the
![Page 40: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/40.jpg)
24
phosphoryfation rate of OmpR thereby causing ompF repression and ompC
activation.
The osmolarity stimulus induces a conformational change of the periplasmic and
TM domains that is transduced through the TM helices to the cytoplasmic
domain, which in turn adopts one of two functional conformations (143). In one
form, His-243 is accessible to ATP bound to the nucfeotide-binding regions of the
kinase domain for autophosphorylation; phosphorylated EnvZ therefore acts as
an OmpR kinase. In the other conformation, EnvZ autokinase activity is reduced
because His-243 is inaccessible to ATP. Non-phosphorylated EnvZ then acts as
an OmpR-P p hosphatase (71). The ratio of these two enzymatic activities
determines the amount of OmpR-P present in €he cell and consequently which
porin gene will be transcriptionally activated or repressed.
Mutations in the conserved motifs of the cata(ytic domain (H. N, F, GI and G2
boxes) alter either or both kinase and phosphatase activities (71). The active
sites for both functions are proposed to overlap and be centered on the H box.
Although His-243 is essential for kinase function, it is important but not essential
for phosphatase activity (71,72). Mutations and deletions within the linker region
do not affect dimer formation or EnvZ function if the cytoplasmic domain is
detached from the membrane, but has negative effects on activity when
connectad to the transmembrane portion of EnvL The linker region is therefore
![Page 41: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/41.jpg)
25
proposed to help bring two EnvZ monomers together and to communicate the
signal from the sensing domain to the kinase domain (107).
The external stimulus sensed by the periplasmic loop of EnvZ has not been
precisely identified. Recently, a 13 amino acid segment conserved among EnvZ
homologues of other enteric bacteria has been identified and named the identity
or 1 box (158). This I box is located at the junction of the first TM and the
periplasmic region and was proposed to be directly involved in signal sensing
and regulation of the kinase-phosphatase ratio (1 58).
Dimerization is a common event for sensor kinases and EnvZ is no exception.
EnvZ dimerization occurs in both the periplasmic and cytoplasmic portions of the
protein and is thought to be ligand-independent (65). The same region
encompassing the I box is proposed to form a leucine zipper-like structure
involved in dimetiration of the periplasmic domain and signal transduction (167).
The intramolecular and intermolecular interactions between the two TMs is
essential for signal transduction since the effects of mutations in one TM can be
suppressed by mutations in the other (144). In support of the EnvZ dimer model,
Yang and lnouye (171) have shown that co-expression of EnvZ lacking the
catalytic domain but possessing the phosphorylation site (His-243) and EnvZ with
His-243 substituted for a valine but containing the kinase domain is capable of
activating ompC transcription. Separately, each of these modified proteins lacks
![Page 42: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/42.jpg)
26
kinase and phosphatase ac3vity. However, when co-expressed, the autokinase
and OmpR kinase activities are restored suggesting that one EnvZ monomer
transphosphorylates the other monomer.
2.3.2.2 The chemotuh system
Motile bacteria alter their swimming pattern in search of a more favorable
environment in E. coli and Salmonella typhimurium, four inner membrane
sensory receptors (Tsr, Tar, Trg and Tap) bind or interact with a specific
attractant (sen'ne, alanine, glycine, aspartate, glutamate, maltose, ribose,
galactose, various dipeptides) or repellent (acetate, indole, leucine, cobalt,
nickel). These receptors are meth y I-acce pting chemotaxis proteins (MCPs)
localized to the poles of the bacterial cell. Six soluble proteins (CheA, CheB,
CheR, CheW, CheY and CheZ) are involved in transducing the signal from the
receptors to the flagellar motor to cause a change in swimming direction
(tumble). CheA is a histidine sensor kinase that undergoes trans-
autophosphorylation when a repellent is perceived by the MCPs. CheA then
phosphorylates CheB, a methylesterase, or CheY, which then interacts with the
components of the flagellar switch (FIiG, FliM and FBN) to induce tumbling
motion. Binding of an attractant inhibits CheA phosphorylation leading to low
levels o f phospftoryfated CheY and a smooth swimming motion towards the
attractant. CheW monomers serve as bridges between MCP dimers and CheA
dimers and are necessary for CheA autophosphorylation. CheZ acts as a
phosphatase and reduces the levels of phosphorylated CheY in order to restore
![Page 43: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/43.jpg)
27
a smooth swimming motion. CheR, a methyltransferase, and phosphorylated
CheB control receptor sensitivity by monitoring the levels of receptor methylation
[reviewed in (2, 1 I, 1 34) 1.
2.3.2.3 NtrB-NtrC and nitrogen regulation
Enteric bacteria like E. coli and S. typhimunum respond to conditions of nitrogen
starvation or excess by increasing or decreasing, respectively, the amount of
glutamine synthetase (product of glnA) in the cell. A two-component regulatory
system composed of the soluble histidine kinase NtrB (or NRII) and the response
regulator NtrC (or NRI) regulates transcriptional expression of glnA. The PII
protein (product of glnB) is also involved in transcriptional control of glnA by
exerting a regulatory function on NlrC-P dephosphorylation. Under nitrogen
limited conditions, NtrB autophosphorylates at His4 39 and transfers that
phosphate group to the Asp-54 of NtrC, which, once activated, binds sequences
upstream of the glnA promoter to activate gene transcription. NtrB, in
conjunction with unmodified or deuridylylated PI[, acts as phosphatase and
facilitates dephosphorylation of NtrC-P under nitrogen excess conditions (1 34).
NtrB shares many features with EnvZ. Like EnvZ, NtrB forms a dimer and one
monomer is phosphorylated in trans by the other monomer (1 03). Also, the
phosphorylatian site (His-139) is not required for phosphatase adivity (el), but
the H box is important for both kinase and phosphatase activities (81.82).
Conformational changes in the transmitter region in response to a stimulus allow
![Page 44: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/44.jpg)
or prevent the interaction of the H box with the N and G domains, therefore
determining which enzymatic activity will predominate (82).
NtrC is a dimeric cytoplasmic protein composed of three domains. First, the N-
terminal receiver domain contains Asp-54, the residue that receives the
phosphate from NtrB, and the other conserved residues of response regulators.
Second, the central output domain possesses nucleotide-binding motifs. This
region exhibits ATPase activity and is likely to be the region that interacts with
the 054 holoenzyme. Third, the C-terminal helix-turnhelix DNA binding domain
binds to enhancer sequences of the glnA promoter (129).
The glnA promoter possesses -241-12 sequences characteristic of a54-
dependent promoters. NtrC dimers bind cooperatively to an enhancer sequence
containing Wo binding sites (upstream activation sequences. UAS) found
upstream of the glnA promoter and interact to form an otigorner (I 13).
Cooperative binding to UAS is the result of proteingrotein interaction between
NtrC dimers, is increased by phosphorylation of NtrC and is not mediated by the
Gterrninal DNA-binding domain (1 13, 160). Tetramerization, cooperative binding
to UAS and phosphorylation of NtrC are required for ATP hydrolysis (7, 113,
159). ATPase activity of each NtrC dimer in the oligomer is essential for
activation of transcription (1 59). The energy provided by ATP hydrolysis
![Page 45: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/45.jpg)
29
catalyzes a conformational change in Ea54 and formation of an open promoter
complex leading to initiation of gene transcription.
2.3.3 The PilS-PilR system of P.' aemginosa
2.3.3.1 PiIR, the response regulator
As mentioned previously, pilin expression in P. aemginosa is regulated by RpoN,
the alternative sigma factor, and the Wo-cornponent system PilS and PilR. PilR
is a transcriptional activator required for initiation of transcription from the a54
dependent pilA promoter. PilR is a 50 kDa cytoplasmic protein that shares great
homology (62% similarity across the entire molecule and 71 % over the central
region) with the NtrC family of response regulators (76). It contains the
conserved aspartate and lysine residues (Asp-1 1, Asp-54 and Lys-104) as well
as the central ATPase domain characteristic of this family. The C-terminal helix-
turn-helix DNA-binding domain, however, shows less similarity to NtrC and is
iikeIy specific for the piIA promoter. Deletion of pilR has no effect on ff agellin
expression (which also requires RpoN) or on the ability of the bacteria to grow in
the absence of glutamine, but results in a strain unable to synthesize pilin (76).
DNA footprinting analyses have shown that PilR binds to four UAS located
between position -74 to -122 relative to the piM transcriptional start All four of
these consensus sequences are necessary for transcription since pilin gene
expression is abolished when any of the PilR-binding sites are mutated or
![Page 46: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/46.jpg)
30
deleted (79). An earlier study had already shown that deletion of a 48 bp
fragment upstream of the pilA promoter greatly reduced pilin expression (109).
PilR purified from E. coli in the absence of PilS retains its specific DNA-binding
abilities (79). This suggests that phosphorylation does not directly confer DNA
binding capabilities to the response regulator, but might improve affinlty of the
regulator for DNA and be necessary for the next steps of transcriptional
activation. Also, overexpression of pilR in the absence of PilS leads to pilin
transcription suggesting that PilR can be phosphorylated by low-molecular weight
phosphodonors or by cross-talk with another kinase, or that high levels of
unphosphocylated PilR can stimulate transcription (17).
2.3.3.2 Function of PiIS, the sensor kinase
Many lines of evidence suggest that like many other sensor kinases, PilS exhibits
two contrasting functions (17). First, it is an autokinase and PilR kinase and
second, it is a PiIR-P phosphatase. In the presence of the activating signal, the
kinase-dominant state prevails and PilS autophosphorylates and transfers the
phosphate to PiIR. PiIR-P then binds to the UAS and interacts with RpoN and
RNA polymerase which leads to activation of pilA transcription and synthesis of
pilin (Figure i ). However, when the signal is absent, the phosphatase activity of
PilS dominates and the rate of PIRmP dephosphorylation is increased so that
piiin transcription is stopped, The signal(@ to which PilS responds remains
unknown, but is likely to be present in small amounts because overexpression of
PilS results in phosphatasedominant state and inhibition of pilin expression.
![Page 47: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/47.jpg)
Also, high concentrations of PilS in the cell inhibit pilA transcription in a dose-
dependent manner (17).
2.3.3.3 Stnrctural features of PilS
PiIS is an inner membrane protein localized to the poles of the bacterial cell (15).
Structurally, the 59 kDa protein consists of three regions: an N-terminal
hydrophobic domain, a central linker domain and a C-terminal kinase domain
(Figure 2) (17). The hydrophobic domain is required to anchor the protein to the
inner membrane, but is not sufficient to target PilS to the poles, the entire linker
region must be present for polar localization of PilS (15).
Based on computer analysis measuring hydrophobicity (25), the N-terminal176
amino acids of PilS are predicted to form six TM helices spanning the inner
membrane connected by short hydrophilic periplasmic and cytoplasmic loops.
The other two regions (linker and transmitter) are predicted to reside in the
cytoplasm. A similar topological arrangement is also considered for other
kinases, such as DivJ of Caulobacfer crescentus (l05), LytS (20) and AgrC (86)
of Sfaphyfococcus aureus and PrtB of Rhodobacter sphaeroides (1 06).
TypicalIy, the signal to which sensor kinases respond is perceived via the N-
terminal portion of the protein. In the case of PiIS, the stimulus could be detected
either by the fM domain or the linker region or both, which does not exclude the
possibilRy of two activating signals. Since most of the TM domain is predicted to
![Page 48: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/48.jpg)
be localized within the inner membrane, it is quite possible that the activating
signal is also located within the membrane.
The function of the linker region (residues 177 to 296) in this signal transduction
system has yet to be clearly determined. However, this region shows weak
sequence homology to PAS domains. In prokaryotes, PAS domains are mostly
found in histidine kinases where they monitor variations in light, redox potential,
oxygen and energy levels in the cell. These domains are cytoplasmic and
usually found adjacent to the TM regions of membrane-associated sensor
kinases. Cofactors such as heme and Ravin adenine dinucleotide (FAD) can
attach to PAS domains. PAS domains are involved in regulation of bacterial
behavior (aerotaxis) and cellular metabolism and development (742). The C-
terminal catawc domain of PilS (residues 297 to 530) contains the
phosphorylation site, His-319, and other conserved motifs of sensor proteins and
is required for kinase activity (I 7).
2.4 Structure of inner membrane proteins -
2.4.1 Topology: definition and classification
The topology of a protein can be defined as the arrangement of the polypeptide
chain relative to the membrane, more specifically the location and orientation of
hydrophobic membranespanning segments. Hydrophobic segments within a
![Page 49: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/49.jpg)
33
membrane protein either function as export signals (signal peptides) that target
the protein to the membrane and promote insertion or translocation of the
polypeptide, or as stop-transfer sequences that terminate translocation of the
protein. Start-sto ptransfer sequences are hydrophobic segments that initiate as
well as block insertion of the protein. These three different types of hydrophobic
domains are similar in composition, but differ in the upstream and downstream
hydrophilic flanking regions (1 56).
The orientation of a hydrophobic segment is determined by the distribution of
positive charges around it and the orientation of the preceding segment When
positively charged residues (arginine, lysine) precede a hydrophobic domain, this
domain will act as an export signal; alternatively a hydrophobic segment followed
by basic residues will act as a stop-transfer sequence (3, 169, 170). Interactions
between hydrophilic regions or between hydrophobic TM segments, as well as
the speed and stability of protein folding may also play a role in the way a protein
inserts into the membrane (147).
lnner membrane proteins are divided into four classes according to their
orientation and the type of sequence that drives the protein to the membrane
(19,133, 156) (Figure 3). Every membrane protein possesses an N-terminal
signaf peptide that targets the protein to the membrane. The signaI peptide
remains embedded in the membrane whether or not it is cleaved by a leader
![Page 50: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/50.jpg)
34
peptidase. Class I proteins possess a signal peptide and a stop-transfer
sequence. The signal peptide is cleaved to generate a mature protein with its N-
terminus located in the periplasm and the stop-transfer sequence alone anchors
the protein into the membrane. Class If proteins contain only an uncleaved
signal peptide, while class Ill proteins possess an N-terminal start-stoptransfer
sequence that targets and anchors the protein to the membrane. The difference
between these two classes is the location of the N- and C-termini. Polytopic
proteins (class IV) have multiple TM segments and represent a succession of
export signals and stop-transfer sequences. The location of the N-terminus is
dictated by the first export signal, if the signal peptide is cleaved off, the N-
terminus will be periplasrnic otherwise it will remain in the cytoplasm. The N- and
C-termini of polytopic proteins can be located on the same side of the
membrane, either the cytoplasm or penplasm, or on opposite sides (133,156).
2.4.2 Structural and functional implications of sequence modifications
The native topology of a membrane protein is fairly resilient, only substantial
sequence modifications wilI alter the topology of some proteins. In many
instances a single amino acid change or deletionhnsertion of a membrane-
spanning segment will result in a relativejy " n ~ n a [ ~ insertion (9,22,43,58,94).
However, mutations that introduce positiveIy &arged residues can block
translocation or insertion of the polypeptide into the membrane or cause an
inversion in the topologicat model of the protein (3.133. 169,170). The topoiogy
![Page 51: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/51.jpg)
35
of a protein can also be affected by defects in the secretion mechanism, such as
mutations in the protein SecY (I 7 5). One possible explanation for this tolerance
is that export signals are present throughout the protein and that each of these
signals can independently promote insertion of a segment of the protein into the
membrane (22,43). lnw rred membrane insertion or folding of a protein can
result in disruption of the protein's fundion. leading to possible defects in
secretion and uptake mechanisms as well as other essential systems (9,94).
2.4.3 Mechanisms of protein insertion
2.4.3.1 Secdependent pathway
The Secdependent translocation pathway is the first step of the general
secretory pathway. The Sec system is also used for membrane insertion of inner
membrane proteins. This system is composed of seven proteins: SecA, B. D, E,
F, G and Y (Figure 4) (36,127,161), SecA is a peripheral membrane/
cytoplasmic protein essential for cell viabili. SecA possesses two nucleotide
binding sites, it is the only Sec protein that exhibits ATPase activity (36, 145).
SecB is a cytoplasmic chaperone that escorts the newly synthesized peptide
from the cytoplasm to the membrane where it meets SecA and the translocase
complex. SecB prevents premature folding and aggregation of the preprotein
and promotes interaction with SecA (127,161). SecE, G and Y are integral
membrane proteins that form a complex called the translocon or translocase
complex. These three proteins are proposed to form a channel through which
![Page 52: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/52.jpg)
the preprotein traverses the bilayer (36). Finally. SecD and SecF are also
membrane proteins, but their role in the translocation process is not well
understood. It is thought that these proteins are involved in the late stages of this
process, probably in the release and proper folding of the protein in the
periplasm, or in regulation (36).
The first step of the See pathway is recognition and binding of SecB, the
chaperone, to the newly formed peptide as it emerges from the ribosome or later
in the translation process. This SecB-precursor complex then interacts with
SecA. The threecomponent complex then moves to the membrane and SecB is
released and recycled. SecA interacts with the anionic phospholipids of the
membrane and the SecYEG translocon. Binding of ATP to S e w s high-affinity
nucleotide-binding site and interaction with SecY stimulate the insertion of the
SecA-preprotein complex into the membrane (96). Interaction of SecA with the
translocon stimulates ATP hydrolysis, which. causes the release of the prep rotein
into the translocation channel (145,151). SecA is withdrawn from the membrane
after a second A T binding and hydrolysis reaction at its low-affinity nucleotide-
binding site (151). At this stage, the leader peptidase will cleave off the signal
peptide (if necessary).
In the case of a periplasmic, outer membrane or extracellular protein being fully
transiocated across the membrane, the proton motive force wmIl drive the
![Page 53: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/53.jpg)
37
translocation of the protein to completion (145, q51). In the absence of a proton
motive force, repeated cycles of SecA insertion, ATP binding and hydrolysis and
SecA withdrawal will complete the movement of the protein across the
membrane (I 45, 15 1 ). Alternatively, the proton motive force-mediated
translocation of a membrane protein will continue until a stop-tansfer sequence
is encountered and the precursor is released from the translocon and integrated
into the membrane (40). SecA will then interact with the next hydrophobic
segment (a start-stop-transfer sequence) and insert it into the translocon through
another cycle of ATP hydrolysis. These cycles will be repeated until the protein
is completely insetted into the membrane.
2.4.3.2 Signal recognition particle pathway
The signal recognition particle (SRP) pathway provides targeting assistance to
secreted or integral membrane proteins, much like the chaperone SecB. The
bacterial SRP is a ribonucleoprotein composed of a 4.5s RNA and a 48 kDa
GTPase named Ffh or P48, and is very homologous to the eukaryotic 7s RNA
and 54 kDa GTPase (34). SRPdependent protein insertion also requires the
translocase complex, suggesting that the SRP and Seedependent pathways
converge at the inner membrane (33,149). The requirement of SRP rather than
SecB for targeting is primarily determined by the hydrophobicity of the signar
sequences, therefore it is speculated that SRP is the targeting system of choice
for polytopic inner membrane proteins (34,148). Secreted proteins may use
SRP if the Sec machinery is deficient Hydrophobicity, muftiple TMs and large
![Page 54: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/54.jpg)
hydrophilic periplasmic domains all contribufe to determining the SRP-
dependence of a protein (I 02).
In contrast to SecB, which recognizes the nascent chain at a post-translational or
late co-translational stage, SRP binds to the signal peptide as soon as it emerges
from the ribosome, causing a pause in the translation process (Figure 5). The
complex formed by the ribosome-bound nascent chain and SRP is then picked
up by the SRP receptor FtsY. FtsY and SRP are released from the nascent
chain after the complex interacts with the membrane at an unknown site, most
likely near the translocon. This event is preceded or accompanied by GTP
binding to both SRP and FtsY. The peptide chain is now free to insert into the
SecYEG translocon for translocation into the periplasm or insertion into the
membrane. Following GTP hydrolysis, FtsY and SRP dissociate from each other
and are recycled (48, 149).
2.4.3.3 Sec-independent pathway
The Mi3 procoat protein is the prototype of the Seoindependent membrane
insertion pathway. It possesses a typical signal peptide but does not require the
Sec apparatus to be correctly inserted into the membrane (162). In Sec-
independent insertion, it appears that a protein spontaneously inserts into the
membrane without the help of the translocase complex, but does require the
membrane electrochemical potentiat (4.29) (Figure 6). The number of k g and
Lys in a hydrophilic domain as well as the length of the segment to be
![Page 55: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/55.jpg)
39
translocated determine if the Sec proteins are needed for protein insertion (155).
Hydrophobic segments pair up and form a helical hairpin that would insert into
the lipid bilayer. If a segment is sufficiently hydrophobic, it will remain in the
membrane and translocation will be stopped, however if a helix is polar,
translocation will continue until a stop-transfer sequence is encountered. Multiple
hairpins can insert into the membrane to generate polytopic proteins (44).
2.5 To~oloeical studv of inner membrane ~roteins
2.5.1 Statistical prediction of a protein's topology
2.5.1.1 Amino acid distribution and the positive-inside rule
The distribution of the positively charged amino acids in the loops connecting the
TM a-helices is considered the major determinant of a protein's topology. This
rule, first described by von Heijne (153) as the positiveinside rule, states that
cytoplasmic loops contain a higher number of the positively charged amino acids
arginine and lysine. In addition, the occurrence of the negatively charged
residues (aspartate and glutamate) is not increased in the periplasmic loops and
should not be considered when defining the topology of a membrane protein.
Although histidine carries a weak positive net charge at a neutral pH, it is not
considered a major topological determinant However, under slightly more acidic
cytoplasmic conditions, the effec2 of its positive charge is accentuated and His
becomes a topological facbr (3). Other studies all agree that the number of Arg
![Page 56: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/56.jpg)
and Lys in the cytoplasmic segments is the most important factor in
determination of the topology. while His, Asp and Glu only have a very weak
effect on topology (3. 1 54. 1 56).
The positive-inside rule holds true for connecting segments shorter than 70 to 80
residues (1 56). The Arg and Lys distribution bias is observed for every
connecting loop of a polytopic protein (1 54). All cytoplasmic segments possess a
larger number of Arg and Lys than periplasmic domains independently of their
position in the protein sequence.
Other amino acids in addition to Arg and Lys appear to be asymmetrically
distributed across the membrane. Proline residues are more prevalent in the
periplasrnic loops compared to the cytoplasmic segments (1 53). As expected,
the hydrophobic residues phenylalanine, isoleucine, valine, methionine and more
importantly leucine are enriched in the membrane-spanning segments as
opposed to the connecting [oops (153). The aromatic residues tryptophan,
tyrosine and phenylalanine are more prevalent at the ends of the TM helices at
the junction of the membrane and the intra- or extracellular environments (321).
As weli, glycine residues are commonly found at the Gterminal end of a helix,
white prolines tend to occur immediately upstream of the N-terminal end of a
helk (121).
![Page 57: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/57.jpg)
41
The concentration of anionic phospholipids in the membrane was shown to be a
determining factor of membrane topology by blocking translocation of positively
charged residues (152). This effect is independent of the mode of protein
insertion.
2.5.1.2 Hydrophobicity plots and secondary structure prediction
Many hydrophobicity scales and algorithms have been developed over the last
30 years to help in the prediction of a membrane protein's topological
arrangement (28). Two of the better known and most widely used scales were
developed by Kyte and Doolittle (83), and Engelman, Steitz and Goldman (GES)
(45). In general. each amino acid is given a hydrophobicity value based on its
structure, solubility, interadion with the lipid bilayer, ability to form a a-helix and
other chemical and physical characteristics. Although these algorithms are
similar, the parameters used in the calculations vary from one index to another,
hence their accuracy is the subject of much discussion (35,45,47,77, 112).
A hydrophobicity plot can be obtained by measuring the average hydrophobicity
and net charge of a moving window of amino acids along the sequence. A peak
of hydrophobicity suggests that a region may form an alpha helix and be inserted
into the membrane. Some DNAlprotein analysis computer programs like
DNASIS(B (v2.0, Hitachi Sofhnrare Engineering Co. Ltd.) and Gene Inspectorm
Vextco Inc.) can generate a hydrophobicity p[ot using different scales and
window size. Other sofhvare, like TopPredlI (25) and TMPred (69), go further in
![Page 58: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/58.jpg)
42
their topoIogical predictions and consider the probability of helix formation as well
as the hydrophobicity of a series o f residues. These programs also suggest the
most likely orientation of the predicted helices and provide a possible topological
mode[ of the protein based on the sequence submitted. Secondary structure
programs are also available on the internet. The results obtained from these
p rograrns represent only a prediction of the protein structure, therefore
experimental testing must confirm the topology.
2.5.2 ExperimentP1 determination of a topology
2.5.2.1 Genes fusions
Statistical topological prediction methods are fairly accurate, but they only
represent a theoretical model and should be confirmed experimentally. The best
described and most widely used experimental system for confirming the topology
of an inner membrane protein is the gene fusion method (14.68, 92,93, 147).
This method takes advantage of the fact that certain enzymes require a specific
environment to fold property and be active. Alkaline phosphatase (PhoA) and
lactamase are only active when translocated into the periplasm, whereas P
galactosidase (La@ is only active in the cytoplasm. These three proteins are
commonly used as reporter enzymes for this system.
A promoterless gene coding for a reporter enzyme lacking its start codon and
export signal is introduced at various random or planned Locations within the
![Page 59: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/59.jpg)
43
gene of interest, thus creating a hybrid protein where the C-terminus of the
protein of study is replaced by a reporter. ~evels of enzymatic activity of the
fusion protein indicate the cellular location of the fusion site. A PhoA hybrid
protein will show high PhoA enzymatic activity if the fusion site is periplasmic,
while low PhoA activity will suggest a cytoplasmic fusion site. Alternatively, high
Lac2 activity generated by a Lac2 hybrid protein is an indication of a cytoplasmic
fusion site, while low activity signifies that the fusion site is periplasmic (Figure 7).
This method has been used by many researchers to determine the topology of a
variety of inner membrane proteins such as MalF (? Z), MalG (1 3), KdpD (172)
and Lacy (21) of E. coli, DotA of L. pneumophila (122), XcpP, Y and Z (10) and
PilD (137) of P. aeruginosa.
2.5.2.2 Other approaches
Other biochemical and immunological methods are also used to determine a
protein's membrane topology. These include vectorial labeling, hydrophobic
labeling, in situ proteolysis and imrnunoblotting (78, 147). Briefly, radioactive or
ff uorescent hydrophilic reagents and spin-labefed small moIecules can be used
as labeling agents to identify sequences found outside the permeability barrier of
sealed membrane preparations. Similarly, membrane-spanning segments can
be identified using hydrophobic labels, Segments of a protein may be
susceptible to proteoIytic cleavage depending on their cellular location. Mutant
proteins with inverted or modified topologies react to proteases, detergents or
![Page 60: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/60.jpg)
44
other chemicals differently than the wildtype protein. This approach is well
described for the E. coli leader peptidase (Lep), this protein is widely used to
study insertion mechanisms and topological determinants. Finally, binding of
antibodies raised to specific epitopes on the protein can be tracked to the
cytoplasmic or extracellular side of a sealed membrane preparation.
Other methods that take advantage of the biochemical and functional properties
of the protein of interest have also been described (147). Topological changes
may be monitored by inhibition or modification of phosphorylation or N-linked
glycwylation of the mutant protein compared to the wildtype protein. A protein's
nonal function may also be modified by topological changes.
![Page 61: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/61.jpg)
Chanter 3. MATERIALS & METHODS
3.1 Media and su~~lements
Bacteria were grown in Luria (LB) broth or agar (10 gR NaCI, 10 g1L tryptone, 5
g/L yeast extract) and Lennox LB (5 gR NaCI). Ampicillin (Amp) and tetracycline
(Tet) were used at a concentration of 100 pg/ml and 20 pg/mI, respectively, for E.
COIL Carbenicillin (Carb, 150 pglml), streptomycin (Str, 200 pg/ml) and Tet (80
Clglml) were used for P. aervginosa. 5-bromo-4-chloro-3-indolylphosphate (XP,
40 pglml), 5-bromo-4-chloro-3-indoIyl galactopyranoside (Xgal, 40 pgfml) and
isopropyl-$-D-thiogalactoside (IPTG) were also added when required.
3.2 DNA mani~ulations
Standard recombinant DNA techniques were used (8,90). Plasmid DNA was
isolated from bacterial cells by the alkaline lysis method using the QlAprep Spin
Miniprep Kit (QIAGEN, Hilden, Germany). DNA was purified from agarose gels
using the QlAquick Gel Exhadion Kit (QIAGEN, Hilden. Germany). Enzymes
were purchased from Gteco BRL (Gaithenburg, MD), unless otherwise stated.
![Page 62: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/62.jpg)
3.2.q DNA linker insertion
Single-stranded selfcomplementary DNA linker oligonucleotides were
synthesized by the University of Calgary DNA Services. The linker preparation
was diluted to I pg/pI in sterile dH20 and annealed by incubating at 72% for 5
minutes, cooled to 65OC and incubated 5 minutes at 65OC. The solution was then
slowly cooled to room temperature. Two microliters of the solution (2 pg linker
DNA) were used in a ligation reaction containing 0.1 pg vector DNA. The vector
DNA was digested with EcoRI, for insertion of the KpnRBS linker, or Bglll, for
insertion of the EwRIATG linker, and purified from an agarose gel.
33.2 Alkaline phosphatase treatment
When necessary, restriction digested DNA was treated with calf intestinal
alkaline phosphatase (CIAP) to prevent vector religation. The digestion mixture
containing 1-2 pg of cut DNA was dialyzed against d H P on a 0.025 prn pore
size filter (Millipore, Bedford, CA) for 10 minutes to remove excess salts. The
desalted DNA solution was recovered, ClAP buffer was added (for a I X
concentration) and ClAP was added at 'IUlpg DNA. This solution was incubated
30 minutes at 37OC and purified using the QlAquick PCR Purification Kit
(QIAGEN, Hilden, Germany).
![Page 63: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/63.jpg)
3.2.3 DNA transfornation in P. aeruginosa
DNA was introduced into P. aenrginosa by chemical transformation according to
the method of lrani and Rowe (73). Electroporation was also used. The recipient
strain was grown overnight on LB agar. The bacterial lawn was collected and
resuspended in 1 ml of sterile 2% sucrose with 20 mM MgC12. The cells were
washed once in the same sucrose-MgC12 solution and resuspended in 400 pl of
sterile 2% sucrose. One hundred microiiters of cells were placed in a chilled
electroporation cuveffe, 50 ng of DNA was added and the mixture was pulsed.
The electroporation settings used were: 400 ohms resistance, 25 pFD
capacitance and 2.1 volts. The electroporated mixture was allowed to recover for
I hour in I ml LB broth at 37OC before plating on LB agar supplemented with the
appropriate antibiotic.
Mutations were introduced by a polymerase chain reaction (PCR)-based method
or using the QuikChangem Site-Directed ~ k e n e s i s Kit from Stratagene (La
Jolla, CA). The oligonucleotide primers and linkers used to introduce the
mufations are described in Table 1. The rationale for the construction of the
fusion plasmids is shown in Figure 8. Table 2 provides a summary of the pilS
mutants and other strains and plasmids used in this study.
![Page 64: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/64.jpg)
3.3.1 PCR mufagenesis
Plasmid pJB315, which carries the pilS gene in a pBluescript vector, was used as
the DNA template for PCR mutagenesis. This method was used to introduce
BamHl restriction sites at five different locations within the pilS gene. PCR
amplification was performed using primer 27, which binds to the vector
backbone, and either one of the mutagenesis primers 3,4,9,10 or 14. The
following amplification conditions were used: 30 cycles of 1 minute denaturation
at 95*C, 1 minute annealing at 55OC and 1.5 minutes extension at 72OC in the
presence of pfu turbo DNA polymerase (Stratagene, La Jolla, Ca). Magnesium
(2 mM) was present in the reaction buffer provided with the enzyme.
The amplification product was purified from an agarose gel and digested wiih
EcoRl and BamHI. The digested piiS fragment, which represents a truncation of
the gene, was purified from an agarose gel and ligated into the cloning vector
pUCP22, thus generating plasmids pJE616, pJE619, pJE625, pJE630 and
pJE637. The KpnRBS linker was introduced at the EcoRl site of these five
constructs to generate plasmids pJE616K, pJE621, pJE625K, pJE630K and
pJE637K, respectively. The KpnRBS linker introduces a Kpnl restridion site
upstream of pjIS and cancels the EcoRI site in which it was inserted. The EcoRl
site was removed because it is also found in the iacZ and phoA genes of the
reporter vectors and could not be used for doning. This linker also introduced a
![Page 65: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/65.jpg)
new ribosome-binding site (RBS) closer to the piiS initiation codon to improve
protein expression.
3.3.2 QuikChangen mutagenesis
The Kpnl-BamHI fragment carrying the complete pilS gene corresponding to
amino acids (a. a.) 1 to 529 from pJE621 was subcloned into pBluescript SKI[+ to
create plasmid pJE640, the template for the QuikChangeTM Site-Directed
Mutagenesis protocol. This technique was perfarmed as prescribed in the
instruction manual provided by the manufacturer. PCR amplification was
conducted at the following conditions: 30 seconds denaturation at 94OC. 1 minute
annealing at 55OC and 12 minutes extension at 68OC for 16 cycles.
Using the QuikChangem method and primers 15-18 and 20-23. Bglll restriction
sites were introduced at 4 other locations within pilS. Plasmids pJE641, pJE646,
pJE652 and pJE655 were thus produced. A Bglll restriction site was also
introduced at the iocation corresponding to a. a. 75 of PilS in pJE641 and a. a.
304 of PIIS in pJE659 with this method using primers 15-16 and 33-34, yielding
plasmids pJE644 and pJE810, respectively. - The EcoRIATG linker was
introduced into the Bglll teskicfrCon site of pJE641, pJE646 and pJE652 to
introduce a start codon at a. a. 123.75 and 49 of the native protein, respectively,
yielding plasmids pJE641E, pJE646E and pJE652E. The EcoRlATG linker
cancels #e Bglll site and introduces an EcoRl restridion site as well as an in-
![Page 66: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/66.jpg)
50
fiame ATG start codon. The addition of these two features allows the creation of
three deletion constructs in which the N-terminaI helices are removed and TM2,
TM3 or TM5 now become the first helix of the mutant PilS proteins.
3-4 Construction of the pj/S internal deletions
34.1 Full-length deletions
The full-length deletions are constructs in which only one or more helices are
removed, while the linker and transmitter domains of PilS are maintained. The
first internal deletion produced was pJE645. It was created by removing the 144
bp Bglli-Bglll fragment corresponding to a. a. 76-123 of PiIS from pJE644.
Similarly, a 381 bp 8g111-Bg111 ftagment was removed from pJE810 to create
pJE811, which carries a deletion of 5 TM segments and the linker region of PIIS.
The 310 bp fragment corresponding to a. a. 1-99 was removed from pJE616K
with Kpnl and BarnHl and inserted into pJE641 and pJE655 to replace the
previous Kpnl-Bglll ftagment The two plasmids created, pJE649 and pJE664,
possess a deletion in the pilS gene corresponding to a. a. 100-123 and a. a. 100-
In, respectively. The other internal deletions were generated in a similar
manner. The 164 bp KpnCBglIl fragment was removed from pJE652 and
inserted at the same sites in pJE655, pJE646 and pJE6-I. Plasmids pJE659,
pJE662 and pJE663 were created; they contain a piiS gene deIeted for segments
![Page 67: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/67.jpg)
51
corresponding to a. a. 50-177, a. a. 50-75 and a. a. 50-123 of the mature protein,
respectively. P lasmids pJ E660 and pJE66 2 were produced by rep lacing the
Kpnl-Bglll fragment from pJE655 with the 242 bp and 386 bp KpnCBglll
fragments from pJE646 and pJE641, resulting in deletions of a. a. 76-17? and
a. a. 124-177. respectively. A deletion of the segment that translates to TM6 (a.
a. 155-177) was created by replacing the Kpnl-Bglll fragment from pJE655 with
the 479 bp Kpnl-BamHI segment from pJE625K.
3.4.2 Truncated deletions
Truncated deletions consist of the fulklength deletions in which the TM6, linker
and transmitter domains (corresponding to a. a. 155-529) are removed. Using
the PCR-based mutagenesis method, a BamHl restriction site was introduced at
the location corresponding to a. a. 154 of the native protein in various mutants of
pilS. PCR amplification was performed using primers 27 and 9 and plasmids
pJE649, pJE645, pJE662, pJE663, pJE646E and pJE652E as DNA templates-
The PCR products obtained with the first four templates were digested with Kpnl
and BamHI, purified from agarose gels and ligated into pBluescript to create
pJE656, pJE667, pJE696 and pJE699, respectively. The PCR products obtained
wiVl the other brvo templates were digested with EcoRl and BarnHl and
introduced in pBluescript to produce pJE8Wand pJE807. The KpnRBS linker
was then introduced into the EcoRl site of these two plasmids to generate
pJE804K and pJE807K respectively.
![Page 68: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/68.jpg)
3.5 Construction of the aene fusions
3.5.1 The reporter vectors
The reporter vectors pJE608, pJE609 and pJE670, shown in Figure 9, are
derivatives of the low copy-number broad host range vector pMMB67EH (56).
This vector contains lacp, the lac repressor, to allow transcriptional control from
its tac promoter. The three reporter vectors possess a unique in-frame BamHl
restriction site at the N-terminus of the reporter gene.
Plasmid pJE608 contains the promoterless lac2 gene missing its first eight amino
acids from pMC1871 (Pharmacia Biotech, Uppsala, Sweden). The gene was
removed from pMCi871 as a BamHl fragment and ligated into the BamHl and
Bglll restriction sites of pSL1180 (Pharmacia Biotech, Uppsala, Sweden). The
lac2 gene was then removed from this intermediate construct and ligated into
pMMB with BamHl and Xbal.
Plasmid pMS501 (137) was used as the source of phoA to create pJE609. First,
a 1.4 kb fragment was removed from pMS5Ol by digesting with BstEll and Nhel,
blunting both ends and religating. Then, the 1.7 kb ftagment containing the phoA
gene lacking a start codon and its export signal sequence was removed from this
construct and inserted into pMMB with BamHI and Hindlll. Similarly, the gene
![Page 69: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/69.jpg)
53
coding for the green fluorescent protein (GFP) was removed from pJB713 and
inserted into pMMB with BamHl and Hindill to create pJE670.
3.5.2 Fusions of pilS to lac& phoA and gtjp
The pilS derivatives (described above and in Table 2) were fused to the reporters
using either Kpnl or EcoRl at the 5' end and BamHl or Bglll at the 3' end of the
pilS fragment. Three series of translational fusions were thus created, see
Figures 10, I1 and 12 for a diagram representation of the constructs created.
The same pilS fragments were also subcloned out of the pUCP22 or pBluescript
vectors where they were first cloned, and inserted into the pMMB vector (without
any reporter gene) using the same restriction enzymes. In this manner, a
complete panel of truncation and deletion mutants were created with fusions to
lacZ, phoA and gfp. All of the constructs are carried on the pMMB vector and
expressed from the iac promoter. The EcoRlATG linker was introduced into the
BamHl site of pJE608 to add a start codon to IacZ. The resulting plasmid.
pJE680, is used as a positive control for B-galactosidase activity.
3.6 Construction of the ~romoter fusion
In order to monitor pilin gene expression. a transcriptional fusion of the pilA
promoter to gfp was consfructed. Because of low levels of fluorescence obtained
from the pGG103A construct @iM promoter-gfp), a translational enhancer was
![Page 70: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/70.jpg)
54
added upstream of the gfp gene to improve GFP translation efficiency. The
translation initiation region FIR) described by Miller and Lindow (99) and Cheng
and Patterson (23) carried on two complementary oligonucleotide linkers
(primers 24 and 25, Table 1) was cloned upstream of the gfp gene in pYG3. The
gfpTIR cassette was excised from pYG3-TlR and inserted into pDN19 to
generate pJE410. The only difference between pGG103 (gfp, no promoter) and
pJE410 is the presence of the TIR. The 400 bp BamHl fragment from pJB1O
carrying the pilA promoter was cloned into the BarnHl site upstream of gfpTlR in
pJE410 to create pJE4l I.
3.7 Hybrid protein analvsis
31.1 Western immunoblotting of the hybrid proteins
Bacterial cultures with the appropriate pfasmid were grown overnight in LB broth
without induction and then diluted 1:50 in fresh media containing lPTG (0.05 mM
for P. aeruginosa and 1 mM for E. col]]. The cultures were allowed to grow for 8
hours prior to harvesting. One milliliter of culture was pelleted, resuspended in
100 pL of W, reducing dye (3% sodium dodecyl sulfate [SDS], 20% glycerol, 5%
p-mercaptoethanol, 100 mM Tris-HCl [pH=hO], 0.01% bromophenol blue) and
boiled for 10 minutes. Three to ten microliters of the samples were loaded on
SDSpolyacrylamide gels (PAGE) for electrophoresis. Proteins were then
electroblotted onto a nitroceliulose membrane (Schleider and Schueil, Keene,
![Page 71: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/71.jpg)
NH). The membrane was incubated overnight with the appropriate antibody.
After washing in Tris-buffered saline (TBS, 20 mM Tris-HCI, 500 mM NaCI,
pH=7.5), the membrane was incubated with the appropriate secondary antibody
(horseradish peroxidasecong ugated anti-mouse or anti-rab bit) for one hour and
washed in TBS prior to detection with the LumiGLOw Chemiluminescent
Substrate K i (Kirkegaard 8 Perry Laboratories. Gaithersburg, MD),
3.7.2 Alkaline phosphatase and pgalactosidase assays
Alkaline phosphatase and p-galactosidase enzymatic assays were performed
according to the methods of Manoil and Miller, respectively (91, 98). Bacterial
cells were grown overnight in LB broth with the appropriate antibiotic and without
IPTG. The next day, the cultures were diluted 1:50 in fresh media containing
IPTG (0.1 mM for P. aemginosa and I mM for E. col4 and allowed to grow until
the cultures reached a cell density (ODsw) of 0.4 to 0.6, approximately 3 hours.
The assay was then performed with 1 mf of these cultures.
3.7.3 Fluorescence assays
Bacteria were grown in LB broth supplemented with Tet and Carb. Two series of
cultures were grown, one without IPTG and one supplemented with 0.5 mM
IPTG. After an overnight incubation at 37OC, 1 ml of culture was hanrested and
washed in phosphate-buffered saline (PBS, 137 mM NaCI, 2.7 mM KCI, 4.3 mM
Na2HP04, 7.4 mM w O c pH=?.3) with 20 mM MgCh The absorbance
![Page 72: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/72.jpg)
56
and fluorescence (excitation at 485 nm, emission at 535 nm) of 200 pl of
washed cells was measured with the ~a l l ac ~ 1 ~ ~ 0 ~ ~ ~ 1 4 2 0 multilabel counter
(PerkinElmer, WelIes ley, MA).
3-8 Cell fractionation
LB broth supplemented with Carb was inoculated 1:100 from an overnight
bacterial culure grown in LB Carb, no induction. After one hour of growth at
370Cr IPTG was added to 0.1 mM and incubation at 37OC was resumed and
allowed to proceed to overnight. The 200 ml overnight cultures were harvested
and the pellet was washed in 50 mM Tris-HCI (pH=8.0), 10 mM MgCh. The
washed cells were resuspended in 4 ml of the same buffer. DNasel and RNasel
were added to a final concentration of 50 pglml-each, lysozyme was also added
to 500 pgfml. Cells were sonicated at 30-50% intensity for 6 cycles of 15
seconds each and then incubated at room temperature for 30 minutes. A low
speed centrifugation (10 minutes, 10 000 x g) was done to remove unlysed cells
and cell debris. A 100 pl aliquot of the supernatant was removed and kept as a
whole-cell control (W fraction). The remaining supernatant was then centrifuged
at 100.000 x g for one hour. The supernatant (soluble fFactrCon) was transferred
to a clean tube and the pellet (membrane fraction) was resuspended in 4 rnl Tris-
HCI (pH=8.0), I 0 mM MgC12- Both fractions were centrifuged again at 100,000 x
g for one hour. The supernatant of the soluble ftactrCon was kept as the S fraction
![Page 73: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/73.jpg)
57
and the pellet of the membrane fraa-on was resuspended in 4 rnl Tris-HCI
(pH=8.0), 10 mM MgCh and kept as the M fraction.
3.9 Microscopy
Bacteria were grown and prepared for microscopy as described previously (1 5)
with minor modifications. Briefly, 5 ml LB Carb with 0.1 mM lPTG cultures were
inoculated from an overnight culture in LB Carb and grown for 3 hours. These
cultures were then incubated ovemig ht at 4OC prior to mounting and imaging.
One milliliter of culture was washed in I ml PBS 20 mM MgCh, 35 pl of the
washed cells was applied to polylysine-coated cover slips for 5-10 minutes and
the excess rinsed off. The cover slips were then mounted on microscope slides
with Mowiol (Calbiochem, La Jolla, CA).
Slides were viewed at 100 X oil immersion, 1.4 NA, with a Leica DMRE
microscope using epifluorescence illumination and Chroma High Q filters.
Images were taken with a Princeton Instruments cooled (-40°C) CCD Digital
Camera (1 2 bit AD, 1 % linearity) and a Kodak KAF 1600 detector.
![Page 74: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/74.jpg)
Chanter 4. TOPOLOGICAL MODEL OF PilS
4.1 Results
4.1 .f Topological predictions
A hydrophobicity profile of PilS was obtained using the program DNASIS@ (v2.0,
Hitachi Software Engineering Co. Ltd.) and the Kyte and Doolittle scale (83) at
the default settings (window of 7 amino acids) (Figure 13). Six peaks of
hydrophobicity greater than 2.00 were observed suggesting the presence of six
TM segments. A similar hydrophobicity analysis was performed using the
computer program TopPredll(25) and TMPred (69). Similar results were
obtained with both analyses. Both programs predicted a six helix model with a
cytoplasmic localization for both the N- and C-termini, as shown in Figure 2. The
only difference between the two models was the first andfor last amino acids of
the some helices. These variations were of only one to three amino acids per
helix (Figure 14).
4.1.2 Construction of the gene fusions
In order to confirm the presence and orientation (cytoplasm to periplasm or
periplasm to cytoplasm) ofthe six predicted helices, hnro series of translational
gene fusions were constructed (see Chapter 3 for experimental details), in the
first series schematized in Figure 10.1acZ and phoA were fused to eight different
![Page 75: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/75.jpg)
59
locations within the pilS gene. These locations (a. a. 49,75,99, 123, 154, 177,
304 and 529) were chosen because they correspond to each of the predicted
connecting loops as well as the end of the linker region and the C-terminus of the
protein. The second series of fusions. shown in Figure 1 I, are to the C-terminus
of four full-length deletions and each of the truncated deletions. In the truncated
deletions, Lac2 and PhoA are fused to the site corresponding to a. a. 154 (after
TM5) of wildtype PIIS. The results obtained from the analysis of this series of
fusions should be compared to the results obtained for the C-term fusions
(pJE623 and pJE624) for the full-length deletions, and TM5 (pJE628 and
pJE629) for the truncated deletions.
4.1.3 Analysis of the PilS-La& and PilS-PhoA hybrid proteins
The hybrid proteins were expressed in the E. coli lacZphoA- strain CC118 as
well as in wildtype P. aeruginosa PAK and in the piiS deletion mutant PAK-AS2.
Western irnmunoblotting of whole cell lysates was performed to verify the stable
expression of the hybrid proteins. Figure 75 shows the results of these Western
blots for the strains PAK-AS2 (panels A and C) and CC1 I 8 (panels B and D);
band patterns and intensities seen for the strain PAK are comparable to those
observed for PAK-AS2. Although breakdown products are present, a major band
(top band in each lane) corresponding to the full size of the hybrid protein
(between 53 and 106 kDa for PilSPhoA and 116 and 175 kDa for PilS-LacZ)
was observed for each construct.
![Page 76: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/76.jpg)
60
Bacteria expressing the hybrid proteins were all grown in the same media under
the same conditions, but variations in the level of protein expression can
nonetheless be observed (Figure 15). The most striking difference in protein
expression is seen between the P. aenrginosa strains and the E. coii strain, as
observed in Figure 15 and other Western blots where E. coli and P. aenrginosa
carrying the hybrid proteins were electrophoresed side by side on the same
polyacrylamide gel (not shown). This variation will be further emphasized by the
enzymatic assays carried out on the strains carrying the fusion plasmids since
these assays measure the activity of the enzyme present in the bacterial cell,
which is directly correlated to the levels of protein expression.
The PilS kinase activity can be measured by the ability of the protein to
complement the pilS deletion in PAK-AS2 and activate pilA transcription. and the
Pits phosphatase activity is determined by a reduction in pilin expression in PAK
when PilS is overexpressed compared to the wildtype strain canying the empty
vector pMMB. A qualitative pilin assay (Western irnrnunoblot probed with an anti-
PilA antibody) was perform to determine if the fusion of the reporter proteins to
full length PilS impaired its kinase and phosphatase functions. When uninduced,
pJE623 and pJE624 are able b fully complement the pilS deletion in PAK-AS2
and approximate wildtype levels of pilin were detected (Figure 16A, lanes 1 and
3), suggesting that the presence of €he repoiter enzyme does not affect PilS
kinase function.
![Page 77: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/77.jpg)
61
Under inducing conditions (0.5 mM IPTG), piIA expression appears slightly
reduced presumably because of the phosphatase activity of PIIS. Figure 168
shows the results of the qualitative pilin assay for phosphatase activity. When
PilS is overexpressed, there is a slight reduction in pilin expression for the two
PilS-Lac2 (lane 2) and PilS-PhoA (lane 4) hybrids compared to PAK (pMMB)
(lane 6), however this inhibition is not as severe as is observed for PAK (pJB228)
(lane 8). This can be explained by smaller amounts of PilS in the cell for the two
hybrids compared to ppJB228, even when grown under the exact same
conditions. The amount of PilS in the cell was determined by visual examination
of the Western blot probed with an anti-PilS antibody (top panel of Figure 16B).
This suggests that the hybrids pJE623 and pJE624 retain fils p hosp hatase
activity as well as kinase activity.
4.1.4 Enzymatic activity of the hybrid proteins
Enzymatic assays were performed to determine the activity of the hybrid proteins
in the two P. aemghosa strains and in E. coli CC118. Strains producing more
than 10 units of either PhoA or Lac2 activity were considered to be positive for
enzymatic activity, while strains producing less than 10 units were considered
negative. Strains (PAK, PAK-AS2 or CCf 18) carrying the negative controls
yielded between 0 and 7 units of LacZ activity for pJE608, and I and 5 units of
PhoA activii for pJE609. High levels (>I0 Miller units) of LacZ activity suggest a
cytoplasmic fusion site, while high levels (>I0 units) of PhoA activity imply a
![Page 78: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/78.jpg)
62
periplasmic fusion site since PhoA requires the oxidizing environment of the
periplasm to be active.
Over 16000 Miller units were obtained in PAK for the Lac2 positive control, this
result is not even comparable to the results obtained for the diverse Pits-Lac2
proteins. This should not come as a surprise considering the amount protein
detected by Western blotb'ng, as shown in Figure f5, lane 17. PilS protein
expression is variable and sometimes scanty, even in P. aemginosa, but the
positive control pJE680 does not contain any pilS sequences or the RBS
introduced by the KpnRBS linker. In addition, in pJE680 the lac2 gene
possesses an ATG start codon, while in the other constructs pits begins with a
GTG start codon. All of these features can explain the very large differences in
Lac2 expression and activity.
4.1.5 PilS possesses six TM segments
As expected, each pair of hybrid proteins shows contrasting patterns of activity
levels. Wlth the exception of the negative controls, pairs of fusions never exhibit
positive or negative enzyme actkity for both reporters. The same patterns of
enzymatic activities are observed in E.. coli and both strains of P. aemginosa
although the values are much lower in E. colithan in P. aeruginosa even when
induced with more IPTG. This difference in protein expression levels between
species is also observed on Western blots (Figure 15).
![Page 79: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/79.jpg)
As shown in Figures 17 and 18 and Table 3, fusions of the reporter proteins to
sites in PilS located downstream of the predicted TM1 , TM3 and TM5 show a
PhoA+JLacZ- phenotype, suggesting a periplasmic localization of these particular
h ion sites. For PAK, the Lac2 activity values measured for these three
constructs are 2.8 k 2.3, ? -7 + 1 .I and 4.1 k 2.2, respectively, which is less then
the 4.1 t 1 -8 Miller units measured for the negative control pJE608. The P hoA
enzymatic activity values obtained for PAK for these same sites were 1 11 -4 &
34.0, 75.6 k 18.7 and 68.0 k 14.8, respectively, all notably elevated compared to
the negative control pJE609 which presented only 1 -3 & 0.4 units of PhoA activity
in PAK.
In contrast. a PhoA-/LacZ+ phenotype is observed for fusions of the reporters to
sites located downstream of the predicted TM2, TM4 and TM6. the linker domain
and at the Cterminus of full length PIS. This phenotype suggests cytoplasmic
fusion sites. The La& activity of these hybrid proteins assayed in PAK ranged
from 97.9 k 37.5 to 340.7 + 94.0 Miller units, while only 1.7 k 0.3 to 7.2 + 1.7
units of PhoA activity were measured for these fils-PhoA hybrids. Figure 19
summarizes these resufts in a schematic manner. These results are in
agreement with the topologicaI model obtained by computer programs.
![Page 80: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/80.jpg)
4.1.6 Orientation of the TM segments
The orientation of the putative helices was confirmed by deleting some helices
and fusing the reporters after the transmitter region in one series of fusions and
at a site located downstream of TM5 in wildtype PilS in a second series of
deletion fusions. The hypothesis is that deletion of a pair of helices would not
reverse the orientation of the downstream helices or the C-terminus of the protein
or affect the topological model, while deletion of one or three helices would
reverse the orientation of the following TMs as well as the Cteminus.
4.1.6.1 Full-length deletion hybrid proteins
Four full-length deletion hybrids retaining the linker and transmitter domains were
constructed (Figure 11). The enzymatic phenotype of these deletion hybrid
proteins was compared to that of the fusions to the C-terminus (pJE623 and
pJE624). The phenotype was assessed by growing these strains on LB agar
supplemented with Xgal (for PilS-LacZ) or XP (for PilS-PhoA) and 0.j mM IPTG
and observing the color of the colonies. Fusions TMi C (deletion of TM2-TM6),
TM4C (deletion of TM5-TM6). ATM2-4C (deletion of TM2-TM4) and ATM4C
(deletion of TM4) a11 present a LacZ+/PhoA- phenotype, same as the Gtem
fusions. As summarized in Table 4, colonies of the four PilS-La& strains were
blue in W e presence of Xgal suggesting an active Lac2 moiety, while the colonies
of the PilSPhoA strains were white in the presence of XP suggesting an inactive
PhoA component. This LaS+PhoA- phenotype implies a cytoplasmic fusion site
for each of these bsions-
![Page 81: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/81.jpg)
65
The phenotype observed for the TM4C fusions was expected if the hypothesis is
right and that deletion of a pair of helices does not affect the remaining helices
and the position of the C-terminus. However, the phenotype observed for the
other three pairs of fusions contradicts that hypothesis. Indeed. in these
constructs, removal of an uneven number of helices does not cause an inversion
in the topology of the protein and the C-terminus of the protein remains
cytoplasmic.
Further study of the amino acid sequence of PilS revealed the presence of a
strong hydrophilic segment between a. a. 175 and 206 just C-terminal of TM6
(Figure 14). Short hydrophilic segments are also present throughout the linker
and transmitter domains of PIS. To investigate the possible role of this segment
and the linker region as insertion inhibitors, a fusion was constructed in which the
entire linker region as well as the last 5 TMs have been removed. The
TMl Alinker fusions carry a deletion of a. a. 50 to 304 of PIIS.
Enzymatic activity of these fusions was measured in P. aeruginosa and
compared to the activities of the TMI and TMlC fusions (Figure 20). The
enzymatic levels obtained for these fusions are somewhat conflicting. Fusion
TMlC (pJE69O) shows high levels of Lac2 activity, 98.8 r 4.3 Miller units for PAK
and 79.6 k 4.2 Miller units for PAKdS2, while the other two PiIS-Lac2 hybrids
(pJE654 and pJE812) exhibit levels of Lac2 activity similar to the negative controI
![Page 82: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/82.jpg)
66
pJE608, i. e. between approximately 1 and 6 Miller units. This would suggest
that when the linker region of PilS is absent, the Lac2 moiety of the hybrid protein
is translocated across the inner membrane. However, the difference in the PhoA
activity measured for the fusions pJE691 (TM1 C) and pJE813 (TMl Alinker) is not
as striking as it is for pJE690 and pJE812. The levels obtained, 12.6 + 0.8 for
PAK (pJE691) and 20.3 t 1.0 for PAK (pJE813), are approximately 10- and 15-
fold, respectively, higher than the negative control pJE609 and 1.5- to 3-fold
higher than the full length PilS-PhoA hybrid pJE623. Also, these values only
represent 10 to 20% of the activity measured for pJE653 (fusion to TMI). It is
therefore difficult to speculate on the cellular localization of the fusion sites.
P. aenrginosa PAK and PAK-AS2 carrying the hybrids were grown overnight with
induction (0.05 mM IPTG). Whole cell lysates of these strains were subjected to
SDS-PAGE and immunoblotted with an anti-PhoA antibody. As shown in Figure
218, more degradation products are detected for pJE6P1 and pJE813 (lanes 2
and 5; 3 and 6, respectively) in addition to the product corresponding to the full-
size hybrid compared to pJE653 (lanes 1 and 4) and the other hybrids (refer to
Figure 15), suggesting that pJE691 and pJE813 are unstable. In contrast, the
PilS-LacZ hybrids pJE690 and pJE8?2 show approximately the same amount of
break-down products as all the other Pits-LacZ hybrids (Figures 21A and 35). It
is therefore possible that the conflicting enzymatic assay results for pJE69T and
pJE813 are refiectke of the amount of degradation products present in the celI
![Page 83: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/83.jpg)
67
and the instabifow of the proteins. Because of these wnfl icting results, 1 is hard
to speculate on the involvement of the hydrophilie segments of the linker and
transmitter regions on translocation, and as discussed in the Discussion section,
further testing should be done.
4.1.6.2 Truncated deletion hybrid proteins
Six truncated deletion hybrids were constructed (Figure 11). The removal of the
hydrophilic linker and transmitter regions (a. a. 155 to 529) negates the possible
insertion inhibitory effect of these domains. Enzymatic activity of the truncated
deletion hybrid proteins was compared to that of the fusions to TM5 (pJE628 and
pJE629).
Figures 22 and 23 and Table 5 show the results of the enzymatic activity assay
for the deletion hybrid proteins. Deletion of the pairs TM1-2 and TM3-4 did not
change the peripfasmic localkation of the reporters, compared to the TM5
fusions, as shown by strong levels of PhoA activity (for PAK, 49.9 t- 11 -7 for
pJE805,68.9 + 19.9 for pJE669, compared to 68.0 r 14.8 for pJE629). Elevated
levels of Lac2 activity were observed for the fusions A m 4 (pJE802) and ATM4
(pJE658) compared to pJE628, suggesting a cytoplasrnichsion site and an
inversion in the topology. Surprisingly, the independent deletions of TMI and
TM2 did not reverse the topology since these fusions showed high levels of PhoA
activity (for PAK, 56.7 + 13.3 and 79.0 & If -3, respectively) and low levels of
Lac2 activity (for PAK, T .1 + 0.5 and 3.6 k 1.4, respectively).
![Page 84: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/84.jpg)
68
A topological prediction was done for the last two deletions using TopPredll. In
both case, the modeis proposed show a periplasmic localization for the fusion
site, as implied experimentally, indicating that these deletions cause an important
change in the topology. The ATMl model indicated a periplasmic N-terminus
and the AIM2 model proposed that the segment corresponding to TM3 in
wildtype PilS is fully translocated across the membrane, leaving only 3 TM
helices to anchor the protein (Figure 24).
4.1.7 Cellular localization of the PilS=LacZ hybrids
It was possible that the Lac2 hybrids were incompletely inserted into the
membrane and therefore cytoplasmic. Equally high activity levels would be
observed if the hybrid proteins were found in the cytoplasm in a soluble form,
giving a false interpretation of a cytoplasmic localization of the fusion site. In
order to confirm if this was the case, dl fractionation experiments were done on
the Lac- fusions showing strong activity levels.
Fve of the eight constructs tested (TM4, TM6, linker, Gterm and ATM4) were
found solely in the membranefiaction (M fraction) (Figure 25A). Fusions TM2
and ATM2-4 were predominantly found in the M fraction but a minor band was
detected in the soluble fraction (S €taction). This indicated that these two hybrid
proteins, which only possess two TM helices, did not insert into the inner
membrane with the same efficiency and stability as the other proteins. The
![Page 85: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/85.jpg)
69
efficiency of separation of the M and S fractions was assessed by probing
identical Western blot membranes of each fraction with anti-Oprf (a membrane-
bound protein) and anti-plactamase (a soluble periplasmic protein) antibodies
(Figure 256). In all cases, segregation of these two proteins into the M or S
fractions appeared to be complete and there is no evidence of cross-
contamination between the two fractions, thus supporb'ng the enzymatic activity
data and the topology results obtained with the PilS-Lac2 hybrid proteins.
Interestingly, the positive Lac2 control was present in both fractions. Since this
protein is expressed to very high levels from the strong tac promoter, it is
possible that the excessive amount of Lac2 was not thoroughly separated even if
the controls OprF and plactamase were completely separated.
4.2 Discussion
The aim of the experiments described in this chapter was to prove or disprove
the topological model of PilS obtained through computer predictions. The
topological model of PilS suggested by the TopPredll(25) is shown in Figure 2.
This model predicts that the first in a. a of the protein form six TM segments
and that the remaining 353 a a. stay in the cytoplasm. This mode[ also complies
with the positive inside rule that states that the positively charged residues Arg
and Lys are more prevalent in cytoplasmic rather than periplasrnic segments
![Page 86: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/86.jpg)
(153). Indeed, a total of 8 Arg and Lys are found in the cytoplasmic segments
(excluding the linker and transmitter regions), while only one Lys is present in the
three predicted periplasmic loops.
In order to confirm tfie predicted topology, two series of translational gene
fusions were engineered and analyzed. In the first series, the reporter genes,
IacZ and phoA, were fused to sites in pilS corresponding to each of the predicted
loops as well as the junction between the linker and transmitter domains and to
the last a. a. of the mature protein. The results of this series of fusions strongly
supports the presence of 6 TM segments. The second series of fusions was
constructed wlh the purpose of confirming the orientation of the helices and also
to determine the effects of helix deletions in the insertion of the protein into the
membrane. In these fusions, the reporters were fused to a piiS gene carrying
various deietions of segments corresponding to one or a combination of helices.
All of these gene fusions were analyzed in wildtype P. aenrginosa PAK and the
pilS deletion mutant PAK-ASZ, as well as in E. coli CC118 (iacZ- phoA-).
As shown in Tables 3 and 5, there is a noticeable fluctuation in the values of
enzymatic activity among the strains considered to be enzymatically active (> TO
units of enzymatic activity). For example, for the strain PAK, values of Lac2
activity measured in active strains vary from 97.8 + 37.5 Miller units for pJE634 to
340 J 2 94.0 Miller units for pJE624, while the PhoA a W i of positive strains
![Page 87: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/87.jpg)
71
varies from 49.9 + I 1.7 for pJE805 to 17 1.4 f 34.1 units for pJE653. As shown
qualitatively by Western immunoblots in Figure 15, protein expression varies
from one construct to another and this variation in protein expression explains
the range of enzymatic values obtained for the various hybrid proteins. After all,
the Lac2 and PhoA activity quantitated by the enzymatic assays is representative
of the amount of protein being produced inside the bacterial cell.
Although a strain exhibiting positive activity in P. aeruginosa also shows positive
activity in E. coli, levels of enzymatic adivity differ substantially between the two
bacterial species. Previous PilS expression studies have reported a defect in
PifS expression in E. coii(l6, 17,66). These studies reported a 37 kDa PilS
product in coli instead of the 59 kDa product obtained in P. aemginosa. Point
mutations within potential start codons showed that this smaller product was due
to the recognition of an alternative start codon by the E. colitranslaional
machinery. This suggests that the correct GTG start codon of PilS is not favored
in E. coli. This could explain the considerable difference in hybrid protein
expression and enzymatic activity observed in E. coii and P. aemginosa.
Because most of the fusions created carry deletions of the portion of the protein
where the alternative start codon is located, smaller products resulting from
recognition of that initiation codon are not detected in E. coli. Despite low protein
expression levels, we are able to condude that the membrane topology of PilS in
E. coli is the same as it is in P. aemginosa.
![Page 88: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/88.jpg)
72
Interestingly, La& enzymatic activity appears to be slightly greater in PAK-AS2
than in PAK, while PhoA activity seems to be elevated in PAK compared to PAK-
AS2 (Figures 17 and 22). Western immunoblots do not show variations in hybrid
protein expression between the two P. aemginosa strains or the two types of
hybrids, so protein levels are not the cause of this discrimination. Also, if the
presence of PilS expressed from the chromosome in PAK interferes with reporter
enzyme activity, why would it preferably negatively interfere with Lac2 activity
and heighten PhoA activity? A possible explanation is that PilS is somehow
involved in the secretion and membrane insertion system of P. aenrginosa. In a
strain where PiIS is absent, secretion may be deficient and the PhoA moiety of
the PilS-PhoA hybrids may not be as efficiently translocated into the penplasm as
it is in PAK where PilS is present and able to exert its effect on the secretion
system. This would explain the lower levels of PhoA activity in PAK-AS2
compared to PAK even though the same amount of protein is produced in both
strains. We have no direct evidence to support this, but it was recently proposed
that the PilA protein of N. gononhoeae, initially isolated as a pilin transcriptional
regulator. is an homologue of FstY, the E-coli SRP receptor (6).
The data obtained with the anaIysis of the fint series of fusions is summarked in
Figure 19. The fusions to sites immediately following the predicted TM7, TM3
and TM5 segments present a LacZ-!PhoA+ phenotype as judged by elevated
levels of PhoA activity and levels of La& activity similar b those measured for
![Page 89: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/89.jpg)
73
the negative control. Such a phenotype impiies that the fusion sites were
periplasmic and that TMI is capable of acting as a signal peptide for PhoA
translocation into the periplasm. However, from these results alone it is not
possible to speculate on the function of TM3 and TM5 as signal peptides since it
is not possible to determine if all 3 (or 5) TM segments have inserted into the
membrane. As demonstrated by the fusion TMI , the insertion of only one TM is
sufficient to drive the translocation of PhoA across the membrane.
In contrast to the fusions to TMI, TM3 and TM5, fusions to TM2, TM4, TM6.
linker and C-terminus of PilS display a LacZ+IPhoA- phenotype, suggesting
cytoplasmic fusion sites. A similar LacZ+/PhoA- phenotype would be observed if
the hybrid protein was found in a soluble form in the cytoplasm. This could
happen if the removal of a number of N helices impaired the insertion process
or caused the protein to be inserted in an unstable way, in either case the
interpretation of the result could be inaccurate. Cell fractionation experiments
were performed on these 5 strains to verify that the hybrid proteins were stably
inserted in the membrane and that the conclusion of a cytoplasmic fusion site
was correct. The results of this experiment, displayed in Figure 25, show that the
PiIS-Lac2 proteins producing elevated levels of Lac2 activity are embedded
within the membrane, indicating that our inte-rpretation of the cytoplasmic fusion
sites was accurate. A very weak band is detected in the S ftaction for the TM2
fusion suggesting that although it is primarily membrane-bound, this protein may
![Page 90: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/90.jpg)
74
not insert into the membrane with the same stability as the others. Nonetheless,
it is very unlikely that the presence of such a small amount of the soluble protein
in the cytoplasm could account for all of the 165.8 t 13.3 Miller units of Lac2
activity measured in PAK or the 11 14.1 !: 251.4 units measured in PAK-AS2.
The observation that TM1 serves as a signal peptide combined with the
cytoplasmic location of the the fusion site following TM2 means that TM2 can be
considered a stop-transfer sequence. As was the case for TM3 and TM5, the
function of TM4 and TM6 as topological determinants can not be ascertained
from the enzymatic phenotype of the TM4 and TM6 fusions alone. The same
LacZ+/PhoA- phenotype of these hsions would be obtained if only TM1 and TM2
were inserted into the membrane. But when the data obtained for all eight
fusions of this series is combined, the following conclusions may be drawn: 1)
TM1, TM3 and TM5 each act as signal peptides and cross the membrane with
their N-terminal end in the cytoplasm and their C-terminal end in the pen'plasm;
2) TM2, TM4 and TM6 serve as stoptransfer sequences that halt translocation of
the protein. These last TMs cross the membrane with their N-terminal end in the
periplasm and their C-terminal end in the cytoplasm. The fusions to the linker
and to the Gterminus of PilS remain cytoplasmic, suggesting that no other signal
peptide sequences are present aside from the three mentioned above.
![Page 91: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/91.jpg)
75
Thus, the six hydrophobic segments of PilS detected by the Kyte and Doolittle
hydrophobicity profile (Figure 13) are capable of forming TM helices that anchor
the protein into the inner membrane with both the N- and C-termini of the protein
staying in the cytoplasm, as predicted by computer programs. Unfortunately, the
method used to investigate the topology of this protein does not allow us to
determine precisely which a. a. is the first or last a. a. of the TM helix. Only an
estimate on the a. a. composition of the TM segments and loops can be
proposed based on the computer models. The a. a. numbers indicated in Figure
2 as the first and last a. a. of the helix should therefore be looked at as possible
but not definite start and end of the TM segment.
The second series of fusions was created to study the effect of helix deletions on
the topology of Pits and to confirm the orientation of the TM helices. Our initial
hypothesis was that the removal of an even number of helices would not affect
the topology and the Gterrninus of the protein would remain cytoplasmic, and
that the deletion of an uneven number of TMs would cause an inversion in the
topology and that the Cterminus of Pits would become periplasmic. However,
the results obtained were not consistent with this hypothesis.
The fusions to the four fulClength deletions gave a LacZ+/PhoA- phenotype,
identical to the fusions at the Gterminus of full [ength PilS. This signifies that the
Gterminus of these mutant PiIS proteins remains in the cytoplasm, but the
![Page 92: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/92.jpg)
76
precise membrane topology of the TM dom& of these mutants cannot be
determined. As noted elsewhere (9,22,43,58), the native topology of a protein
is fairly resistant to sequence modifications. The fact that the transmitter domain
of PilS stays in the cytoplasm regardless of the number of TM helices implies that
the protein adopts an alternative membrane topology in order to keep its
functional domain in the cytoplasm where it is free to bind ATP and interact with
PiIR. Alternative topologies of deletion mutants lacking, TMI or TM2 are shown
in Figure 24.
Two of our truncated deletion mutants cause an inversion in the orientation of
subsequent TMs. These two PilS variants contain a deletion of TM4 and TM2-
TM4. As shown by cell fractionation, despite the deletion, the PilS-Lac2 hybrid
proteins retain their ability to insert into the membrane (Figure 25A). It should be
noted however that small amounts of the ATM2-4 PilS-Lac2 protein are also
present in the solubIe fraction, suggesting that the impressive deletion of three
TMs somewhat impairs the insertion process. [t should be stressed that the
position and orientation of the TM segments in these mutants cannot be
determined and that only the location of the fusion site can be inferred from the
enzymatic profile of the fusions. Interestingly, the removal of TM4 in the
truncated deletion appears to cause an inversion in the orientation of TMS
(Figure 22), but the same helix deletion in the full-length deletion construct does
not appear to cause an inversion (Table 4). One possible explanation for this
![Page 93: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/93.jpg)
77
observation is that the hydrophilic linker and transmitter domains, absent in the
truncated deletion, serve as strong translocation blockers. Lee et al(84) have
reported that multiple sequences in fhe Lac2 protein act together to block
translocation of the protein across the inner membrane. This would also explain
why all the fulClength deletions tested have their C-terminus in the cytoplasm
regardless of the number of TM helices.
A construct in which the last 5 TMs as well as the linker domain of PilS were
removed was created to determine if the hydrophilic segments found in the linker
had a translocation inhibition effect The enzymatic phenotype of this fusion was
compared to that of the fusion TMIC. The results obtained for the TMI C and
TMIAlinker PilS-La& hybrids suggest that the linker may play a role in the
keeping the Gterminal355 a. a. of PilS inside the cytoplasm. However, the
complementary TMlC and TMl Aiinker PilS-PhoA hybrids are highly unstable
and both exhibit some PhoA activity. Because of the instability of the protein, it is
not clear if the PhoA adivity measured is due to break down products or because
the PilS moiety of the hybrid is capable of driving PhoA into the periplasm. More
constructs in which a number of helices and the linker domain are removed
should be generated and analyzed before confidently assigning a role for the
linker in the insertion process. It would also be of interest to create PilS mutants
in which the fransmitter domain and a number of helices have been removed.
![Page 94: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/94.jpg)
78
This would allow us to investigate the potential role of the hydrophilic transmitter
as a membrane insertion blocker*
Taken together, the data described in this chapter supports and proves the
topological model of PilS predicted by theoretical computer analysis. The
topology of PifS thus consists of a cytoplasmic N-terminus followed by six TM
helices joined by vely short connecting loops, and a large cytoplasmic domain
comprising the linker and transmitter domains.
![Page 95: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/95.jpg)
Chanter 5. ROLE OF THE PilS TM SEGMENTS IN FUNCTION AND
CELLULAR LOCALIZATION
5-1 Results
5.1 .I Construction of the plasmids
Refer to Chapter 3 (materials and methods) for details on the construction of the
plasmids used in this portion of this study and Figure 12 for a diagram
representation of the constructs.
5.1.1.1 The internal helix deletions
A series of thirteen internal helix deletions were designed for this study (pJE680
series) in addition to the intemal deletions previously engineered (pJB200 series)
(Figure 12). These mutant piiS genes are carried on the pMMB vector and their
expression can be induced by addition of IPTG to the growth media. It should be
noted that very low levels of gene expression are observed from the fac promoter
of the pMMB vector even without induction.
5.1.1.2 The pilA promoter fusion
In order to quantitate the activity of the pilA promoter, a transcriptional fusion of
the gfp gene to the pilA promoter was constructed. This fusion is carried on the
pDNI9 vector. which has a very low copy-number. The vector pDNl9 is lncP
![Page 96: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/96.jpg)
80
and encodes Tet resistance, it is therefore compatible with pMMB, which is lncQ
and resistant to Carb.
When expressed in wildtype PAK, the first piM-g@ fusion constructed, pGG103A,
produced insufficient amounts of GFP and fluorescence could not be adequately
measured. To remedy this problem, the translational enhancer TIR (23, 99) was
introduced upstream of the gfp translational start in pGG103A to create pJE4T 1
(Figure 26). The TIR contains a consensus ShinaDalgarno (SD) sequence with
a spacer region that minimizes RNA secondary structure as well as a
translational enhancer sequence from gene1 0 of phage T7. Introduction of the
TIR replaces the native SD sequence. Table 6 shows a comparison of the units
of fluorescence per cell measured with the Wallac VICTOR^" 1480 multilabel
counter. The ff uorescence and absorbance vaIues were normalized against a
growth media control. The presence of the TIR does not substantially affect gfp
expression and Ruorescence when the pilA promoter is absent (pJE47 0).
However, GFP fluorescence is increased by approximately 130% when gfp is
expressed from the pilA promoter with TIR in pJE411 compared to the pGGl03A
without the TlR.
5.11,'1.3 The PilS-GFP fusions
The thirteen mutant piiS genes carrying the various internal helix deletions
described above were fused to g@ to create the pJE670 series (Figure I2). The
![Page 97: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/97.jpg)
87
gfp gene was also fused to the other deletions and to wildtype pilS to create the
pJB700 series (15) (Figure 12).
5.1.2 Cellular localization of the PIIS-GFP hybrid proteins
5.1.2.1 Epifluorescence microscopy of the PilSCFP hybrid proteins
The same piiS genes carrying the internal deletions used in the function study
were translaionally fused to gfp. These PilS-GFP hybrid proteins were
expressed in P. aemginosa and the cellular localization of the hybrids was
assessed by fluorescence microscopy. Controls for the validity of this system as
well as the pJB7OO series of PilS-GFP fusions were analyzed previously (15). To
briefly summarize, full length PilS is anchored to the inner membrane and
specifically localized to the poles of the P. aenrginosa cell (polar localization), but
not in E. coli where it is found on the entire inner membrane (lateral localization).
The negative control caving only GFP (pJB708) or mutant hybrids in which the
TM domain of PiIS has been deleted (pJB724, pJB733, pJB735 and pJB739) are
soluble and uniformly label ~e cell in both E. coli and P. aemginosa. The TM
domain is required for membrane anchoring, but the TM domain and complete
linker region are both necessary for poIar localization. The transmitter domain
does not appear to be involved in polar localization of PiIS.
The thirteen PIIS-GF P fbsions of the plE67Q series were visualized by
fluorescent microscopy. These PilS proteins carry deletions within the TM
![Page 98: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/98.jpg)
82
domain only, their linker and transmitter regions are intact The amount of
protein expressed varied from one hybrid protein to another and consequently,
the fluorescence of the cell varied as well, No differences in cellular localization
ofthe protein or fluorescence intensity were observed between PAK and PAK-
AS2, therefore only microscopy images of the PiIS-GFP proteins expressed in
PAK are shown in Figure 27.
The polar localization of PilS was not affected by the removal of TM1 (pJE675).
TM1-2 (pJE673) or TM14 (pJE672), suggesting that the first helix is not required
for initiation of the insertion process or polar targeting. This observation also
suggests that the last two TMs of PilS are sufficient for anchoring the protein into
the membrane and polar targeting. Plasrnids pJE677, pJE674 and pJE6713
carry deletions ofTM3-4, TM4 and TM4i6, respectively, and these three PilS
deletion proteins also retain their polar localization.
Another mutant, pJE678 carrying a deletion of TM5-6, also shows polar
localization of the hybrid protein, but, as shown in Figure 27H, GFP also labels
the lateral edges of the cell. This suggests that the removal of the last two
helices of the TM domain does not prevent insertion of the protein into the
membrane, but keeps it from being efficiently targeted to the poles of the cell.
Lateral labeling with a polar concentration of fluorescence is also observed for
pJB742 (15). In this construct, the N-terminaI 177 a. a. of PilS have been
![Page 99: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/99.jpg)
replaced by the Male protein; the linker and transmitter of PilS are attached to
the Cteninus of MalG (Figure 12). Male is an integral inner membrane protein
involved in maltose transport in E. colt the entire protein sequence fonns six TM
helices (31).
The cellular localization of the other mutant PilS-GFP fusions was not as easily
evaluated as that of the mutants described above. The six mutants (pJE676,
677,679,6710,671 1 and 6712) clearly lose their ability to drive PilS to the poles
of the bacterial cell, but their localization (soluble or lateral) cannot be clearly
assessed. These six proteins are not expressed as well and thus the cells are
not as fluorescent as the other strains, which rendered the fluorescent
microscopy examination and photography of the bacteria expressing these
proteins more strenuous.
5.1.2.2 Cell fractionation of the non-polar PilSCFP hybrid proteins
To determine the cellular localization of the six non-polar Pits derivatives, cell
fractionation experiments were performed. PAK expressing the six mutant PIIS-
GFP proteins was grown for 18 hours with induction (0.1 mM IPTG). The cells
were harvested, lyzeci by sonication and the-soluble and membrane fractions
were separated. Both fracfions were electrophoresed by SDS-PAGE and the
Western blot was probed with an anti-GFP antibody.
![Page 100: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/100.jpg)
84
Figure 28A shows the results of this experiment Degradation products are
detected in the S fraction, but these bands are equally present for all fusions
tested including pJB7 12 (full length PIIS-GFP) and pJB708 (GFP alone). A band
corresponding to PIS-GFP is obsenred in the S fcaction of the six non-polar
constructs, suggesting that these constructs are found in a soluble form. A weak
but discemable band is also present in the M fraction of pJE676 (lane 3) and
pJE677 (lane 4), which means that the protein may be present in small amount in
the membrane. The other hybrid proteins were not detected in the M fraction,
supporting a soIuble localization of the proteins and the conclusion that removal
of TM2, TM2-4, TM4-6 and TM6 greatly affects the membrane insertion
processes of PiIS.
Only very weak bands are present for pJE6712 (lane 8), suggesting a
considerable defect in expression of this fusion protein. plac, used as a soluble
control for cell fractionation, is expressed from the pMMB vector. The plac band
in the solubk fraction of pJE6712 (Figure 288, bottom right panel, lane 8) is
detected with the same intensity as the fllac band of the constructs (lanes I to 7).
Expression from the vector is therefore equal in all strains and the deficient
expression of Me PPS-GFP of pJE6712 is particular to this strain.
The same OprF and plac contrors used for Pits-LacZ cell Fractionation
experiment were used here with the same results. partition into the M and S
![Page 101: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/101.jpg)
fractions appears to be complete (Figure 28B), except for pJE6712. A band
corresponding to OprF (a membrane-bound protein) is visible in the S fractr*on of
pJE6712, but it is possible that this band may be the result of spill over from the
neighboring lane. No plac band is detected in the M fraction of pJE6712,
suggesting that the separation must have been complete.
It can therefore be concluded that these six deletion mutants, TMIC, TMZC,
TMJC, TMBC, ATM2C and ATM2-4Cr are unable to insert stably into the
membrane and are found primarily in a soluble cytoplasmic form inside the P.
aemginosa cell. Figure 29 shows a summary of the cellular localization data
accompanied by a diagramatic representation ofthe PiiS mutants.
5.1.3 PilS function assays
5.1.3.f Experimental considerations
The internal deletion constructs as well as the negative control pMMB and the
positive control pJB228 (wildtype pilS) were introduced into P. aenrginosa PAK
and PAK-ASZ already carrying pJE411, the pi& promoter@ transcriptional
fusion. The kinase and phosphatase activities reside in the transmitter domain
where the site of phosphorylation (His031 9) and nucleotide-binding motifs are
located. For this reason, mutants in which part or alI of this region have been
deleted were not analyzed for function. The focus was placed on mutants
![Page 102: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/102.jpg)
86
carrying deletions within the TM domain or lacking the linker region to determine
the potential role of these domains in signaling and pilA transcription.
The values of pilA promoter activity are reported as the fluorescence emitted by
GFP per cell (Fluolcell). The GFP fluorescence measured in these strains
correlates to the activity of the pilA promoter in pJE4i 1 and activation from this
promoter is dependent on PilS, therefore fluorescence becomes a measurable
marker of PilS function. No effort has been made to control the levels of pilR
gene expression. Strain PAK-AS2 has an in-frame deletion of p i s so pilR
expression is unaffected by this deletion, PilR is therefore present in the both
strains in wildtype chromosomal amounts and is not a factor in these PilS
function assays.
One series of bacterial cultures of these strains was grown overnight in LB broth
with Carb and Tet and a second series of cultures of the same strains was grown
in media supplemented with 0.5 mM lPTG to induce averexpression of pilS.
Preliminary testing was done on cultures of PAK and PAK-AS2 with 5 different
plasmids (pMMB, pJ8224 p56228, pJB231 and pJB233) grown in the presence
of three different IPTG concentrations, 0.05 mMt 0.1 mM and 0.5 mM to
determine which lPTG concentration should be used in the PiIS function assays.
As shown in Figure 30, any amount of IPTG is enough to induce overexpression
of PilS and similar fluorescence (promoter aa0vity) results are obtained
![Page 103: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/103.jpg)
87
regardless of the concentration of IPTG used. Therefore 0.5 rnM IPTG was
added to the growth media to ensure the excessive production of the PilS
mutants from the tac promoter for the following experiments.
5.1.3.2 Kinase and phosphatase function of mutant PilS
The phosphatase function of PilS is defined experimentally by a reduction in pilin
gene expression in wildtype PAK under induced conditions, i.e. when PilS
(wildtype or mutant) is overexpressed. in the reporter system designed for this
study, positive phosphatase activity is depicted by a reduction in fluorescence of
the PAK strain canying a PilS mutant compared to PAK carrying the pMMB
vector.
In PAK (pMMB), only chromosomal amounts of PilS are present and 7860 i 918
fluorescence units per cell (fluofcell) are measured when the bacteria are grown
with induckon (Figure 37 and Table 7). In the strain carrying wildtype PilS
(pJB228), 819 t 148 fluolcell are measured when PilS is overexpressed, which
represents a reduction of approximately 90% compared to pMMB. A reduction in
fluorescence of approximately 45% is observed for pJB228 even when the
bacteria are grown without induction. SmaB amounts of PilS are still produced
from the fec promoter even under uninduced conditions, indicating that the
phosphatase function of PilS is so strong that even slight overexpression ofthe
protein are sufficient to inhibit gene transcription.
![Page 104: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/104.jpg)
88
Experimentally, the kinase function of PilS is defined as the ability of the protein
(wildtype or mutant) to complement the in-frame pilS deletion in PAK-AS2 leading
to transcription from the pilA promoter. It is measured under either induced or
uninduced conditions. Pilin promoter activity in the strains carrying the PilS
mutants was compared to pMMB (1 103 + 184 fluofcell) for basal promoter activity
levels and cell fluorescence. The value obtained for the strain carrying pJB228
(wildtype piis) (2917 +_ 445 fluofcell) grown under uninduced conditions was
considered as wildtype levels of PilS kinase activity (Figure 32 and Table 8).
Figure 29 summarizes the results obtained for the function assays. The first
striking observation is that only one PilS deletion mutant exhibits both wildtype
kinase (5382 k 787 fIuo/cell, uninduced) and phosphatase (822 t 241 fluofcell,
when overexpressed) activities. This mutant (pJB237) lacks the entire linker
region of PiJS but possesses the complete TM and transmitter domains, implying
that the linker region is not essential for signaling.
The next important observation is that all the other mutants lose one of the two
amities and are locked in one of two signaling states: U+P- or K-P+. Only
pJE686 (.lNllC) and TMSC (pJE6812) exhibit a K+IP- phenotype. However
unlike wildtype PIIS, the kinase fonction is only detectable when the mutant is
induced with a high concentration of IPTG. Plasmids pJE6712 and pJE6812
carry the same PilS mutant (TMSC) and the only difference between the two
![Page 105: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/105.jpg)
89
constructs is the presence of GFP in pJE6712 and both of these construct are
very poorly expressed, as shown by immunoblots for pJE6712 (Figure 28) and by
the faint labeling of pJE6712 with GFP. As concluded from the GFP localization
experiments, both the pJE686 and pJE6812 mutants are found in a soluble form.
For pJE686. this result is not very surprising since the protein only contains one
TM. However for pJE6812 which possesses 5TMs, this observation is startling
considering that pJE688 (containing 4 TMs) is membrane-bound and even
capable of some polar targeting. This suggests that the deletion of TM6 in
pJE6812 generates severe expression. membrane insertion and conformational
defects, hence the unusual functional phenotype (K+/P-) observed cannot be
attributed to changes solely in the TM domain but are likely due to more severe
changes throughout the molecule.
Although protein expression does not appear to be altered in pJE686 (TMIC) as
it is in pJE6812 (TMSC), both proteins present the same functional phenotype
and soluble localization. Also, the pilA promoter activity is virtually the same for
both constructs in both PAK and PAK-AS2 strains (PAK-ASP: 10396 r 947
fluo/cell for pJE686 and 12525 & 1554 fluofcell for pJE6812; PAK: 10663 + 1501
fluotcelI for pJE686 and 1 1018 + 1972 Ruolcell for pJE6812). For these reasons.
it is probable that pJE686 suffers from conformational defects similar to those
hypothesized for pJE6812. it is therefore likely that the functionaI phenotype
![Page 106: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/106.jpg)
90
observed for pJE686 is also the result of conformational defects in other parts of
the molecule and not to an attered TM structure.
The other 12 PilS mutants tested are locked in a K-/P+ signaling state, as judged
by baseline levels of fluolcell measured in PAK-AS2 and highly reduced levels of
fluo/cell in PAK (Figures 31 and 32. Tables 7 and 8). Indeed, for the kinase
function, between 446 + 40 and 1153 k 102 fluofcell are measured for the
mutants in PAK-AS2 when grown without induction compared to the baseline
fluo/cell of 693 c 58 measured for PAK-ASZ (pMMB). On the other hand, for the
phosphatase activity, between 71 1 + 86 and 3481 & 242 fluolcell are measured in
PAK when PilS derivatives are overexpressed, while 7860 k 91 8 fluolcell are
measured in PAK (pMMB) under the same growth conditions. The pilA promoter
activity of the mutant strains is reduced approximately 46% to 91 % compared to
the wiidtype pilA promoter activity in PAK (pMMB), this reduction in pilin gene
expression is also comparable to the 90% redudion observed for pJB228 when
full length PiIS is overexpressed. Although protein expression varies from one
construct to another, the K-/P+ mutants are well expressed and stable. Some of
these mutants are localized to the poles of the cell while some remain soluble.
The mutants carry deletions within the TM domain and one mutant
(~58233) is deleted for the entire TM domain, suggesting that the TM domain is
crucial for activation of the kinase function. The construct lacking the linker but
![Page 107: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/107.jpg)
containing intact TM and transmitter domains (p JB237) retains wildtype kinase
function, supporting the importance of the TM domain in signaling. However, it
does not appear that one particular helix or a specific combination of helices is
required, but rather the whole TM domain is necessary for signaling.
5.2 Discussion
In this portion of the study, the implications of internal helix deletions on the
signaling functions of PilS, as well as the protein's ability to insert stably into the
membrane and to be targeted to the poles of the bacterial cell were investigated.
A series of helix deletions were thus created and the function of the mutant PilS
proteins was assessed by monitoring transcription from the piIA promoter. A piIA
promoter-gfp transcriptional fusion was used as a measurable marker of pilA
promoter activity. The cellular localization of the PilS variants was determined
using translational PIS-GFP and epifluorescence microscopy as well as cell
fractionation experiments.
S i PifS mutants (TMIC, TM2C, TMJC, TMSC, ATM2C and ATM24C) not onIy
lost their abitii to drive PilS to the poles. but were also unable to anchor the
protein into the membrane. These PilS-GFP proteins were also poorly
expressed and not as fluorescent as the membrane-bound PilS variants. It is
possible that the soluble proteins are more susceptibre to protein degradation
![Page 108: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/108.jpg)
92
and proteolysis when away from the inner membrane, thus explaning the lower
levels of fluorescence.
Although six TM are preferred for-stable membrane insertion, the presence of
four TMs suffices to anchor PilS and target it to the poles. As discussed in the
previous chapter, the PilS-Lac2 fusion pJE654 (fusion to TM2) is mainly
membrane-bound, indicating that the first two helices are sufficient to anchor the
protein into the membrane in a relatively stable fashion. However, the presence
of the same two helices in pJE687 (TM1-2 with linker and transmitter) is not
sufficient for membrane protein insertion, possibly because the hydrophilic
domain present in pJE687 interferes with the insertion process. A similar C-
terminal domain interference situation is encountered for TM4 and TM4C. The
PiIS-Lac2 fusion pJE642 is clearly membrane-bound, but when the linker and
transmitter are maintained so that only TM5-6 are deleted, the PilS protein
inserts into the membrane but partly loses its ability to move to the poles.
The Pits variant containing only TM5-6 (plE682) also inserts stably into the
membrane and furthermore is targeted completely to the bacterial poles,
supporting the conclusion that two helices are sufficient for membrane anchoring.
Constructs pJE682 and pJE687 both contain only two helices as well as the
linker and transmitter of PilS and GFP; the only diflerence between the two
constructs being the individual helices (pJE682 has TMS-6, pJE687 has TMI-2).
![Page 109: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/109.jpg)
As mentioned earlier, pJE687 cannot insert stably into the membrane, while
pJE682 inserts very well and is also targeted to the poles. According to €he
program TopPredll, the first TM1 is not as strong a topological determinant as
the other 5 TMs presumably because it contains an Arg residue within the TM
segment (22), while TM5 is ranked as the strongest candidate for membrane-
spanning segment Therefore, while all six TMs are required for kinase
activation, only two TMs (if they are the right two) are required for membrane
insertion and polar localization.
The fact that the removal of the first TM as well as the first two and first four TMs
does not affect membrane integration of the protein leads us to believe that PilS
insertion into the membrane is a non-sequential event and that each signal
peptide segment (?MI, TM3 or TM5) can independently initiate insertion (22.43).
Although experiments to determine the mode of insertion used by PilS have not
been done, we hypothesize that the insertion of PilS into the inner membrane
does not involve the Sec or SRP machinery, but rather is a spontaneous event
driven by the proton motive force. A more complex machinery may not be
needed since the periplasmic loops are so short and devoid of positive charges.
More specificaIIy, we speculate that PilS inserts into the membrane according to
the "helical hairpin" model (44,58). This model states that hydrophobic helices
pair up to form a helical hairpin structure that spontaneously partitions out of the
![Page 110: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/110.jpg)
aqueous cytoplasm into the hydrophobic membrane (Figure 6). In this model,
TM1-2 would insert together, TM34 would form one pair and TM5-6 would form
the third helical hairpin. Because TMI is a weaker export signal than TM3 and
TM5, it is possible that the TM3-4 and TM5-6 pairs target the protein to the
membrane and insert first, the TMI-2 pair would then benefit from the close and
strong membrane association provided by the other twosomes and finally insert
into the membrane. This would explain why pJE682 (TM5-6) is stably inserted
into the membrane and pJE68f (TMI-2) remains soluble or very weakly
associated with the membrane.
The PilS function assays measure the modulating effects of the TMs and linker
on the transmitter. As shown on Figure 29, there is no correlation between the
cellular localization of the PilS mutants and their signaling state. The linker
domain was shown to be essential for polar localization (19, but as
demonstrated here, the linker is not necessary for signal transduction and
wildtype PilS function. The TM domain was also shown to be essential for
membrane anchoring (15), but as shown here, the complete TM domain is not
required for membrane insertion although the presence of the six helices is
optimum for stable polar localization. The kinase activity of the PilS mutants is
not asured by polar location as many polar constructs are K-. To complicate
matters, a fatetally localized mutant containing the intact TM domain (~56237)
exhibits both kinase and phosphatase activity.
![Page 111: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/111.jpg)
The complete TM domain is however essential for wildtype PilS function and
signaling. As summarized in Figure 29, any alterations in the TM domain that do
not cause severe expression or structural defects lock the protein into a K-lP+
signaling state. As well replacing the PilS TM domain with the MalG protein,
which also forms six TM helices, results in a K-/P+ signaling state. This suggests
that the kinase activation signal is specific for PiIS and that MalG is unable to
transduce the signal to the transmitter domain and cause autophosphorylation of
PiIS. However MalG efficiently anchors the protein to the membrane and
furthermore the Male-PilS-GFP (pJB742) protein is partially targeted to the poles
of the cell, strengthening the conclusion that the linker is the principle
determinant of polar localization.
From the data obtained, it can also be concluded that the phosphatase function
of PilS is constitutive and does not depend on an intact TM domain or signaling
event to be induced. The K-/P+ state prevails in the absence of the activating
signal, but when the signal is perceived by the TM domain, a conformational
change occurs in the transmitter domain to activate PilS kinase function and pilA
transcription. This signaling system resembles the Envf-OmpR osmoregulation
system of E- coli (refer to section 2-32. I) in #at the transmitter domain is
present in one of two conformations. In the phosphatase-dominant state ATP is
not accessible to His-319, the phosphorylation site, while in the kinase-dominant
conformation, AT? becomes available and His-319 is phosphorytated.
![Page 112: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/112.jpg)
96
The six TM helices are absolutely required for kinase signaling, which leads us to
believe that the three-dimensional structure formed by the entire TM domain is
necessary for signal perception and transduction to the kinase domain. In this
model, recognition of the signal induces a conformational change in the TM
domain that is transduced through the linker to the transmitter. Intramolecular
interactions (TM-TM, TM-linker, TM-transmitter) needed for signal transduction
from stimulus sensing to response could be impaired by missing helices or non-
inserted TM segments. Because the linker is not required for kinase function, it
excludes this region as the potential signal-sensing domain and rules out the
possibly of two activating signals. Rather, the role of the linker domain is to
promote polar localization of Pits and simply communicate the conformational
modification of the TM domain to the kinase domain. This, however, does not
exclude the possibility that the linker recognizes or interacts with a polar
component It does suggests however that the polar anchor recognized by the
linker is not the kinase activating signal recognized by the TM domain.
Dimerization is a common feature of membranebound sensor kinases and there
are no reasons to believe that PilS does not dimerize, but this phenomenon has
not been studied for PilS and the potential intermolecular interactions between
PilS monomers in an oligomer have not been investigated. It remains therefore a
possibility that the conforrnationaI change referred to above is intermolecuiar
rather than intramdecular, or that the combined TM domains of two PilS
![Page 113: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/113.jpg)
97
monomers form a large 12-helix structure through which the signal is sensed.
Studies should be undertaken to determine if PilS dimerizes and to identify the
dimerization domain. If these studies reveal that PilS dimekes via the TM
domain or a portion of that region, it would indicate that dimerization is necessary
for kinase activity. Therefore missing helices or rnisinsertion of PilS could
interfere with dimer formation or intermolecular interactions.
![Page 114: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/114.jpg)
Chanter 6. CONCLUSlONS AND FUTURE DIRECTIONS
The work presented here was undertaken with the aim of studying the structural
and functional properties of the hydrophobic domain of the P. aenrginosa pilin
gene transcriptional regulator PilS in order to better understand the signal
transduction events leading to activation of pilin gene transcription. Based on the
data shown in this thesis, the following conclusions may be formulated:
1) the N-terminal177 a. a. of PilS form six TM helices;
2) two TMs are sufficient for anchoring PilS into the inner membrane, although
four and six TMs are optimum for anchoring the protein stably into the
membrane;
3) internal helix deletions do not alter the cytoplasmic localization of the G
terminal end of the protein;
4) the six TMs are not necessary, but preferable, for polar localization of PiIS;
5) all six TMs are however absoluteIy required for PilS kinase function, but not
p hosphatase function;
6) polar localization does not guarantee normal kinase function, nor does it
appear to be rbquired for normal kinase function;
7) the polar anchor is not the kinase activation signal.
Other experiments could be done to expand and further support our wndusions
and hypotheses. M would be interesting to determine if PI'IS, or perhaps another
![Page 115: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/115.jpg)
response regulator of PBS, is involved in the mechanisms of protein secretion
across and insertion into the inner membrane and how this new role would relate
to pilin expression and pili production. As well, determining the mode of PilS
insertion into the membrane (Sec-dependent, SRPdependent, helical hairpins)
would allow us to control the insertion mechanism and determine if full length
PilS is functional when entirely cytoplasmic. Also, experiments could be done to
demonstrate the potential role of the hydmphilic segments found in the linker and
transmitter regions as insertion blockers. These segments may work to prevent
translocation of the C-terminus of PilS in an attempt to keep the kinase domain in
the cytoplasm where it can interact with PiIR.
![Page 116: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/116.jpg)
Chanter 7. TABLES AND FIGURES
![Page 117: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/117.jpg)
Table 1. Oligonucleotides used in this study
GTTTCTGTCGGATCCTGGCGCCG
j CCAGCGGATCCTGCTGCGCCTGCTGG
Sequenceb Primer number
C 3
4
I a. a. 123 I CGGGCGCATAGATCTGGTCATCGC
Mutation sitea
I a. a. 123 I GCGATGACCAGATCTATGCGCCCG
a, a. 99
a. a. 529
1 21 I a. a. 49 I GACATGGAACAGATCT GGGTGGACG
GATGCCGCTGGGATCCCCGCCACCTG
GCGGCTTCCGTGGATCCAGmGCGC
I GACCGGCCAGCAGATCTTGCTGCGCCTGC
34 L
Primer number 13
a. a- 304
Primer name
EcoR IATG linker
I? prornotef
corresponding codon is underlined in the sequence column). a. a.: amino acid. The sequences read 5' to 3'. The sequence of the restriction site being
introduced in primers is shown in bold. This primer binds to a sequence of the T? promoter found in the vector. The underlined region in the next column is the enhancer sequence and the
sequence in bold is the Shine-Dalgarno sequence,
GCAGGCGCAGCAAGATCTGCTGGCCGGTC
Seq uenceD
Kpn RBS linker
GATCCATGAATTCATG
TAATACGACTCACTATAGGG
24
25
AATTGACCTCTGGTACCAGAGGTC
a Refers to the last amino acid of PilS before the new restriction site (the
TI orwar ward^
~ l ~ - ~ e v e n e ~
CTAGATGCATGATrAACmATAAGGAGGAA AAACA TATGTTmCCTCCmATAAAGmAATCATGC AT
![Page 118: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/118.jpg)
Table2. Strains and plasmids used in this study
I Strain or p iasmid
P. aemgimsa
PAK
PAK AS2
p Bluescript I SKI!+
Wild type
In frame deletion of pilS, SP
Relevant traits a
~ r n p ~ . broad-host-range cloning vector, lncQ, lacP, ptac
Source or reference
I4mpR, phagemid cloning vector
/4mpR, ~ e n p , cloning vector
~ r n p ~ , superlinker phagemid
~et!, broad-host-range cloning vector, i ncP. plac
phoA lacking its export signal sequence
Promoterless lac2
pi19 promoter in pUCl8
piis with pfac in pMMB67EH
piiS and prlR in p6luescript SKI[+
mutant 2 in pCR2.1
gfp mutant 3 with plac in pUCP22
Stratagene
D. Bradley
(17)
Stratagene
H, Schweizer
P harmacia Biotech
D. Nunn
P harmacia Biotech
J. Boyd
(17) J. Boyd
J. Boyd
![Page 119: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/119.jpg)
I mutant 3 with TIR, with plac in pUCP22
gfp mutant 3 in pDN19, no promoter
gfp from piIA promoter in pGGlO3
gfp mutant 3 with TIR in pDN19, no promoter
gfp with TlR and pilA promoter in pJE410
lacZ lacking its first 8 a. a. with ptac in pMMB67EH
phoA without its signal sequence with ptac in pMMB67EH
gfp mutant 2 with ptac in pMMB67EH
EcoRlATG linker inserted in pJE608
a. a. 1-99 of pilS in pUCP22, KpnRBS linker inserted in the EwRI site
a. a. 1-154 of pilS in pUCP22, KpnRBS linker inserted in the EcoRl site
a. a. 1-177 of pilS in pUCP22, KpnRBS linker inserted in the EcoRI site
a. a. 1304 of piiS in pUCP22, KpnRBS linker inserted in the EcoRl site
Full length piiS in pUCP22, KpnRBS linker inserted in the EcoRl site
same as pJE621 in pBluescript SKI[+
BgllI site at a. a. 123 of pilS in pJE640
EcoRlATG linker inserted in pJE641 in the BglIl site
Bglll site at a. a. 75 of pilS in pJE641
Bg Ill site at a. a. 75 of piiS in pJE640
EcoRlATG linker inserted in pJE646 in the Bglll site
BglII site at a. a 49 of pilS in pJE640
1 G. Gagnon
G. Gagnon
G. Gagnon
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
![Page 120: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/120.jpg)
pJE655 I Bglll site at a. a. 177 of piiS in pJE640 I This study
pJE652E I EcoRlATG linker inserted in pJE652 in the Bglll site
This study
This study
pJE659
pJE660
a. a. 1-491177-529 of pi/S (ATM2-TMG), in p BluescriptSKI I+
pJE661
This study
a. a. 1-751177-529 of pi/S (ATM3-TMG), in pBluescriptSKII+
pJE663
This study
a. a. 1-1 231123-529 of pilS (A TM5-TM6), in pBluescriptSKII+
pJE664
This study
a. a. 1 4911 23-529 of pilS (ATM2-TM4), in pBluescriptSKII+
a. a. 1-99f477-529 of pi/S (ATM&TMG), in I This study pBluescn'ptSKlI+
pJE665
This study
This study
pJE666
pJE696 I a. a. i 49ff 5-1 54 of piis, in pBluescriptSKII+ I This study
a. a. 1 -1 5411 77-529 of pi/S (ATMG), in pBluescn'ptSKII+
This study
This study
a. a. 1-991123-I 541177-529 of pilS (4TM4 and TM6), in pBluescfiptSKII+
This study
pJE804K I a. a. 75-1 54 of piis, in pBluescriptSKII+, KpnRBS linker insetted in the EcoRl site
pJESi0 I Bglll rite at a. a. 305 ofpilS in pJE659 I This study
This study
pJE807K l a. a. 49-154 of pilS, in pBluescriptSKII+. KpnRBS linker inserted in the EcoRI site
This study
pJE811
AmpR, Gene S F , Tep: resistance to ampicillin, gentamicin, streptomycin and tetracycline, respectively. a. a.: amino acid.
a. a. 1-491305529 of prlS. in pBIuescriptSKll+
This study
![Page 121: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/121.jpg)
Table 3. Enzymatic activitf of the PifS-&a& and PilS-PhoA hybrid proteins
I acid I I I fl-galactosidase activity (Miller units)
(-1 --- pJE608 2.0 k 0.2 4.1 + 1.8 6.2 + 1-5
TMI 49 pJE654 0.8 k 0-1 2.8 + 2.3 1.2 + 1.3
Fusion Last PilS Construct site
a The enzymatic activity values are the mean of at least 4 separate experiments c
' amino
TM5 154 pJE628 1.2 k 0.6 4.1 f 2.2 3-9 k 2-1
TM6 1 77 p JE634 43.3 k 4.2 97.9 + 37.5 277.1 + 105.3 linker 3 0 4 p JE638 44.1 + 5.0 323.6 & 72.8 466.5 & 163.0
G 5 29 p JE624 44.8 k 4.5 340.7 + 94.0 405.6 k 164.5 term (+I --* pJE680 8524.4k 16396.1 k 23889.8 &
201 5.1 2405.7 14600.4
standard deviation.
PAK-AS2 E. cdi CC1.10
PAK
Alkaline phosphatase activity (units)
pJE609
p JE653 p JE647 pJE635 pJE643
(-1 TMI TM2 TM3 TM4
--- 49
75 99
123
7.6 t 0-5
62.3 & 18.8
1.2 + 0-5
20.2 & 2.4
1.9 + 0-9
4-9 & 0.5
11-8 k0.9
4.3 & 0.4
10-3 k 0.7
5-0 ,t 0.6
TM5 TM6 linker G
term
1-3 k 0.4
j?1-4 & 34.1
1.7 k 0.3
75.6 k 18.7
2.8 4 0-9
154 177
3 04. 529
pJE629
pJE633 pJE639 pJE623
14.2+0-6
5.4 & 0-4
5.4 k 0.5
4.8 k 0.4
68.0&14-8
4.8 k 0-8
7.2 2 1 -7
7.2 k I -0
27.6 & 7-3
5.0 & 1-6
6-1 k1.2
4.3 +, 0.9
![Page 122: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/122.jpg)
?06
Table 4. Colony phenotype of the fulklength deletion hybrid proteins
N. A. : not applicable
Deletion
(-) TMlC
TM4C
ATM2-4C
A m 4 C
C-term
(-1 TM1C
TM4C
ATM2-4C
ATM4C C-term
Color on Xgal
White
Blue
Blue
Blue
Blue
Blue
N. A.
N, A.
N. A
N, A
N. A.
N. A-
Construct
pJE608
pJE690
pJE692
pJE694
pJE650
pJE624
pJE609
pJE691
pJE693
pJE695
pJE651
pJE623
Color on XP
N. A.
N. A.
N. A.
N, A.
N. A,
N. A,
White
White
White
White
White
White
![Page 123: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/123.jpg)
Table 5. Enzymatic activityl of the PilS-Lad and PiIS-PhoA deletion hybrid proteins
a The enzymatic activity values are the mean of at least 4 separate experiments k standard deviation.
Fusion name
E, coii CC118
Amino acids
removed
PAK Construct
(-1 ATMI
ATMI-2 ATM2
&TM2-4 ~TM304
A T M ~
TMS
(+I
hTM4
TM5
PAK- AS^
p-galactosidase activity (Miller units)
9.3 2 1.3
68.0k14.8
--- 1-49
1-75
50-75
50-154
100- 154 1 24- t 54 154- 529 --_
5.9 t 1.6
27.6 -c- 7.3 L
6.2 -c 1.5
3.1 k 1.5
2-7 ,+ 1-3
5.1 k 2.2
108.6k34.6
3.9 2 1.8
299.7 5 133.9
3.9 k 2.1
23889.8 & 14600-4
1 .O -+ 0.2
0.5 k 0.2
1.0 k 0.5
1.1 + 0.3
11.3t1.2
0.7 k 0.3
41 -2 k 6.6
1.2 k 0.6
8524.4 2 2075.1
pJE608 pJE808 pJE806 pJE698 pJE802 pJE668
p JE658
pJE628
p JE680
L
(-1 ATMI
ATMI -2 A T M ~
ATM2-4 A T M ~ - ~
5-7 -t- 0-7
14.2r0.6
154 124- 154 154
4.1 & 4.8
1 .I 5 0.5
2.5 ,+ 0.9
3.6 & 1.4
106.6215.8
1.2 c 0.1
280.0 + 71 .7
4.2 k 2.2
16396.1 k 2405.7
pJE657
pJE629
Alkaline p hosp hatase activity (units) -I)
1-49
1 -75 50 -75
50-154
4.9 k 0.5
8.8 + 0.7
11 -2 + 1.2
10.7 0.7
4.4 t, 0.5
1 1.4 & 1 .O
pJE609
pJE809 p JE805 p JE697
pJE803
1-3 + 0.4
56.7 +I 3.3
49.9 k 11 -7
79.0 k 17.3
2-8 2 0.7
1 0 0 -
1.6 k 0.5
33.7 k 14.0
15.3 3.5
21-1 a 6.3 1.2 k 1-1
p JE669 68.9 k 19.8 22.3 -t 3.2
![Page 124: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/124.jpg)
Table 6. Effect of the presence of the translational initiation region FIR) on GFP ff uorescence .
Strain and Plasmid
PAK
pGGlO3
pJE410
pGG103A
pJE411
PAK-AS2
pGG103
pJE410
pGGlO3A
p J M ? 1
PromoterKIR
No I No
No / TIR
pilA I No
pilA / TlR
No / No
No / TIR
pilA I No
piIA / TIR
Fluorescence/ cell
m
200.0
252.6
2927.6
6762.6
322.3
248.7
198.2
455.7
![Page 125: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/125.jpg)
109
Table 7. Phosphatase activity of the PilS mutants
a These values represent the activity of the GFP protein expressed from pJE411 and are the mean o f 4 separate experiments k standard deviation. This construct contains the entire linker and transmitter domains of PilS, but the TM domain of PilS has been reptaced by MalG (which comprises 6 TM helices).
A quantitative pilA promoter assay was not performed for this strain, the phosphatase activity was assessed qualiWively by western immunoblot with an anti-PilA antibody.
Construct
pJE681
pJE682
pJE683
plE684
pJE685
pJE686
Fluofcella no lPTG
7895 k 1063
4360 k 1 135
4646 k 1343
6857 k 806
3495 + 830
6978 & 1413
6084 k 941
3939 & 671
5098 a 530
6483 k 1228
7225 k 1036
7602 & 1835
4578 +, 806
2836 k 328
9007 k 806 C
4346 2 806
9065 k 286
Mutation
ATM3-4C
ATM14C
ATTMI-ZC
ATM4C
ATM?C
TMIC
Fluo/cef la 0.5 mM IPTG
1224 + 349
863 a 172
1092 k 102
946 a 160
1417 k254
1 0663 t 1500
888 _+ 66
711 1 8 6
1057 2 183
1069 k 242
3481 k 242
t f 018 k 1972
926 k 203
943 & 121
822 4: 241 C
819 r= 148
7860 kg18
pJE687
pJE688
pJE689
pJE68lO
pJE6811
pJE6812
p JE68 13
pJB233
pJB237
pJB742
pJB228
pMMB
TM2C
TM4C
ATM2C
A T M ~ ~ C
TM3C TMSC
ATM4/6
ATMI-GC
Alinker
MalG:PilS
none
no PilS
![Page 126: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/126.jpg)
110
Table 8. Kinase activity of the PiIS mutants
a These values represent the activity of the GFP protein expressed from pJE411 and are the mean of 4 separate experiments f standard deviation. This construct contains the entire linker and transmitter domains of PiIS, but the
TM domain of PilS has been replaced by MaIG (which comprises 6 TM helices). A quantitative pilA promoter assay was not performed for this strain, €he kinase
activity was assessed qualitativeIy by western imrnunoblot with an anti-Pik anti body.
L
Construct
pJE681
pJE682
pJE683
pJE684
pJE685
p JE686
p JE687
pJE688
pJE689
pJE6810
pJE6811
pJE6812
pJE6813
pJB233
~56237
p56742
pJB228
pMMB
Fluofcella no IPTG
993 t 126
939 + 119 1072 k 81
881 & 70
1418 k471
1601 i 571
1069 +_ 146
819 k48
1012 k 108
973 ,t 60 984 & 102
948 k 203
1043f 224
646 & 71
5382 & 787 c
2917 & 445
1203 s 184
Mutation
ATM3-4C
ATM1-4C
ATMI-2C
ATM4C
ATM1C
TM1C
TM2C
TM4C ATM2C
ATM2-4C
TM3C
TMSC
ATM416
ATMI-GC
linker
MalG:PilS
none
no PiIS
Fluofcella 0.5 mM IPTG
586 k 74
496 k 45
558 k 70
545 + 86
823 + 97
Z 0396 + 947
686 k 256
446 k40
549 & t 95
494 kt 57
1153 + 102 12525k2554
643 t, 123
609 2 48
677 k 92 C
537 + 44
693 k 58
![Page 127: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/127.jpg)
711
Figure 1. Schematic representation of the mechanism of pilA gene transcription
activation. See text for details.
![Page 128: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/128.jpg)
![Page 129: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/129.jpg)
113
Figure 2. Predicted topological model of PiIS. The boxes representing the six
TM segments are numbered 1 to 6. The first and last amino acids of each helix,
as predicted by TopPredIl, is also indicated in the TM boxes. The number above
or below the connecting loops refen to the number of Arg and Lys residues
found in that particular segment.
![Page 130: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/130.jpg)
Periplasrn
n Cyt oplasrn
![Page 131: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/131.jpg)
1?5
Figure 3. Classifcation of inner membrane proteins. The leader peptidase
cleavage site in class I proteins is indicated by the anow. SP: signal peptide; ST:
stop-transfer sequence; USP: uncleaved signai peptide; SST: start-stop-transfer
sequence. This figure was reproduced from (1 53).
![Page 132: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/132.jpg)
w
cytoplasm w
SP&T USP SST Complex
![Page 133: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/133.jpg)
117
Figure 4. Secdependent translocation and insertion mechanism (adapted from
(36)). Step I is the interaction of the nascent polypeptide chain and the
chaperone SecB in the cytoplasm. This complex then interacts with SecA (step
2). After SecB dissociates from the complex, SecA and the polypeptide chain
move to the SecYEG translocon (step 3). ATP binding to SecA and interaction
with SecY stimulates insertion of SecA and the precursor chain into the
membrane (step 4). ATP hydrolysis provides the energy necessary for release of
the preprotein into the translocation channel. Step 5A represents the
translocation of a periplasmic or extracellular protein. The arrow shows the
leader peptidase cleavage site. The proton motive force (Ap) drives the
translocation of the protein across the membrane. Alternatively in step 58, the
proton motive force drives translocation of the preprotein chain until a stop-
transfer sequence is encountered. Repeated cycles of SecA binding to
hydrophobic segments, ATP binding and hydrolysis and insertion and release will
lead to the insertion of the multiple TM segments of polytopic proteins in the
membrane.
![Page 134: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/134.jpg)
Step 3
pedplasm
cytoplasm
![Page 135: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/135.jpg)
119
Figure 5. The signal recognition particle (SRP) pathway. On the right side of the
diagram is the SecB pathway and the SRP pathway is shown on the left side of
the figure. The SRP, ribosome and nascent polypeptide chain complex binds to
its receptor FtsY in the cytoplasm. This complex then interacts with the
membrane, an event accompanied or preceded by GTP binding to SRP and
FtsY. At this stage, the polypeptide chain is able to interact with the SecYEG
translocon and be translocated or inserted into the membrane. Upon GTP
hydroiysis, SRP and F tsY dissociate from each other. This figure was
reproduced from (149).
![Page 136: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/136.jpg)
GDP
![Page 137: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/137.jpg)
121
Figure 6. Sec-independent insertion of the MI 3 prowat protein. Electrostatic
binding of the positive residues of M'I3 procoat brings the protein to the
membrane. The two hydrophobic segments of MI3 procoat then spontaneousIy
insert into the membrane with the help of the membrane electrochemical
potential. The insertion step is followed by cleavage ofthe signal peptide by the
leader peptidase. This figure was reproduced from (161).
![Page 138: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/138.jpg)
![Page 139: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/139.jpg)
123
Figure 7. Theoretical principle of the gene fusion approach to study topology.
The dotted ovals represent a reporter enzyme, either Lac2 or PhoA, fused to a
TM helix (black box). The phenotype expected for a cytoplasmic fusion site is
shown on the left and the phenotype expected for a periplasrnic fusion site is
shown on the right.
![Page 140: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/140.jpg)
Lac2 -ve PhoA +ve
![Page 141: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/141.jpg)
Figure 8. Rationale for €he construction of the fusion plasmids. BamHl
restriction sites are introduced within the piiS gene by PCR mutagenesis and
Bglll sites are introduced by Quikchange mutagenesis. The KpnRBS linker is
inserted in the EcoRl restriction site upstream of pilS, so the pilS fragment can be
cloned into the reporter vectors or on pMMB using Kpnl and BamHl or 89111. The
EcoRlATG linker was inserted into the newly engineered Bglll site of some
plasmids to replace the Bglll site by an EcoRl site and to introduce an ATG start
codon. Using EcoRl and BamHI, the pilS fragment was excised and cloned into
the reporter vectors and pMMB.
![Page 142: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/142.jpg)
![Page 143: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/143.jpg)
127
Figure 9. Diagram of the reporter vectors. The name and size of each plasmid
is indicated next to the circular diagrams. The restriction sites used for cloning
are shown in bold.
![Page 144: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/144.jpg)
EeoRl Sstl Kmi Smal BamH1
pJE608 (1 'I 948 bp)
EcoRl Sstl Kpnl Smal BamHI
pJE609 (10460 bp)
Amp 1
pJE670 (9520 bp)
![Page 145: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/145.jpg)
129
Figure 10. Schematic representation of the PilS-Lac2 and PilS-PhoA hybrid
proteins. Panel A shows a diagram of wildtype PilS with the six TM helices
numbered 1 to 6 and the position of the linker and transmitter regions is
indicated. The various PilS mutants are illustrated in panel B. The name of the
fusion is indicated in the leffmost column (fusion site) and the name of the
plasmid that carries the truncated piiS gene fused to lac2 is indicated in the
central column, while the name of the plasmid carrying the fusion to phoA is
mentioned in the rightmost column. The black circles represent the reporter
enzyme.
![Page 146: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/146.jpg)
B Fusion site
linker pJE638
1 2 3 4 5 6 linker transmitter
![Page 147: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/147.jpg)
131
Figure 'f1. Schematic representation of the PilS-Lac2 and PilS-PhoA deletion
hybrid proteins. Panel A shows a diagram of wildtype PilS with the six TM
helices numbered 1 to 6 and the position of the linker and transmitter regions is
indicated. The various PilS deletion mutants are illustrated in panel B. The
name of the deletion is indicated in the leftmost column and the name of the
plasmid that carries the mutant pilS gene fused to lac2 is indicated in the central
column, while the name of the plasmid carrying the fusion to phoA is mentioned
in the rightmost column. The black circles represent the reporter enzyme.
![Page 148: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/148.jpg)
6
Deletion TM I C
TM 4C
ATM 24C
ATM 4C
ATM 1
ATM 3-2
ATM 2
ATM 2-4
ATM 3-4
ATM 4
TM 1 blinker
1 2 3 4 5 6 linker transmitter
![Page 149: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/149.jpg)
133
Figure 12. Schematic representation of the full-length deletion of PIS and PilS
GFP hybrid proteins. Panel A shows a diagram of wildtype PilS with the six TM
helices numbered I to 6 and the position of the linker and transmitter regions is
indicated. The various Fils deletion mutants are illustrated in panel B. The
name of the deletion is indicated in the leftmost column (fusion site) and the
name of the plasmid that carries the truncated pilS gene fused to gfp is indicated
in the central column. The name of the plasmids in which the mutant piIS gene is
carried in pMMB without fusion to any reporter is indicated in the rig htmost
column. The biack circles represent GF P.
![Page 150: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/150.jpg)
![Page 151: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/151.jpg)
135
Figure 13. Hydrophobicity profile of PilS as determined by the Kyte and Doolittle
scale and a window of 7 amino acids. The six peaks of hydrophobicity are
numbered 1 to 6. The dashed line represents the threshold of hydrophobicity for
formation of a TM helix.
![Page 152: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/152.jpg)
Amino acid position
![Page 153: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/153.jpg)
137
Figure f4. Amino acid sequence of PilS. The underlined segments correspond
to the TM helices as predicted by TopPredll(25), while the sequences shown in
bold represent the TM helices as proposed by TMPred (69). The positively
charged residues Arg and Lys are outlined in blue, while the more moderately
hydrophilic residues Asp, Asn, Gln and Glu are colored in blue. The amino acids
found at the junction of the TM and linker domain (Arg-176) and the junction of
the linker and transmitter domains (Ser-296) are indicated. The site of
p hosphorylation (His-31 9) is also indicated. The fusion sites (Pro-49, Gln-75.
Gly-99, lle-123, Val-154, Gln-177, Gln-304 and Leu-529) are indicated in red.
![Page 154: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/154.jpg)
Val Brg Ala Glu U g L e u U g Leu Ser Glu Glu Gln Gly G l n U g Ile Leu A q Leu T y r His L e u l&g~ Leu Zhr fle G l y L e u V a l Leu V a l Leu Leu IJe Set 88s GLu Leu Glu Asp Gln Val Leu Gym L e u V a l His pro4' G l u Leu Phe H i s V a l Qly Seg T w Cys Z y r Leu Val Phe Ile Leu Val bla Leu Phe L u Pro Pro Ser lLfB ~1x1'' L e u Leu P r o Ile Phe fie Leu Ala L e a 'Phr Asp Val Leu M e t Leu Cys Glp Lmz Phe Tlrr Ala G l y G l y 019' Val Pro S e t
Gly 118 059 S e t Leu Leu V a l Val Ala V a l Ala f le Ala Ada f le L e u Leu BtQ Gly &g 1leU3 OLp Leu V a l Ile Ala M a N a Ala ser Leu O l y Leu Leu P y r L e u T h r Phe Phe Leu Ser Leu Ser Ser Pro Asp A l a Thr Asn His Tyr ~a1"' O l n Ala G l y G l y L e u ( i ly
Zht Leu Cys Phe Ala Ala Ala Leu V a l Ile G l n Ala Leu Val U g ~ln''~ Glu G l n T h r Glu Thr Leu Ala Glu Glu Axg Ala Glu
Thr Val Ala Asn Leu Glu Glu Leu Asn Ala Leu Ile Leu Gln Arg Met Btg Thr Gly Ile Leu Val Val Asp Ser Azg G l n Ala Ile Leu Leu Ala Asn Gln kla kla Leu Gly Leu Leu Arg G l n Asp Asp Val G l n G l y Ala Ser Leu Gly lLIg H i s Ser Pro M e t Leu Met His Cys M e t Lys G l n Trp Axg Leu A8n Pro Ser Leu AEg P r o P r o Thr Leu Lys V a l Val P r o Asp Gly P r o Thr Val Gln Pro Ser Phe Ile Ser Leu Asn k g Glu Asp Asp Gln H i s V a l Leu Ile Phe Leu Glu Asp Ile ~ e r " ~ Gln Ile Ala Gln Gln Ala Gln ~ l n " ' Met S ~ I Leu Ala Gly Leu Gly J k g Leu T h r Ala G l y Ile Ala is"' G l u Ile Apg Asn Pro L e u Gly Ala Ile Ser H i s ALa ma G l n Leu Leu G l n Glu Ser Glu Glu Leu Asp Ala P r o Asp Arg lLPg Leu Thr Gln Ile Ile Gln Asp Gln Ser Lys llPg M e t Asn Leu Val Ile Glu Asn Val Leu Gln L e u Ser Jky Arg lLrg G l n Ala Glu Pro Gln G l n Leu Asp Leu Lya Glu Trp Leu G l n Aeg Phe V a l Asp G l u Tyr Pro Gly &g Leu U g Asn Bep Ser Glu Leu His Leu G l n L e u G l y Ala Gly Asp Ile G l n Thr lltg Met Asp Pro H i s G l n Leu Asn Gln Val Leu Ser Asn Leu Val Gln Asn Gly Leu lLtg Tyr Ser Ala Gln Ala H i s Gly &g Gly G l n V a l T r p Leu Ser Leu Ala Brg Asp Pro Glu Ser Asp Leu Pro V a l Leu Glu ile Ile Asp Asp Gly Pro Gly V a l P r o Ala Asp Lgs Leu Asn Asn Leu Phe G l u Pro Phe Phe Thr Thr G l u Ser &ys G l y T h r Gly Leu Gly Leu Leu Ser %pg Glu Leu Cys Glu Ser Asn G l n AZa Bng fle Asp Tyr lLEgl Asn lLrg Glu Glu G l y G l y Gly Cys Phe lLtg Ile Thr Phe AZa His Pro Arg Lym ~ e u ' ' ~ Ser
![Page 155: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/155.jpg)
139
Figure IS. Western immunoblot of the PilS-Lac2 and PilS-PhoA hybrid proteins
from whole cell lysates of PAK-AS2 (panels A and C) and CC118 (panels B and
D) carrying the fusion plasmids. Panels A and B were probed with an anti-lac2
antibody and panels C and D were probed with an anti-PhoA antibody. Both
antibodies were purchased from 5 Primet3 Prime (Boulder, CO), diluted 1 :I000
and adorbed on acetone powder made €tom PAK-RA (pMMB) to reduce cross-
reactive binding. To better visualize the Lac2 band of the positive control (panels
A and 6, lane 17), half as much sample was loaded in this lane of the gel.
Molecular weight standards are shown on the left. The stars indicate the location
of the hybrid proteins or the expected position of the fusion protein (bands were
visible on other blots after overexposure to X-ray film).
Lane 1: pMMB Lane 2: (-) Lane 3: TMI
Lane4: TMZ Lane 5: TM3 Lane 6: TM4
Lane 7: TM5 Lane 8: TM6 Lane 9: linker
Lane 10: C-term Lane ?I : ATMI Lane 12: ATMI-2
Lane 13: ATM2 Lane 14: ATM24 Lane 15: ATM3-4
Lane 16: ATM4 Lane 17: (+)
![Page 156: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/156.jpg)
![Page 157: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/157.jpg)
141
Figure 16. Qualitative pilin assay in strains carrying the fusions to full length
PIS. PAK-AS2 (for the kinase assay) and PAK (for the phosphatase assay)
carrying the fusion plasmids and the negative (pMMB) and positive (pJB228)
controls were grown overnight in the presence or absence of IPTG. A: kinase
assay. B: phosphatase assay. The bands corresponding to PIS, PilS-Lad,
PilS-PhoA and PilA are indicated by arrows.
Lane I: pJE623, no IPTG Lane 2: pJE623.0.5 mM IPTG
Lane 3: pJE624, no lPTG Lane 4: pJE624. no IPTG
Lane 5: pMMB, no IPTG Lane 6: pMMB, 0.5 mM lPTG
Lane 7: pJB228, no lPTG Lane 8: pJB228, no IPTG
![Page 158: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/158.jpg)
![Page 159: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/159.jpg)
943
Figure I f . Enzymatic activity of the Pits-Lac2 and PiIS-PhoA hybrids in P.
aeruginosa. The assays were performed as described in Chapter 3 and the
values illustrated here and mentioned in Table 3 are the mean of at least 4
separate experiments f standard deviation. A: Bgalactosidase activity of the
PilS-Lac2 proteins. B: Alkaline phosphatase of the PilS-PhoA hybrids. The
black bars represent the activity measured in PAK, while the white ban show the
enzymatic activity measured in PAK-hS2.
![Page 160: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/160.jpg)
1.0 (-1 TMI TM2 TM3 TM4 TM5 TM6 linker C (+)
term
0 -0 - fM1 TM2 TM3 TM4 TMS TM6 IinkerC-term
Fusion site
. . . , /. PAK U PAK-DS2 /
![Page 161: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/161.jpg)
445
Figure 18. Enzymatic activity of the PilS-Lac2 and PilS-PhoA hybrids in E. coli
CCj 18. The assays were performed as deribed in Chapter 3 and the values
illustrated here and mentioned in Table 3 are the mean of at least 4 separate
experiments f standard deviation. A: 8-galactosidase activity ofthe Pits-Lac2
proteins. B: Alkaline phosphatase of the PilS-PhoA hybrids.
![Page 162: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/162.jpg)
0.1 (-1 TMt TM2 TM3 TM4 TM5 TM6 linker C (+)
term
0 -0 (-1 TM1 TM2 TM3 fM4 TM5 TM6 linker C-term
Fusion site
![Page 163: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/163.jpg)
147
Figure 19. Summary of the gene fusion results and topological model of PiIS.
Each fusion site is indicated along with its enzymatic phenotype. The shaded
ovals represent LaWPhoA- phenotypes, while the hatched rectangles
symbolize Lac-/PhoA+ phenotypes. Refer to Table 3 for the results of the
enzymatic assay.
![Page 164: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/164.jpg)
a. a. 304
PhoA -
.- . . - - -. - -
transmitter
a- a- 529 I
PhoA -
![Page 165: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/165.jpg)
149
Figure 20. Enzymatic activity of the fusions TM1, TMIC and TMlAlinker. The
assays were performed as described in Chapter 3 and the values illustrated here
are the mean of at least 4 separate experiments + standard deviation. A: &
galactosidase activity of the PilSLacZ proteins. B: Alkaline phosphatase activity
of the PilS-PhoA hybrids. The black bars represents the activity measured in
PAK, while the white ban show the enzymatic activity measured in PAK-AS2.
![Page 166: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/166.jpg)
I
f
I. PAK U PAK-DS2 I
TMI TMIC
Fusion site / Deletion
![Page 167: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/167.jpg)
151
Figure 21. Western immunoblot of the fusions TM1 (pJ E653/p JE654), TMl C
(pJE690fpJE691) and TMl Alinker (pJE812fpJE813) in PAK (lanes 13) and PAK-
A S 2 (lanes 4-6). Panel A was probed with an anti-Lac2 antibody and panel B
was probed with an anti-PhoA antibody. Molecular weight standards are shown
on the lefL The top band in each lane represents the fusion protein.
Lane 1 : PAK (TM1) Lane 2: PAK (TMI C)
Lane 3: PAK ml Alinker) Lane 4: PAK-AS2 (TM1)
Lane 5: PAK-AS2 (TM1 C) Lane 6: PAK-AS2 (TMl Alinker)
![Page 168: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/168.jpg)
![Page 169: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/169.jpg)
153
Figure 22. Enzymatic activity of the PilS-Lac2 and PilS-PhoA deletion hybrids in
P. aenrginosa. The assays were performed as described in Chapter 3 and the
values illustrated here and mentioned in Table 5 are the mean of at least 4
separate experiments f: standard deviation. A: p-galactosidase activity of the
PilS-Lac2 proteins. B: Alkaline phosphatase of the PilS-PhoA hybrids. The
black bars represents the activity measured in PAK, while the white bars show
the enzymatic activity measured in PAK-AS2.
![Page 170: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/170.jpg)
j B PAK [I PAK-DS2
Deletion
![Page 171: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/171.jpg)
4 55
Figure 23. Enzymatic activity of the PiISLacZ and PilS-PhoA deletion hybrids in
E. coli CC118. The assays were performed as described in Chapter 3 and the
values illustrated here and mentioned in Table 5 are the mean of at least 4
separate experiments + standard deviation. A: P-galactosidase activity of the
PilS-Lac2 proteins. 8: Alkaline phosphatase of the PilSPhoA hybrids.
![Page 172: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/172.jpg)
![Page 173: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/173.jpg)
157
Figure 24. Topological models of the ATM1 and ATM2 deletions as predicted
with TopPredll. The numbering of the TM helices (clear boxes) is the same as in
wildtype PilS. The arrows indicate the site of the fusion to lac2 or PhoA. A: the
N-terminus of the PilSATM1 protein is periplasmic and the topology of the
remaining portion of PilS is unchanged. B: The N-terminus of PilSATM2 remains
cytoplasmic and the segment corresponding to TM3 in wiidtype PilS is fully
translocated into the periplasm and the following TMs inserts into the membrane
in the same way as wildtype PilS.
![Page 174: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/174.jpg)
J . b , I , Periplasi
1111 2
3 4 - 5 6
I.' I\ I Cytoplasm
Periplasm
Cytoplasm
![Page 175: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/175.jpg)
159
Figure 25. Cell fractionation of the PilS-Lac2 hybrids showing positive activity.
The membrane and soluble fractions were separated as described in Chapter 3.
Western immunoblots of each fraction were done in triplicate and one set was
probed with an anti-Lac2 antibody (panel A), another with an anti-Oprf antibody
(panel B, top row) and the last one with an anti-plactamase (plac) antibody (panel
B, bottom row). The top panel in A and the right column in panel B are the M
fraction, while the bottom panel in A and the left column of panel B are the S
fraction. Molecu tar weight standards are shown on the left. The stars indicate
the location of the Pits-Lac2 hybrid proteins. The band corresponding to OprF
and plac in panel B are indicated by arrows.
Lane I : TM2 (pJE648) Lane 2: TM4 (pJE642) Lane 3: TM6 (pJE634)
Lane 4: linker (pJE638) Lane 5: Gterm (pJE624) Lane 6: A T M ~ - ~ (pJE802)
Lane 7: ATM4 (pJE658) Lane 8: (+) (pJE680)
![Page 176: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/176.jpg)
21 5
M fraction
131
![Page 177: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/177.jpg)
761
Figure 26. Sequence comparison of the junction of the pilA promoter and gfp
gene in pGGl03A (top) and pJE41 I (bottom). In both panels, the GFP start
codon is indicated with a blue arrow, the -24 and -12 sequences of the pilA
promoter are underlined, the PiiR binding sites (UAS) are shown in bold, and the
sequences underlined in red are the Shine-Dalgamo (SD) sequences. The
segment highlighted in green in the bottom panel is the translational enhancer
sequence. The sequence that differs between the two constructs is enclosed in
the rectangle.
![Page 178: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/178.jpg)
AAGCTTTCCCTGTCCAGGCTGTTCAGGTCGCAATAGGCGATGCCGAA
TTCTGCACCAGGTGCGTCACCAGCGACAGCTTGTTGCGCTGCGCCTG
CGAGCTGTCGGGACAGACCGCTCAGITGGATGCTGTCGTTCATGGAG
GGGTCTGCCAAATCGGGGGAGTCCGGCTGTCAAAAAGTGTCACATC
-24 -1 2
TAGGCGTTAGGATCC
GFP start
CTGCTCGGCGGACAATTCGGCCAGGGCCAGGCCGCTTACCAGCTTG
TTCTGCACCAGGTGCGTCACCAGCGACAGCTTGTTGCGCTGCGCCTG
AAGGAAATCGCAGAGGGCTATTGAAGTGCCTTATAACGCAGATAACA
CATATGAGT 4 + Enhancer SD
GFP start
![Page 179: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/179.jpg)
163
Figure 27. Epifluorescence microscopy images of the PIS-GFP fusion proteins.
Bacteria (PAK) were grown at 37OC for 2-3 hours in media supplemented with
0.1-0.5 mM IPTG. After an overnigth incubation at 4OC, cells were prepared for
microscopy as stated in Chapter 3. Images were processed and analyzed with
Adobe Photoshop using custom look-up tables.
A:pJE671(ATMWC) B:pJE672(AW?4C) C:pJE673(ATM1-2C)
0: pJE674 (ATM4C) E: pJE6713 (ATM416C) F: pJE676 (TM1 C)
G: pJE677 (TM2C) H: pJE678 (TM4C) I: p JE679 (ATMZC)
J:pJE6710(ATM2-4C) K:pJE6711(TMBC) L: pJE6712 (TMBC)
M: pJB772 (PIS) N: pJB731 (TM6) 0: pJB708 (GFP)
![Page 180: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/180.jpg)
![Page 181: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/181.jpg)
465
Figure 28. Gel[ fractionation of the non-polar PiIS-GFP hybrids. The membrane
and soluble fractions were separated as described in Chapter 3. Western
immunoblots of each fraction was done in triplicate and one set was probed with
an anti-GFP antibody (panel A), another with an anti-OprF antibody (panel B, top
row) and the last one with an anti-plactamase (plac) antibody (panel B, bottom
row). The top panel in A and the right column in panel B are the M fraction, while
the bottom panel in A and the left column of panel B are the S fraction.
Molecular weight standards are shown on the left. The stars indicate the location
of the PilS-GFP hybrid proteins. The band corresponding to OprF and plac in
pane( B are indicated by arrows.
Lane 1 : C-term (pJB712) Lane 2: Am (pJB733)
Lane 3: TM7C (pJE676) Lane 4: TM2C (pJE677)
Lane 5: ATM2C (pJE679) Lane 6: ATM2-4 (pJE67t 0)
Lane 7: TM3C (pJE6771) Lane 8: TMSC (pJE6712)
![Page 182: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/182.jpg)
131 89
M fraction 45
32
431
89 S fraction
45
32
M fraction S ftacfron
![Page 183: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/183.jpg)
Figure 29. Summary of the cellular localization, kinase and phosphatase assay
resuits of the PilS mutants. A schematic representation of wildtype PiIS is shown
in panel A. The name of the deletion as well as a diagram of the PilS mutant is
shown in panel B. The columns on the right side of the figure summarize the
results obtanied from the kinase and phosphatase assays as well as the cellular
location of the PiISGFP hybrids as evaluated by microscopic examination and
cell fractionation experiments. (+) : positive function assay; (-) : negative function
assay.
![Page 184: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/184.jpg)
![Page 185: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/185.jpg)
?69
Figure 30. Testing of the kinase and phosphatase functions of PilS mutants
under different induction conditions. Cells were grown overnight in the presence
of 0.0.0.05,O.l or 0.5 mM IPTG and washed in PBS 20 MgCl2. The absorbance
and fluorescence of an aliquot of washed cells was measured. The pilA
promoter activity is reported as ff uofceli. The vector pMMB is used as a negative
control for background cell fluorescence and pilA promoter activity. Each column
is labeled with the name of the construct as well as the concentration of IPTG
used in the growth media. The result of the phosphatase assay are shown in
panel A and the results of the kinase assay are shown in panel B.
![Page 186: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/186.jpg)
Construct / lPTG concentration
![Page 187: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/187.jpg)
171
Figure 31. Phosphatase assay of the PilS mutants. The piiA promoter activity is
reported as RuolcelI. The vector pMMB is used as a negative control for
background cell fluorescence and pilA promoter activity, pJB228 is used as a
control for wikltype PilS phosphatase function. The black bars indicate the
promoter activity in strain PAK under uninduced conditions; the white bars
represent the promoter activity grown under conditions in which the PilS mutant
tested was overexpressed. Results are the mean of four experrnients + standard
deviation.
![Page 188: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/188.jpg)
![Page 189: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/189.jpg)
173
Figure 32. Kinase assay of the PiIS mutants. The pilA promoter activity is
reported as fluofcell. The vector pMMB is used as a negative control for
background cell fluorescence, pJB228 is used as a control for wildtype PiIS
kinase function. The black bars indicate the promoter activity in strain PAK-AS2
under uninduced conditions; the white bars represent the promoter activity grown
under conditions in which the PilS mutant tested was overexpressed. Results
are the mean of four expennients t standard deviation.
![Page 190: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/190.jpg)
![Page 191: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/191.jpg)
C h a ~ b r 8. LITERATURE CITED
1. Alm, R. A*, and JB S. Mattick. 1997. Genes involved in the biogenesis and
function of t y p e 4 fimbriae in Pseudomonas aemginosa. Gene. 192:89-98.
2. Amsler, C. Dm, and P. Matsumura. 1995. Chemotadc signal transduction in
Escherichia coli and Salmonella typhimurium., p:89-103. in Two-component
signal transduction, J. A Hoch and T. J. Silhavy (ed.), ASM Press, Washington,
D.C.
3. Andenson, H., E. Bakker, and G. von Heijne. 1992. Different positively
charged amino acids have similar effects on the topology of a polytopic
transmembrane protein in Escherichia coli. J Biol Chem. 267:1491-1495.
4. Andersson, H., and G. von Heijne. 1994. Membrane protein topology:
effects of ApH+ on the translocation of charged residues explain the 'positive
inside' rule. EMBO J. 13:2267-2272.
5. Aron, S. K., Be W. Ritchings, E. C. Almin, S. Lory, and R. Ramphal.
1998. The Pseudomonas aemginosa flagellar cap protein. FIiD, is responsible for
mucin adhesion. Infect Immun. 669 000-1007.
6. Anridson, C. G., T. Powers, P. Walter, a d M. So. 1999. Neisseria
gononhoeae PilA is an FtsY homolog. J Bacterial. 181:731-9.
T. Austin, S., and R Dixon. 1992. The prokaryotic enhancer binding protein
NTRC has an ATPase activity which is phosphorylation and DNA dependent.
EMBO J. tf:22'€9-2228-
![Page 192: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/192.jpg)
t 76
8. Ausubel, Fa, R. Brent, Rw Kingston, D. Moore, J. Seidman, and J. Smith.
1990. Current Protocols in Molecular Biology. John Wiley and Sons, New York,
9. Bibi, E., G. Verner, C.-Ye Chang, and H. R w Kaback. 1991. Organization and
stability of a polytopic membrane protein: Deletion analysis of the lactose
permease of Eschefichia coli. Proc. Nail. Acad. Sci. USA 88:7271-7275.
10. Bleves, S., A. Lazdunski, and A. Filloux. 1996. Membrane topology of
three Xcp proteins involved in exoprotein transport by Pseudomonas aemginosa.
J Bacterial. 178:4297-300.
11. Bounet, R B., J. F. Hess, K. A. Borkovich, A. Pakula, and M. I. Simon.
1989. Protein phosphorylation in chemotaxis and two-component regulatory
systems in bacteria. J Biol Chem. 264:7085-7088.
12. Boyd, D., C. Manoil, and J. B~chithw 1987. Determinants of membrane
protein topology. Proc. Natl. Acad. Sci. USA, 84:8525-8529.
f3. Boyd, D., B. Trader, and J. Becfittr. 1993. Analysis of the Topology of a
Membrane Protein by Using a Minimum of Alkaline Phosphatase Fusions. J.
Bacteriot. 175:553-556.
14. Boyd, D., B. frpxler, G. Jande, W. Print, and J. Beckwith. 1993. Gene
fusion approaches to membrane protein topology. Soc Gen PhysioI Ser. 48:23-
37.
15- Boyd, J. M. 2000. Localisation of the histidine kinase, PIS, to the poles of
Pseudomonas aemghosa and identification-of a localisation domain. Mol Micro
(accepted for pu blica80n).
![Page 193: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/193.jpg)
177
16. Boyd, J. M., T. Koga, and S. Lory. 1994. Identification and characterization
of PIIS, an essential regulator of pilin expression in Pseudomonas aenrginosa.
Mol Gen Genet 243565-574.
17. Boyd, J. Ms, and S. Lory. 1996. Dual Functi-on of PilS During Transcriptional
Activation of the Pseudomonas aemginosa Pilin Subunit Gene. J. Bacterial.
178~831-839,
18. Bradley, D. E. 1980. A function of Pseudomonas aenrginosa PA0 polar pili:
twitching motility. Can. J. Microbial. 26:14&154.
19. Broorne-Smith, J w K., S. Gnaneshan, L. A. Hunt, F. Mehnein-Ghomi, 1.
Hashemudeh-Bonehi, M. fadayyon, and E. S. Hennessey. 1994. Cleavable
signal peptides are rarely found in bacterial cytoplasmic membrane proteins
(Review). Mol. Membr. Biol, l I :Me
20. Brunskill, E. W., and K. W. Bayles. 1996. Identification and molecular
characteriration of a putative regulatory locus that affects autolysis in
Staphyococcus aureus. J. Baderiol. 178:6 1 1-6 18.
21. Calamia, J., and C. Manoil. 1990. lac permease of Escherichia coik
topology and sequence elements promoting membrane insertion. Proc Natf Acad
Sci U S A- 87:493741.
22. Calamia, J., and C. Manoil. 1992. Membrane protein spanning segments as
export signals. J Mo( Biol. 22453943.
![Page 194: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/194.jpg)
178
23. Cheng, X, and T. A. Patterson. 1992. Construction and use of lambda PL
promoter vectors for direct cloning and high level expression of PCR amplified
DNA coding sequences. Nucleic Acids Res. 20:4591-8.
24. Chi, E., T. Mehl, D. Nunn, and S. Lory. 1991. Interaction of Pseudomonas
ae~ginosa with A549 pneumocyte cells. Infect immun. 59:822-828.
25. CIaros, Me G., and G. von Heijne. 1994. TopPred 11: an improved software
for membrane protein structure predictions. Cornput. Appl. Biosci. 10:685-686.
26. Comolli, J. C., A. R. Hauser, L. Waite, C. 6. Whitchurch, J. S. Mattick,
and J. N. Engel. 1999. Pseudomonas aemginosa gene products PilT and PiIU
are required for cytotoxicity in vitro and virulence in a mouse model of acute
pneumonia. Infect lmmun. 67:3625-3630
27. Comolli, J. C., L. L Waite, K Em Mostov, and J. N. Engel, 1999. Pili
binding to asialo-GM1 on epithelial cells can mediate cytotoxicity or bacterial
internalization by Pseudomonas aemginosa. lnfect immun. 67:3207-3214.
28. Cometle, J. L., K. B. Cease, He Mrgalit, J. L. Spouge, J. A. Benofsky,
and C. DeLisi. 1 987. Hydrophobicity scales and computationaI techniques for
detecting amphipathic structures in proteins. J. Mol. Biol. 195:659-685.
29. Dalbey, R. E m 1990. Positively charged residues are important determinants
of membrane protein topology. Trends Biochem Sci. 15253-7.
30. Darzins, Am, a d M. A Ru~~ellm 1997. Molecular genetic analysis of type4
piIus biogenesis and Witching motility using Pseudomonas aemginosa as a
mode[ system- a review. Gene. 192: 1 09-1 1 5.
![Page 195: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/195.jpg)
179
31. Dassa, E m , and So Muir. 1993. Membrane topology of MalG, an inner
membrane protein from the maltose transport system of Escherichia coli. Mot.
Microbiol. 7~29-38,
32. Davies, .Im, A. Dewar, A. Bush, T. Pitt, D. Gruenert, Dm M. Geddes, and Eo
W. F. W. Alton. 1999. Reduction in the adherence of Pseudomonas aemginosa
to native cystic fibrosis epithelium with anti-asialoGM1 antibody and
neuraminidase inhibition. Eur. Respir. J. 13:565-570.
33. De Gier, J.=W. L., P. A. Scotti, A. Saaf, Q. A. Valent, A. Kuhn, and J o
Luirink. 1998. Differential use of the signal recognition particle translocase
targeting pathway for inner membrane protein assembly in Escherichia coli. Proc.
Natl. Acad. Sci. USA, 95:14646-14651.
34. De Gier, J.-W. L., Q. A. Valent, 0. von Heijne, and J. Luin'nk. 1997. The
E. coli SRP: preferences of a targeting factor. FEBS Let 408:l-4.
35. Degli Esposti, M., M. Crimi, and G. Venturoli. 1990. A critical evaluation of
the hydropathy profile of membrane proteins. Eur. J. Biochem. 190:207-219.
36. den Bbauwen, f., and A. J. M. Driessen. 1996. Sec-dependent preprotein
translocation in bacteria. Arch. Microbiol. 165~1-8.
37. DiMango, Em, H. J. Zar, R. Bryan, and A. Prince. 1995. Diverse
Pseudomonas aenrginosa Gene Products Stimulate Respiratory Epithelia1 Cells
to Produce Interfeukin-8- 3. Clh- Invest 96:2204-2210-
![Page 196: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/196.jpg)
180
38. Doig. P., T. Todd, P. A. Sastry, K. K. Lee, R. S. Hodges, We Paranchych,
and R T. Iwin. 1988. Role of pili in adhesion of Pseudomonas aeruginosa to
human respiratory epithelial cells. Infect Immun. 56: 1641 6.
39. Doring, G., M. Maier, E. Multer, Ze Bibi, B. Tummler, and A. Kharazmi.
1987. Virulence factors of Pseudomonas aeruginosa. Antibiot Chemother.
39:136-148.
40. Duong, F., and W. Wickner. 1998. Seutependent membrane protein
biogenesis: SecYEG, preprotein hydrophobicty and translocation kinetics control
the stop-transfer function. EMBO J. 17:696705.
41. Dziejman, M., and J. J. Mekalanos. 1995. Two-component signal
transdudon and its role in the expression of bacterial virulence facton., p:305-
317. in Two-component signal transduction, J. A. Hoch and T. J. Silhavy (ed.),
ASM Press, Washington, D.C.
42. Egger, L. A., H. Park, and M. Inouye. 1997. Signal transduction via the
histidylasparty1 phosphorelay. Genes Cells. 2: 2 67-1 84.
43. Ehnnann, Me, and J. Beckwith. 1991. Proper insertion of a complex
membrane protein in the absence of its amino-terminal export signal. J. Biol.
Chem. 266:16530-16533.
44. Engelman, 0. M., and T. A. Steitz. 1981. The spontaneous inserbion of
proteins into and across membranes: the helical hairpin hypothesis. Cell. 23:411-
422-
![Page 197: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/197.jpg)
181
45. Engelman, D. M., Tm A. Steitz, and A. Goldman. 1986. ldentirying nonpolar
transbilayer helices in amino acid sequences of membrane proteins. Ann. Rev.
Biophys. Biophys. Chem. 15:321-353.
46. Fan'nha, I. A., B. D. Conway, L. M. G. Glasier, ND W. Ellert, R. T. Iwin, R.
Sherburne, and W. Panmchych. 1994. Alteration of the pilin adhesin of
Pseudomonas aemginosa PA0 resub in normal pilus biogenesis but a loss of
adherence to human pneumocyte cells and decreased virulence in mice. Infect.
tmrnun. 62:4118-4123.
47. Fasman, G. Dm, and W. A. Gilbert 1990. The prediction of transmembrane
protein sequences and their conformation: an evaluation. Trends Biochem. Sci.
t5:89-92.
48. Fekkes, P., and A. J. M. Driessen. 1999. Protein targeting to the bacterial
cytoplasmic membrane. Microbiol. Mol. Biol. Rev. 63:161-173.
49. Feldman, M., Re Bryan, S. Rajan, L. Scheffler, S. Bnmnert, H. Tang, and
A. Prince. 1998. Role of flagella in pathogenesis of Pseudomonas aemghosa
pulmonary infection. Infect lrnmun. 66:43-51.
50. Fick, R. B. (ed). 1993. Pseudomonas aemginosa the opportunist
pathogenesis and disease CRC Press, Boca Raton, Fla
St. Finck-Barbancon, V., J. Goranson, L.-Zhu, T. Sawa, J. P. Wiener-
Kronish, S. M. Fieiszig, C. Wu, L. Mende-Mueller, and D. W. Frank. 1997.
ExoU expression by Pseudbmonas aemginosa correlates with acute cytotoxicity
and epithelial injury. Mol. Microbiol. 25:547-57.
![Page 198: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/198.jpg)
182
52. f leiszig, S. M., J. P. Wener-Kronish, H. Miyazaki, V. Vallas, K. E.
Mostov, D. Kanada, T. Sam, T. S. Yen, and D. W. Fnnk. 1997. Pseudomonas
aemginosa-mediated cytotoxicity and invasion correlate with distinct genotypes
at the loci encoding exoenzyme S. Infect. Immun. 65~579-586.
53. Fleiszig, S. M., T. S. Zaidi, E. L. Fletcher, M. J. Preston, and 0. B. Pier.
1994. Pseudomonas aenrginosa invades corneal epithelial cells during
experimental infection. Infect Immun. 62~3485-3493.
54. Forest, K. T., and J. A. Tainer. 1997. Type4 pilus-structure: outside to
inside and top to bottom- a minireview. Gene. 192~165-169.
55. Fnnk, D. W. 1997. The exoenzyme S regulon of Pseudomonas aemginosa.
Mol. Microbial. 26:62'l-629,
56. Filrste, J. P., W. Pansegrau, R. Fnnk, H. Bloecker, P. Scholz, M.
hgdasarian, and E. Lanka. 1986. Molecular cloning of the plasmid RP4
primase region in a multi-host-range tacP expression vector. Gene. &:I 19-131.
57. Fussenegger, M., To Rudel, R. Barlien, Ro Ryll, a d T. F. Meyer. 1997.
Transformation w m petence and t y p e 4 pilus biogenesis in Neisseria
gononftoeae - a review. Gene. f92: 125-1 34.
58. Gafvelin, G., and G. von Heijne. 1994. Topological ''frustration" in
multispanning E coli inner membrane proteins, Cell. 77:401412.
59. Gilligan, P. H- 1991. Microbiology of airway disease in patients with cystic
fibrosis- CIin- Microbioi. Rev. 435-51-
![Page 199: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/199.jpg)
183
60. Govan, Jo R., and V. Deretic. 1996. Microbial pathogenesis in cystic
fibrosis: m ucoid Pseudomonas ae~ginosa and Burkholderia cepacia. Micro bio l
Rev. 60:539-574.
61. Grimwood, K 1992. The pathogenesis of Pseudomonas aemginosa lung
infections in cystic fibrosis. J. Paediatr. Child Health. 28:4-11.
62. Hauser, A. Rey and J. N. Engel. 1999. Pseudomonas aemginosa induces
Type-Ill-secretion-mediated apoptosis of macrophages and epithelial cells. Infect
Immun, 67:5530-5537.
63. Hauser, A. Re, S. Fleiszig, P. J. Kang, K Mostov, and J. N. Engel. 1998.
Defeds in type Ill secretion correlate with internalization of Pseudomonas
aemginosa by epithelial cells. Infect. Immun. 66:'I413-1420.
64. Heinrich, D. W., and A. C. Glasgow. 1997. Transcriptional regulation of
type 4 pilin genes and the site-specific recombinase gene, piv, in Moraxella
lacunata and Momella bovis. 3 Bacterial, 479:7298-7305.
65. Hidaka, Y., He Park, and M. Inouye. 1997. Demonstration of dimer
formation of the cytoplasmic domain of a transmembrane osmosensor protein,
EnvZ, of Escherichia coli using Ni-histidine tag affinity chromatography. FEBS
tetters. 400:238-242.
66. Hobbs, M., E. S. R Collie. P. D. Free, S. P. Livingston, and J. S. Mattick.
1993. Pits and PIIR, a No-wmponenttranscriptionaI regulatory system
controlling expression of type 4 firnbriae in Pseudomonas aemginosa. Moi.
Microbial, 7:669-682.
![Page 200: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/200.jpg)
2 8 4
67. Hobbg, M., and J. S. Mattick. 1993. Common components in the assembly
of type 4 fimbriae, DNA transfer systems, filamentous phage and protein-
secretion apparatus: a general system for the formation of surface-associated
protein complexes. Mol. Microbial. 10:233-243.
68. Hoffman, C. S., and A. Wright 1985. Fusions of secreted proteins to
alkaline phosphatase: An approach for studying protein secretion. Proc. Natl.
Acad. Sci. USA. 8251 07-51 4 I,
69. Hofmann, K., and Wm Stoffel. 1993. TMBASE - A database of membrane
spanning protein segments. Biol. Chem. HoppeSeyler. 374:166
70. Hoiby, N., G. Doring, and P. 0. SchiotL 1987. Pathogenic mechanism of
chronic Pseudomonas aenrginosa infections in cystic fibrosis patients. Antibiot.
Chernother; 39:60-76.
71. Hsing, W., F. Dm RUSSO, K. K. Bemd, and T. J. Silhavy. 1998. Mutations
that alter the kinase and phosphatase activities of the twocomponent sensor
EnvZ. 3. Bacteriot. 180:4538-4546.
72. Hsing, W., and T. J. Silhavy. 1997. Fundion of conserved histidine-243 in
phosphatase activity of Envf, the sensor for porin osmoregulation in Eschenichia
CU\~ J, Bacterial, 179:3729-3735,
73. [rani, V. R., and J m J. Rowe. 1997. Enhancement of transformation in
Pseudomonas aefugiinosa PA01 by Mg2+ and heat Biotechniques. 22:54-56,
74. twin, R Y., P. Doig. K. K Lms P. A. Sastry, W. Paranchych, T. Todd, and
R S. Hodges. 1989. Characterization of the Pseudomonas ae~gimsa pilus
![Page 201: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/201.jpg)
185
adhesin: confirmation that the pilln structural protein subunit contains a human
epithelial cell-binding domain. Infect lrnmun. 57:3720-3726.
75. lshimoto, K. S., and S. Lory. 1 989. Formation of pilin in Pseudomonas
aeruginosa requires the alternative sigma factor (RpoN) of RNA polymerase.
?roc Natl Acad Sci U S A, 86:1954-1957-
76. Ishimoto, K. S., and S. Lory. 1992. Identification of pilR which encodes a
transcriptional activator of the pilin gene in Pseudomonas aerughosa. J.
Bactenol, 174~35 14-3521.
77. Jahnig, F. 1990. Structure predictions of membrane proteins are not that
bad. Trends Biochern, Sci. 15:93-95.
78. Jennings, U L 1989. Topography of membrane proteins. Ann. Rev.
Biochern, 58~999-f 027.
79. Jin, S., K. S. Ishimoto, and S. Lory. 1994. PiIR, a transcriptional regulator
of p iliation in Pseudomonas aenrginosa, binds to a cis-acting sequence upstream
of the pilin gene promoter. Mol. Microbial. f4: 1 049-1 057.
80. Kallstrom, H., M. S. bhm, P.4. Berggren, and A.-B. Jonsson. 1998. Cell
signaling by the type N pili of pathogenic Neissena. J. Biol. Chem. 273:2177?-
21782.
8t. Kamberov, E. S., M. R. Atkinson, P. Chandnn, and A. J. Ninfr. 1994.
Effect of mutations in Eschen'chia coliglnL (nbg), encoding nitrogen regulator II
(NRII or NtrB), on the phosphatase activity involved in bacterial nitrogen
regulation. J. Biol. Chem. 269:28294-28299:
![Page 202: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/202.jpg)
186
82. Kramer, G., and V. Weiss. 1999. Functional dissection of the transmitter
module of the histidine kinase NtrB in Eschenchia coli, Proc. Nail. Acad. Sci.
USA. 96:604-609.
83. Kyte, J., and R F* Dooliffle. 1982. A simple method for displaying the
hydropathic character of a protein. J Mol Biol. 1573 05-32.
84. Lee, C., P. Li, H, Inouye, E. R Brickman, and J. Beckwith. 1989. Genetic
studies on the inability of bgalactosidase to be translocated across the
Eschenchia coli cytoplasmic membrane. J. Bacterial. 171 ~4609-4616.
85. Lee, KO K, H. 8. Sheth, W. Ye Wong, R. Sherbume, W. Pannchych, R. S.
Hodges, C. A. Lingwood, H. Krivan, and R f. Irvin. W94. The binding of
Pseudomonas aeruginosa pili to glycosphingolipids is a tipassociated event
involving the GterminaI region of the structural pilin subunit Mol Microbiol.
11:705-713.
86. Linr, G., S. Jarraud, G. Ji, T. Greenland, A. Pednu, J. Etienne, R. P.
Novick, and f. Vandenesh. 1998. Transmembrane topology and histidine
protein kinase activity of AgrC, the agr signal receptor in Sfaphylococcus aureus.
Mol. Microbiol. 28:655-662,
87. Lory, S., and M. S, Strom. 1997. Structureknction relationship of type-l\l
prepilin peptidase of Pseudomonas aenrginosa- a review. Gene. 1929 1 7-121.
88. Lu, HA., S. T. Motley, and S. Lory. 1997. Interactions of the components
of the general secretion pathway: role of Pseudomonas ae~ginosa type 1V pilin
![Page 203: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/203.jpg)
subunits in complex formation and extracellular protein secretion. Mol. Microbiol.
25:247-259.
89. Mahenthinlingam, Em, Ma Em Campbell, and D. P. Speeh 1994.
Nonmotility and phagocytic resistance of Pseudomonas aenrginosa isolates from
chronically colonized patients with cystic fibrosis. infect irnmun. 62596-605.
90. Maniatis, T., E. F. hitsch, and J. Sambrook. 1982. Molecular cloning: a
laboratory manual. cold'spring Harbor Laboratory, Cold Spring Harbor, NY.
91. Manoil, C. 1991. Analysis of Membrane Protein Topology Using Alkaline
Phosphatase and p-Galactasidase Gene Fusions. Methods Cell Biol. 3461-75.
92. Manoil, C., and J. Beckwith. 1986. A Genetic Approach to Analyzing
Membrane Protein Topology. Science. 233:1403-1408.
93. Manoil, C., D. Boyd, and J. Beckwith. 1988. Molecular genetic analysis of
membrane protein topology. Trends Genet 4223.226.
94. Manoil, C., and B. Traxler. 1995. Membrane protein assembly: genetic,
evolutionary and medical perspectives. Ann. Rev. Genet 299 31-1 50.
95. Marty, N., C. Pasquier, J.-L. Dournes, K. Chemin, F. Chavagnat, M.
Guinand, G. Chabanon, 6. Pipy, and H. Montrozier. 1998. Effects of
characterised Pseudomonas aenrgiiosa exopolysaccharides on adherence to
human tracheal cells- J. Med. Microbiol, 41:129-134.
96. Matsumoto, G., T. Yoshihisa, and K. lto. 1997. SecY and SecA interact to
allow SecA insertion and protein translocation across the Eschenchia coli plasma
membrane. EMBO J, 16:6384-6393,
![Page 204: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/204.jpg)
188
97. Mattick, J. S., C. B. Whitchurch, and R A. Alm. 1996. The molecular
genetics of type-4 fimbriae in Pseudomonas aeruginosa - a review. Gene.
1?9:147-155.
98- Y iller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY.
99. Miller, W. G,, and S. E. Lindow. 1997. An improved GFP cloning cassette
designed for prokaryotic transcriptional fusions. Gene. 191:149-153.
100. Mizuno, T., and S. Mizushima. 1990. Signal transduction and gene
regulation through the phosphorylation of two regulatory components: the
molecular basis for the osmotic regulation of the porin genes. Mol. Microbial.
4:j 077-1 082,
101. Muhlebach, M. S., P. W. Stewart, M. W. Leigh, and T. L. Noah. 1999.
Quantificauon of inflammatory responses to bacteria in young cystic fibrosis and
control patients. Am. J. Respir. Clit. Care Med. t60:186-191.
102. Newitt, J. A., N. D. Ulbnndt, and H. D. Bemstein. 1999. The structure of
multiple polypeptide domains debmines the signal recognition particle targeting
requirements of Escheflchia coli inner membrane proteins. J. Bacterial.
181 ~4561-4567.
f03. Ninfa, E. G., Me R. Atklnson, E. S. Kamberov, and A. J. Ninfi. 1993.
Mechanism of autophosphorylation of EscheHchhia ccoli nitrogen regulator I1 (NRII
or NtrB): frans-phosphorylation between subunits. J. Bacteriol. 175:7024-7032.
![Page 205: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/205.jpg)
189
104. Nunn, D. N., and S. Lory. 1991. Product of the Pseudomonas aemginosa
gene pilD is a prepilin leader peptidase. Proc. Natl. Acad. Sci. USA. 88:3281-
3285.
105. Ohta, N., f. Lane, E. G. Ninfa, J. M. Sommer, and A. Newton. 1992. A
histidine protein kinase homologue required for regulation of bacterial cell
division and differentiation, Proc. Natl. Acad. Sci- USA. 899 0297-1 0301.
106. Ouchane, S., and S. Kaplan. 1999. Topological analysis of the membrane-
localized redox-responsive sensor kinase PrrB from Rhodobacter spaeroides
2.4.1. J. bid. Chem. 274: 1 7920-1 7296.
107. Park, H., and M. Inouye. 1997. Mutational analysis of the linker region of
Envf, an osmosensor in Eschenchia COIL J Bacterial. 179:4382-4390.
108. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in
bacterial signaling proteins. Annu. Rev. Genet 26:71-112.
109. Pasloske, B. L, D. S. Drummond, L. S. Frost, and W. Paranchych.
1989. The activity of the Pseudomonas aenrginosa pilin promoter is enhanced by
an upstream regulatory site. Gene. 81 :25-34.
1 Pier, G. B., M. Grout, T. S. Zaidi, and J. B. Goldberg. 1996. How mutant
CFTR may contribute to Pseudomonas aenrginosa infection in cystic fibrosis. Am
.J. Respir-Clit Care. Med. S175S182.
1tI. Plotkowski, M. C., A. M. Saliba, S. H. Pereira, M. P. Cewante, and L. 0.
Bajoiet 1994. Pseudomonas aenrginosa selective adherence to and entry into
human endothelial cells, Infectlmmun. 625456-5463.
![Page 206: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/206.jpg)
1 90
2 . Ponnuswamy, P. K., and M. M. Gromiha. 1993. Prediction of
transmem b rane helices from hydrophobic characteristics of proteins. I nt J.
Peptide Protein Res. 42:326-341.
113. Porter, S. C., A K. North, A. 6. Wedel, and S. Kutsu. 1993.
Oligornerkation of NtrC at the ginA enhancer is required for transcriptional
activation, Genes Dev, 7:2258-2273.
114. Pratt, L. Am, and 1. J. Silhavy. 1995. Porin regulation of Escherfchia colf.,
p:105-127. in two-component signal transdudon, J. A. Hoch and T. J. Silhavy
(ed.), ASM Press. Washington, D. C.
115. Prinz, W. Am, D. H. Boyd, M. Ehnnann, and J. Beckwith. 1998. The
protein translocation apparatus contributes to determining the topology of an
integral membrane protein in Escherichia coli. J. Biol. Chem. 273:8419-8424.
1t6. Pugsley, A. P. 1993. The complete general secretory pathway in gram-
negative bacteria. Microbiol Rev. 57:50-108.
I ? Ramphal, R., 5. K Arora, and B. W. Ritchings. 1996. Recognition of
mucin by the adhesin-flagellar system of Pseudomonas aeruginosa. Am. J.
Respir. Crit Care Med. 154:S170S174.
11L Ramphal, Re, C. Guay, and 0. B. Pier. 1987. Pseudomonas aenrginosa
adhesins for tracheobronchia[ mucin. Infect Immun, 55:600-603.
119. Ramphal, R., L. Koq K. S. bhimoto, P. A. Totten, J. C. Lam, and S.
Lory. 1991. Adhesion of Pse~~domonas aemgimsa pilhdeficient mutants to
mucin. Infect Immun. 59:1307-'I 31 I,
![Page 207: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/207.jpg)
191
120. Ramphai, R., J. C. Sadoff, M. Pyle, and J. D. Silipigni. 1984. Role of pili
in the adherence of Pseudomonas aemginosa to injured tracheal epithelium.
Infect. Immun, 44~38-40.
2 Reithmeier, R. A. 1995. Characterization and modeling of membrane
proteins using sequence analysis. Curr Opin Struct Biol. 549 1-500.
122. Roy, C. R, and R. R. Isberg. 1997. Topology of Legionella pneumophilia
DotA: an inner membrane protein required for replication in macrophages. Infect
lrnrnun. 65573-578.
123. Russel, M. 1998. Macromolecular assembly and secretion across the
bacterial cell envelope: Type II protein secretion systems. J. Mol. Biol. 279:485-
499.
124. Saier, M. J. 1994. Bacterial sensor kinasehesponse regulator systems: an
introduction. Res Microbiol. 145:349-355.
125. Saiman, L., and A. Prince. 1993. Pseudomonas aemginosa pili bind to
asialoGMl which is increased on the surface of cystic fibrosis epithelial cells. J.
Clin, invest, 92: 1875-1 880.
126. Salyets, A. A., and Dm D. Whitt. 1994. Pseudomonas aenrginosa., p:260-
270. in Bacterial pathogenesis: a molecular approach, A. A. Salyen and D. D.
Whitt (ed.), ASM Press, Washington, D.C.
127. SchaR P. J., and J. Beckwith. ? 990. Genetic analysis of protein export in
Escften'chia coli. Annu Rev Genet 24215-248.
![Page 208: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/208.jpg)
192
128. Sheth, H. B., K. K. Lee, W. Y. Wong, G. Srivastava, 0. Hindsgaul, RD S.
Hodges, W. Pannchyth, and R f. Iwin. 1994. The pili of Pseudomonas
aenrginosa strains PAK and PA0 bind specifically to the carbohydrate sequence
beta GalNAc(l4)beta Gal found in glywsphingolipids asialo-GM1 and asialo-
GM2. Mol Microbiol. I I ~715-723.
129. Shiau, S.-P., P. Chen, and L. J. Reitzer. 1993. Effects of insertions and
deletions in glnG (ntrC) of Eschenchia coli on nitrogen regulator ldependent
DNA binding and transcriptional activation. J. Bacteriol. 1?5:190-199.
130. ShingIer, V. 1996. Signal sensing by m e p e n d e n t regulators:
derepression as a control mechanism. Mol. Microbiol. 19:409-416.
131. Simpson, D. A., R. Ramphal, and S. Lory. 1992. Genetic analysis of
Pseudomonas aeruginosa adherence: distinct genetic loci control attachment to
epithelial cells and mucins. Infect immun. 60:3771-3779.
132. Speert, D. P., B. A. &oh, D. A. Cabrol, and I. E. Safit. 1986. Nonopsonic
Phagocytosis of Nonmucoid Pseudomonas aenrginosa by Human Neutrophils
and Monocyte Derived Macrop hages Is Correlated with Bacterial Pitiation and
HydrophobicityD Infect immun. 53:207-212.
133. Spiess, M. 1995. Heads or tails-what determines the orientation of
proteins in the membrane. Febs Let 369:76-9.
I34. Stock, J. B.. A. J. NinfP, and A. M. Stock. 1989- Protein phosphorylation
and regulation of adaptive responses in bacteria. Microbiol Rev. 53:450-490.
![Page 209: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/209.jpg)
193
135. Stock, J. B., M. G. Surette, M. Levit, and P. Park. 1995. Two-component
signal transduction systems: structu re-function relations hips and mechanisms of
catalysis., p:25-51. in Two-Component Signal Transduction, J. A. Hoch and T.
J. Silhavy (ed.), ASM Press, Washington, D.C.
136. Stone, B. J., and Y. Abu Kwaik. 1999. Natural competence for DNA
transformation by Legionella pneumophila and its association with expression of
type IV pili. J. Bacterial. t 81 :I 395-1400.
137. Strom, I. S. 1992. Analysis of determinants of pilus biogenesis in
Pseudomonas aeluginosa. Doctoral Thesis. University of Washington.
138. Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of the
type n/ pis. Annu. Rev. Microbiol. 47565-596.
139. Taha, M. Ks, B. Dupuy, W. Saun'n, M. So, and C. Marchal. 1991. Control
of pilus expression in Neisseria gonorrhoeae as an original system in the family
of t w ~ ~ ~ ~ m p o n e n t regulators. Mol Microbiol. 5:137-48.
140. Taha, M. K., Me So, He S. Seifert, E. Billyard, and C. MarchaI. 1988. Pilin
expression in Neisseria gononhoeae is under both positive and negative
transcriptional control. EMBO J. 7~4367-4378.
14f. Tang, HDr M. Kays, and A. Prince. 1995. Role of Pseudomonas
aemginosa pili in acute pulmonary infection: Infect lmmun. 63:1278-1285.
142. Taylor, 6. L., and I. B. Zhulin. f999. PAS domains: internal sensors of
oxygen. redox potential, and light Microbiol Mol Biol Rev. 63:479-506.
![Page 210: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/210.jpg)
1 94
143. Tokishita, S., A. Kojlma, and f. Mizuno. 1992. Transmembrane signal
transduction and osmoregulation in Eschedchia coli: functional importance ofthe
transmembrane regions of the membrane-located protein kinase, EnvL J.
Biochem. 111:707-713.
244. Tokishita, S., and T. Mizuno. 1994. Transmembrane signal transduction
by the Escherichia coli osmotic sensor, EnvZ intermolecular complementation of
transmembrane signalling: Mol. Microbiol. 13:435-444.
145. Tokuda, H. 1994. Biochemical characterization of the presecretory protein
translocation machinery of Eschericha coif. FEBS Lett. 346:65-68.
146. Totten, P. Am, J. C. Lam, and S. Lory. 1 990. The rpoN gene product of
Pseudomonas aenrginosa is required for expression of diverse genes, including
the Ragellin gene. J. Bacterial. 172:389-396.
147. Traxier, B., D. Boyd, and 6. Beckwith. 2993. The Topological Analysis of
Integral Cytoplasmic Membrane Proteins. J. Membr. Biol. 132:l-11.
14%. Valent, Q A., J.-W. L. De gier, G. von Heijne, D. A. Kendall, C. M. ten
Hagen Jongman, B. Oudega, and J. Luirink. i997. Nascent membrane and
p resecretory proteins sy nthesked in Eschefichia coli associate with signal
recognition particle and trigger factor. Mol. Microbiol. 25:53-64.
149. Valent, Q. A., P. A. Scotti, S. High, JPW. L. de Gier, G. von Heijne, G.
Lentzen, W. Wintimneyer, B. Oudegr, and J. Luirink. 1998. The Escherichia
coliSRP and SecB targeting pathways converge at the translocon. EM60 J.
f E2504-2512,
![Page 211: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/211.jpg)
150. Van Delden, C., and B. H. Iglewski. 1998. Cell-to-cell signaling and
Pseudomonas aeruginosa infections. Emerg Infect Dis- 4:552-560-
151. van der Wolk, J. P., J. G. de Wit, and A. J. Driessen. 1997. The catalytic
cycle of the Escherichia coii SecAATPase comprises Wo distinct preprotein
translocation events. EMBO 3. .16:7297-7304-
152. van Klompenburg, W., I. Nilsson, 0. von Heijne, and B. de Kruijff.
1997. Anionic phospholipids are determinants of membrane protein topology.
EM60 Jt t6~4261-4266.
153. von Heijne, 0.1986. The distribution of positively charged residues in
bacterial inner membrane proteins correlates with the trans-membrane topology.
EMBO J.5:3021-3027.
t54. von Heijne, 0.1992- Membrane Protein Structure Prediction
Hydrophobicity Analysis and the Positive-inside Rule. J. Mol. Biol. 225:487494.
155. von Heijne, 0.1994. Membrane proteins: from sequence to structure. Ann.
Rev. Biophys. Biomol. Struct 233 67-7 92,
156. von Heijne, G., and Y. Gavel. 1988. Topogenic signals in integral
membrane proteins. Eur J Biochem. 174:671-678.
157. Wall, D., and D. Kaiser. 1999. Type N pili and celi mobility. Mol. Microbial.
32~?-10.
158. Waukau, Jms and S. Forst 1999. Identification of a conserved N-terrninaI
sequence invoIved in transmembrane signal transduction in EnvZ J, BacterioI.
181 :5534-5538-
![Page 212: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/212.jpg)
196
159. Weiss, Dm S., J. Batut. K. E m Klose, J. Keener, and S. Kustti. 1991. The
phosphocylated form of the enhancer-binding protein NTRC has an ATPase
activity that is essentiar for activation of transcription. Cell. 67: 1 55-67.
160. Weirs, V., F. Claverie-Martin, and B. Magasanik. 1992. Phosphorylation
of nitrogen regulator I of Escherichia coli induces strong cooperative binding to
DNA essential for activation of transcription. Proc Natl Acad Sci. 89:5088-5092.
161. Wickner, W., A. J. M. Driessen, and F.U. Had. 1991. The enzymology of
protein translocation across the Escherichia coli plasma membrane. Ann. Rev.
Biochem. 60:101-124-
162. Wolfe, P. B., M m Rice, and W. Wickner. 1985. EfFects of two sec genes on
protein assembly into the plasma membrane of Escherichia coli. J. Biol. Chem.
260~1836-1841.
163. Woods, D. 1987. Pathogenesis of acute and chronic Pseudomonas
aemginosa infections. Antibiot Chemother. 39: 160-1 71.
f64. Woods, D. E., O. C. Stnus, W. J. Johrnson, V. K. Berry, and J. A.
Bass. 1980. Role of pili in adherence of Pseudomonas aeruginosa to
mammalian buccal epithelial cells. Infect. Immun. 299 146-1 151.
165. Wu, S. S., and D. Kaiser. 1995. Genetic and functional evidence that Type
IV pili are required for social gliding motility in Myxococcus xanthus. Mol.
Microbio[, 18:54?-558.
t68. Wu, S. S., and 0. ffiiber. t 997. Regulation of expression of the piiA gene
in Myxococcus xanthus. J. Bacterial. f79:7748-7758.
![Page 213: Characterization of the hydrophobic domain of PilS, A](https://reader035.vdocument.in/reader035/viewer/2022062420/62ae6eaa4b9f5053f41fa76f/html5/thumbnails/213.jpg)
197
167. Yaku, H., and T. Mizuno. 1997. The membrane-located osmosensory
kinase, EnvZ, that contains a leucine zipper-like motif functions as a dimer in
Escherichia coli. FEBS Let 41 7:409-42 3,
168. Yamaguchi, T., and H. Yamada. 1991. Role of mechanical injury on
airway surface in the pathogenesis of Pseudomonas aenrginosa. Am. Rev.
Respir. Dis. 144:114?-1152.
169. Yamane, Km, Y. Akiyama, K. lto, and S. Mizushima. 1990. A positiveIy
charged region is a determinant of the orientation of cytoplasmic membrane
proteins in Eschedchia coli. J. Biol. Chem. 265:21166-21171.
170. Yamane, K., and S. Mizushima. 1988. Introduction of basic amino acid
residues atter the signal peptide inhibits protein translocation across the
cytoplasmic membrane of Escherichia coli. Relation to the orientation of
membrane proteins. J Biol Chem. 263:19690-19696.
If I. Yang, Y., and Me Inouye. 1991. lntennolecular complementation between
Wo defective mutant signal-transducing receptors of Escherichia coii. Proc. Naff.
Acad. Sci. USA, 88:f i 057-1 1061.
172. Zimmann, P., W. Puppe, and K. Altendorf. 1995. Membrane topology
analysis of the sensor kinase KdpD of Esche~chia coli. J Biol Chem. 270:28282-
28288,