chemical induction of endogenous retrovirus particl es...
TRANSCRIPT
-
1
Chemical induction of endogenous retrovirus particles from the VERO 1
cell line of African green monkeys 2
3
Hailun Ma, Yunkun Ma, Wenbin Ma, Dhanya K. Williams, Teresa A. Galvin, and 4
Arifa S. Khan* 5
6
Laboratory of Retrovirus Research, Division of Viral Products, Center for Biologics 7
Evaluation and Research, U.S. Food and Drug Administration, Bethesda, Maryland 8
20892 9
10
Running Title: ERV particles induced from AGM-VERO 11
12
*Corresponding author. Mailing address: Laboratory of Retrovirus Research, Division of 13
Viral Products, Center for Biologics Evaluation and Research, U.S. Food and Drug 14
Administration, 8800 Rockville Pike, HFM-454, Bldg. 29B, Rm 4NN10, Bethesda, 15
Maryland 20892. Telephone: (301) 827-0791. Fax: 301-496-1810. E-mail: 16
18
Present address: Division of Product Quality, Center for Biologics Evaluation and 19
Research, U.S. Food and Drug Administration, Bethesda, Maryland 20892 20
21
Word count for the abstract: 256 words. 22
Word count for the Text: 8844 words 23
Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Virol. doi:10.1128/JVI.00147-11 JVI Accepts, published online ahead of print on 4 May 2011
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
2
24
Keywords: Simian endogenous retrovirus (SERV), Baboon endogenous virus (BaEV), 25
African green monkey (AGM) VERO cell line, Chemical induction, 5-iodo-26
2deoxyuridine (IUdR) and 5-azacytidine (AzaC). 27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
3
ABSTRACT 47
48
Endogenous retroviral sequences are present in high copy number in the genomes of all 49
species and may be expressed as RNAs, however, the majority are defective for virus 50
production. Although virus has been isolated from various Old World monkey and New 51
World monkey species, there has been no report of endogenous retroviruses produced 52
from African green monkey (AGM) tissues or cell lines. We have recently developed a 53
step-wise approach for evaluating the presence of latent viruses by chemical induction 54
(Khan et al., Biologicals, 37:196-201). Based upon this strategy, optimum conditions 55
were determined for investigating the presence of inducible, endogenous retroviruses in 56
the AGM-derived VERO cell line. Low-level reverse transcriptase activity was produced 57
with 5-azacytidine (AzaC) and with 5-iodo-2deoxyuridine (IUdR); none was detected 58
with sodium butyrate. Nucleotide sequence analysis of PCR-amplified fragments from 59
the gag, pol, and env regions of RNAs, prepared from ultracentrifuged pellets of filtered 60
supernatants, indicated that endogenous retrovirus particles related to simian endogenous 61
type D, betaretrovirus sequences (SERV) and to baboon endogenous virus type C 62
gammaretrovirus sequences (BaEV) were induced by AzaC, whereas SERV was also 63
induced by IUdR. Additionally, sequence heterogeneity was seen in the RNAs of SERV- 64
and BaEV-related particles. Infectivity analysis of drug-treated AGM-VERO cells 65
showed no virus replication in cell lines known to be susceptible to type D simian 66
retroviruses (SRVs) and to BaEV. . indicated the presence of several inducible, 67
endogenous retrovirus loci in the AGM genome. The results indicated that multiple, 68
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
4
inducible endogenous retrovirus loci are present in the AGM genome that can encode 69
noninfectious, virus-like particles. 70
71
INTRODUCTION 72
73
Endogenous retroviral sequences are stably integrated, genetically-inherited, and 74
present in multiple copies in the genomes of all species. The majority of these sequences 75
are defective; however, some may produce infectious retroviruses (9, 11, 16, 71, 78). In 76
general, newly-acquired endogenous retroviral sequences are more likely to be associated 77
with an infectious virus, whereas ancient sequences may be transcriptionally active but 78
defective for virus production (86) or produce non-infectious particles (38). In rodents, 79
endogenous retroviruses can be activated in animals as a consequence of age (4) or in cell 80
lines, either spontaneously by long-term culture passage (2, 49, 63) or by treatment with a 81
variety of inducers including biological, immunological, and chemical agents (1, 13, 17, 82
25, 39, 47, 50). In humans or nonhuman primates (NHPs), spontaneous release of 83
endogenous retroviruses has been reported from tumor tissues and cell lines, as well as 84
from normal placenta (9, 12, 14, 15, 19, 20, 27, 28, 34, 43, 44, 51, 52, 58, 62, 64-66, 69, 85
72, 73). Endogenous retroviruses have also been isolated from NHP cells by extended 86
cultivation (6-8 months) of normal primary cell cultures and cell lines (67, 75, 76, 79). 87
The number of endogenous primate retroviruses isolated thus far is limited and the virus 88
isolates or the tissues from which they were recovered are not readily available for 89
characterization by current state-of-the-art methods or for the development of reagents 90
for further investigations. 91
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
5
Endogenous retroviruses have been reported from a variety of NHP species, including 92
Old World primates and New World primates but there has been no evidence of 93
endogenous retroviral particles produced from African green monkey (AGM) tissues or 94
from cell lines derived from this species. The VERO cell line, derived from the kidney of 95
a normal, adult AGM (Chlorocebus species, formerly called Cercopithecus aethiops) 96
(87), is used broadly in research and virus diagnostics as well as in vaccine development 97
due to its broad susceptibility to infection by different viruses (6). This cell line has been 98
shown to be non-tumorigenic at low passage level (7, 18, 22, 32, 48, 54, 74, 84) and 99
negative for viruses by extensive testing using a variety of assays including PCR assays 100
and standard chemical induction (29, 74). We have recently developed a step-wise 101
strategy for using chemical inducers to optimize induction conditions for investigating 102
the presence of latent viruses (37) . We have used this strategy to evaluate activation of 103
endogenous retroviral sequences in VERO cells, which, although known to contain 104
numerous copies of endogenous retroviral sequences due to their AGM species of origin 105
(5, 8, 10, 26, 31, 36, 42, 57, 68, 81), were not expected to contain an inducible virus 106
based upon its extensive testing history and broad use of the cell line (29, 74). Here we 107
report that treatment of VERO cells with 5-azacytidine (AzaC) and with 5-iodo-108
2deoxyuridine (IUdR) induced endogenous retroviral particles related to ancient simian 109
endogenous type D betaretrovirus sequences (SERV) that are present in all Old World 110
monkeys (83) and distinct from pathogenic, type D simian retroviruses (SRVs) (46). 111
Additionally, particles containing baboon endogenous virus (BaEV)-related type C 112
gammaretrovirus sequences were also induced from Aza-C treated VERO cells. 113
Infectivity analysis of drug-treated VERO cells indicated the absence of a replicating 114
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
6
virus using various target cells known to be susceptible to SRVs and BaEV. The results 115
demonstrate the use of optimized chemical induction conditions for investigating 116
infectious, endogenous retrovirus loci in the genomes of primates and other species. 117
118
MATERIALS AND METHODS 119
120
Cell lines and chemicals. Cell lines were obtained from ATCC (Manassas, VA). The 121
VERO cell line (AGM kidney cells; ATCC, cat. no. CCL-81, lot no. 3645301; passage 122
120) was grown in Eagles minimum essential medium (modified) with Earles salts 123
without L-glutamine (EMEM; Mediatech, Manassas, VA, cat. no.15-010-CV) containing 124
5% fetal bovine serum, per ATCC instructions, (heat-inactivated at 56 C for 30 mins; 125
FBS; Hyclone, Logan, UT, cat. no. SH30071.03), 2 mM L-glutamine, 250 U of penicillin 126
per ml, and 250 g of streptomycin per ml, 1x non-essential amino acids (MEM-NEAA 127
100x, Quality Biological Inc., Gaithersburg, MD), and 1 mM sodium pyruvate (Quality 128
Biological, Inc), designated as complete medium. To maximize reproducibility of results 129
in the induction assays, a cell bank was established at passage 123. A new vial was used 130
in each experiment to maintain similar passage number in the induction studies. 131
For virus-induction studies, VERO cells were treated with different concentrations of 132
IUdR (stock solution, 75 mg per ml in 1N NH4OH; Sigma, St. Louis, MO, cat. no, 133
17125), AzaC (1 mg/ml in complete VERO cell medium; Sigma, cat. no. A1287), and 134
sodium butyrate (NaB; 0.9 M in sterile H20; Sigma, cat. no. B5887). 135
Target cell lines used in infectivity studies were: A-204 (human rhabdomyosarcoma; 136
ATCC, cat. no. HTB-82), Raji (human B cell lymphoma; ATCC, cat. no. CCL-86), and 137
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
7
Cf2Th (dog thymus, ATCC, cat. no. CRL-1430). Cf2Th cells were grown in Dulbeccos 138
modified Eagles MEM (DMEM; Invitrogen, Carlsbad, CA, cat. no. 119955) 139
supplemented with 20% FBS; A-204 and Raji cells were grown in RPMI 1640 (Quality 140
Biological, cat. no. 112-024-101) supplemented with 10% FBS and 1x NEAA. 141
Additionally, the media contained 2 mM L-glutamine, 250 U of pencillin per ml, and 250 142
g of streptomycin per ml. 143
Growth curve and population doubling time (PDT). Cells were counted using an 144
automated Guava PCA Flow Cytometer according to the manufacturers protocol (Guava 145
ViaCount Assay, Hayward, CA). Cells were diluted and the number of viable cells, dead 146
cells, and apoptotic cells were counted in triplicate. The average count of the viable cell 147
numbers was used in the experiments. For cell-cycle analysis, 0.5 x 106 cells were 148
processed and stained according to the manufacturers protocol (Guava Cell Cycle 149
Assay). 150
To determine the optimum number of cells for obtaining a sigmoidal growth curve, 151
VERO cells (0.5 x 106, 0.75 x 10
6 and 1.0 x 10
6) were planted in 5 ml complete medium 152
in 25-cm2
flasks and viable cells were counted at various times using Guava PCA 153
cytometer. Cell-cycle analysis was done to determine the cell phases. Population 154
doubling time (PDT) was calculated as 1/k =T (where T= PDT) from the linear curve in 155
the log phase from the formula N=N02kt (where N = total viable cell number at end time 156
t; N0= total viable cell number at initial time t0, t= hours from A0 to A, and k = the 157
regression constant) (60). Results were confirmed in 3 independent assays. 158
Drug-dose evaluation. VERO cells (1 x 106; passages 125 131) were planted for 159
16 h in 25-cm2 flasks before replacing medium with fresh medium containing different 160
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
8
concentrations of AzaC (0.3125-40 g/ml), IUdR (50-3200 g/ml), or NaBut (1-6 mM). 161
After 48 h drug treatment, cells were washed with medium three times (designated as day 162
0), trypsinized, and counted by Guava PCA cytometer. Another set of flasks were further 163
incubated after the medium change, and the cells were trypsinized and counted at day 3. 164
Untreated cells, at confluence, were used as control to evaluate cell toxicity and cell 165
recovery based upon the cell-confluence ratio at day 0 and at day 3, which was calculated 166
by dividing the number of viable cells in the drug-treated flask from the number of viable 167
cells at confluence in the untreated control flask (2.3 x 106) and expressed as a percent. 168
Furthermore, in case of IUdR-treated cells, additional controls were included to evaluate 169
toxicity due to NH4OH used for dissolving the drug. In case the number of cells in the 170
NH4OH-treated flask were less than those the untreated control flask, the number of 171
viable cells in the IUdR-treated flasks were divided by the number of viable cells in the 172
NH4OH-treated flasks before determining the cell-confluence ratio. 173
Chemical treatment and evaluation for induced retroviruses by the single-tube 174
fluorescent PCR-enhanced reverse transcriptase (STF-PERT) assay. VERO cells 175
were drug-treated under optimized induction conditions: cells (1x106) were planted for 16 176
h and then treated with drug for 48 h (AzaC, 1.25 g/ml, IUdR, 200 g/ml, and NaBut, 3 177
mM); Untreated cells were included as control. For kinetics of virus induction, medium 178
was replaced daily and filtered supernatant collected for detection of reverse transcriptase 179
(RT) activity by the STF-PERT assay (53). Supernatants were collected and filtered 180
(Costar Spin-X Centrifuge Tube Filters, 0.45 m Pore CA Membrane; Corning, 181
Lowell, MA) on the day of drug removal (d0) prior to washing, and then daily, at each 182
medium change. Filtered supernatants were stored at -80 C in single-use, 10 l aliquots 183
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
9
for STF-PERT analysis and in 0.5 ml aliquots for additional use. Each sample was tested 184
at 1:10 dilution (per the assay protocol) and results were obtained from triplicate samples. 185
The PERT assays for testing supernatant from drug-treated cells met the acceptability 186
criteria (53): IUdR, slope = -3.96, Y-intercept = 48.06, r2 = 0.999; AzaC, slope = -3.14, 187
Y-intercept = 42.59, r2 = 0.996; NaB, slope = -3.97, Y-intercept = 48.05, r
2 = 0.996. 188
Negative controls were cells without drug (or with NH4OH in the case of IUdR cell 189
toxicity studies) and were set up in parallel. 190
RT-PCR. Total cellular RNAs were extracted using the RNeasy Plus Mini Kit 191
(Qiagen, Valencia, CA; Cat. No. 74134) in combination with the RNase-Free DNase Set 192
(Qiagen; Cat. No. 79254) according to the manufacturers instructions. Concentration 193
and purity were determined by using UV-absorbance. 194
Low concentrated (10 x) supernatant sample was prepared from normal and drug-195
treated cells by ultracentrifugation of filtered supernatant (1.5 ml) at 45,000 rpm 196
(Beckman TLA 45 rotor) for 90 min at 4 C. RNA was prepared from the pellet by 197
resuspending it in 130 l of Promega DNase buffer, and adding 10 l DNase (1U per l; 198
RNase-free DNase, Promega, Madison, WI) for incubation at 37 C for 30 min. RNA 199
was extracted from the entire sample using QIAamp Viral RNA Mini Kit (Qiagen; cat. 200
No. 52904). 201
High concentrated (1000 x) supernatant sample was prepared from normal and from 202
AzaC-treated VERO cells (1.25 g/ml for 48 h) on day 4 post drug treatment (medium 203
was changed on day 1) by ultracentrifugation of pooled (180 ml), filtered supernatant 204
(0.45 ,Corning, Corning, N.Y., cat no 430314) on a 20% sucrose cushion (25,000 rpm in 205
a Beckman SW-28 rotor for 4 h at 4 ). Pellets were pooled, resuspended in 4 ml PBS 206
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
10
(pH 7.4) and ultracentrifuged immediately at 35,000 rpm (BeckmanSW-41 rotor) for 90 207
min at 4 . The pellet was resuspend in 180 l in PBS (pH 7.4) and stored in aliquots at 208
-80 to minimize freeze-thaw of test samples. RNA was extracted from 50 l using 209
QIAamp Viral RNA Mini Kit (Qiagen; cat no 52904) after DNase I digestion (1 U per l; 210
RNase-free DNase, Promega, Madison, WI), as described above. 211
One-half of the RNA sample was used for cDNA synthesis using iScript cDNA 212
Synthesis Kit (Bio-rad, Hercules, CA, cat. no. 170-8890) according to the manufacturers 213
instructions. The other half of the RNA was used for RT-minus control. Additionally, 214
PCR amplification using human -actin primers was performed to demonstrate absence 215
of cellular DNA according to the manufacturers protocol (Clontech, Mountain View, 216
CA, cat. no. 639008). 217
Consensus PCR primers (SRV/SERV) were designed based upon sequences of SRV-1 218
type D retrovirus (M11841), SRV-2 complete genome (AF126467), simian Mason-Pfizer 219
D-type retrovirus or SRV-3 (M12349), and simian type D virus 1, complete proviral 220
genome (U85505; designated as SERVbab in this paper). The location of the SRV/SERV 221
primers is shown in table 1: an LTR-gag fragment (553 bp) was amplified using forward 222
primer F04, 5- CTGTCTTGTCTCCATTTCT-3 and reverse primer R10, 5- 223
ACSGCAGCCATKACTTGYGG-3; a pol fragment (610 bp) was amplified using 224
forward primer F41, 5-TACAAGAYCCMTAYACCTA-3 and reverse primer R46, 5-225
TTDGGTGGRTAATGGTTRTC-3, and an env fragment (548 bp) was amplified using 226
forward primer F65, 5-CAYATNTCYGATGGAGGAGG-3 and reverse primer R70, 227
5-CCYGTCCARTTTGTRGGTA-3. PCR conditions were: 95 3 min, followed by 35 228
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
11
amplification cycles of 95 for 30 seconds, 56 for 1 min and 72 for 1 min with a 229
final extension at 72 10 min. 230
Primers for amplification of BaEV sequences and PCR cycle conditions were as 231
described previously (82): RT1 and RT2 in the pol region, and ENV1/ENV4 with nested 232
primers ENV2/ ENV3 in the env region. Additional primers were made for PCR 233
amplification in the gag region: outer primer pairs were GAG1 (5-234
GAGTGGCCCACCCTTCATGT-3) and GAG2 (5-CAGTACTGGATCGTGCGGTT-235
3), at nucleotide positions 1108-1127 and 1697-1678, respectively, and inner primers 236
pairs were GAG3 (5-CCCCGGGACGGAACTTTTGA-3) and GAG4 (5- 237
GATGAGGTAGAGGGTCTTGGAAG-3) at nucleotide positions 1135-1154 and 1420-238
1398, respectively. The nucleotide positions are based upon the sequence of the BaEV by 239
Kato et al., (35) . 240
PCR reactions were done in 25 l using 2 l cDNA template, 10 x PCR buffer 241
containing 15 mM MgCl2, 1.5 U Taq DNA polymerase (Roche Molecular Biochemicals, 242
Indianapolis, IN; cat. no. 11647687001). The final concentration of deoxynucleotide 243
triphosphates were 200 M each and primers were 1M each. 244
Nucleotide sequence analysis. PCR-amplified DNA fragments were isolated from 245
agarose gels by using Zymoclean Gel DNA Recovery kit (Zymo Research Corp, 246
Orange, CA; Cat. No. D4001) and cloned into the pGEM-T Easy vector (Promega; cat no 247
A1360). Nucleotide sequences were determined with T7 and SP6 primers using an ABI 248
3130xl Genetic Analyzer according to the manufacturers standard protocol (Applied 249
BioSystems, Foster City, CA). Sequence analysis and alignment of the sequences were 250
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
12
done using nucleotide BLAST (National Center for Biotechnology Information, National 251
Library of Medicine, NIH, Bethesda, MD). 252
Transmission electron microscopy (TEM). Supernatant (160 ml) was collected 253
from VERO cells without drug treatment and from VERO cells on day 4 after drug 254
treatment for 48 h with IdUR (200 g/ml) and AzaC (1.25 g/ml) for 48 h. 255
Ultracentrifuged pellets were obtained through a 20% sucrose cushion using the 256
procedure described above for preparation of 1000x supernatant sample. The pellets 257
were fixed overnight in McDowell and Trumps Fixative and sent to Charles River 258
Pathology Associates (Durham, NC) for evaluation of virus-like particles. The volume of 259
the pellet was measured by comparison to known standards and processed for TEM 260
analysis. Thin sections were cut, stained with methanolic uranyl acetate and Reynolds 261
lead citrate and examined by TEM. Ten grid spaces were examined and evaluated for 262
numbers of particles with retrovirus-like morphology. The number of virus-like particles 263
in the entire pellet was calculated by multiplying the number of particles tabulated in the 264
examined section by the number of potential sections in the pellet (calculated by dividing 265
the volume of the entire pellet by the volume of the section examined). The limit of 266
sensitivity of the assay was calculated as the smallest detectable amount of virus in the 267
samples or one particle in the section examined by TEM. Thus to obtain the limit of 268
sensitivity the number of potential sections in the pellet is multiplied by one. 269
Cell pellets (2 - 4 x 106) for TEM analysis were prepared by trypsinizing cells from 270
normal or AzaC-treated VERO cells, as previously described (41). 271
Infectivity analysis. Combined infectivity and coculture studies were set up with 272
cells and supernatant from drug-treated cells that were prepared by planting VERO cells 273
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
13
(1x106, passage 131) in 25-cm
2 flasks for 16 h and then treating the cells with drug for 48 274
h (AzaC, 1.25 g/ml or IUdR, 200 g/ml). Cells were washed three times with plain 275
medium to remove the drug and fresh complete medium added (day 0). Medium was 276
replaced the next day (d1); on day 4, unfiltered supernatant and cells from eight 25-cm2 277
flasks were pooled and used for infection/coculture with target cells at predetermined cell 278
ratios for equivalent growth of test and target cells. Target control cells were set up 279
without coculture, and control cocultures were set up with target cells and uninduced 280
VERO cells. 281
In case of the A-204 and Cf2Th adherent target cells, 2.7 x 106 and 1.5 x 10
6 cells, 282
respectively, were set up in 10 ml medium for preincubation with 5 ml unfiltered 283
supernatant from AzaC-treated and from IUdR-treated VERO cells (passage 131) at 37 284
C for 45 min in 75-cm2
flasks, after which trypsinized, AzaC- or IUdR-treated VERO 285
cells (about 3.0 x 106 cells per flask) were added into the corresponding flasks. The 286
coculture ratio of VERO cells to target cells was 1:1 for A-204 cells and 2:1 for Cf2Th 287
cells. In case of the Raji suspension target cells, 8 x 106 cells in 10 ml per flask were 288
incubated at 37 C for 45 min with unfiltered supernatant from AzaC- or IUdR-treated 289
VERO cells (5 ml), and then all of the cells and supernatant (total volume 15 ml) were 290
added by replacing the medium in flasks containing drug-treated VERO cells (3 x 106), 291
which had been pre-incubated for 45 min in 75-cm2 flasks. The target cells were 292
demonstrated to be susceptible to SRV (A-204 and Raji) and to SMRV (Cf2Th). Medium 293
was replaced with 13 ml of target-cell medium following overnight incubation. In the 294
case of Raji cells, the supernatant was collected, spun at 1200 rpm (GS-6KR centrifuge 295
with a GH-3.8 rotor, Beckman Instruments, Columbia, MD) for 10 min at 4 C, and the 296
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
14
Raji cells were resuspended in 10 ml medium, then added back to the flask containing 297
VERO cells in fresh 10 ml medium. Upon reaching 95% confluence, all of the cells 298
were passaged the next day (day 2) into 162-cm2
flasks. Cultures were propagated in 162-299
cm2 flasks with passage every 2-3 days until termination on day 32. 300
Extended-cell culture was done on AzaC-induced VERO cells (passage 135; 1.0 x 106 301
in 25- cm2, 1.25 g/ml in 5 mls). For extended culture, cells were washed 48 h after drug 302
treatment (= day 0, the day of drug removal) and then cultured in fresh complete medium. 303
Upon reaching confluence, cells were passaged into 75-cm2 and then into 162-cm
2 flasks 304
at the same time as the cocultures and continued in 162-cm2 flasks until termination on 305
day 34. Uninduced VERO cells were included as control. 306
The cultures were regularly monitored for cytopathic effect (CPE). Filtered 307
supernatants were collected starting at the first passage at day 4 post coculture or post 308
drug treatment, until termination, and stored at -80 C for the STF-PERT assay. 309
310
RESULTS 311
312
Determination of cell-growth characteristics. Growth curves for VERO cells were 313
determined using different cell concentrations (0.5 x 106 and 1.0 x 10
6) (Fig. 1). Similar 314
kinetics were seen in both cases (as well as with 0.75 x 106, data not shown) with the log 315
phase starting at 16 h after seeding the cells. PDT was determined from 20 h 40 h in the 316
log phase of the growth curve and calculated as described in Materials and Methods, to 317
be 16.9 h and 17.5 h, for starting cell concentrations of 0.5 x 106 and 1.0 x 10
6, 318
respectively. This indicated that any of the tested cell concentrations could be used to 319
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
15
obtain a sigmoidal growth curve for determining the beginning and end of the log phase 320
for induction studies. An independent experiment was set up to evaluate the growth curve 321
with cell-cycle analysis. The results indicated a high percentage of cells in S phase 322
(28.8%) at 16 h, which corresponded to the beginning of the log phase in the growth 323
curve (data not shown). 324
Optimization of induction conditions. The drug-dose range was determined by 325
evaluating cell toxicity and cell recovery based upon the highest drug concentrations that 326
resulted in good culture recovery at 3-4 days after drug removal, since the cells without 327
drug treatment reached confluence in 2-3 days (37). Cells were planted for 16 h before 328
adding drug, since this corresponded to the beginning of the log phase and a high 329
percentage of cells in S phase. Cells were treated for 48 h [equivalent to 2.7 PDTs; (37)] 330
with different drug concentrations (IUdR, 50 3200 g/ml; AzaC, 0.3125 40 g/ml; 331
and NaBut, 1 - 6 mM). Cell viability was determined on day 0 and on day 3, and the cell-332
confluence ratio calculated. Comparison of the results at day 0 and day 3 indicated the 333
drug concentrations (dose range) at which the cells could recover from toxicity (Fig. 2). 334
To determine the relationship between RT activity and drug dose, filtered supernatants 335
were collected at day 3 from drug-treated cells and analyzed in the STF-PERT assay: 336
increased RT activity corresponded to samples with >50% cell recovery from drug 337
toxicity (Fig. 2). Differences in cell toxicity were seen with different drugs: cells were 338
fairly resistant to IUdR and relatively sensitive to AzaC and NaBut. This was in contrast 339
to the results obtained in previous induction studies with K-BALB mouse cells, where 340
cells were sensitive to IUdR and more resistant to AzaC. In those studies, 30 g/ml 341
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
16
IUdR and 2 g/ml AzaC (39, 40) or 5 g/ml AzaC (37) (Y. Ma et al., data not shown) 342
were used with 24 h drug treatment for virus induction. 343
To evaluate the kinetics of RT production with drug treatment, cell-free supernatant 344
was collected daily and tested by STF-PERT assay. Medium for testing was collected 345
from VERO cells treated with different drug concentrations for 48 h, from day 0 (the day 346
the drug was removed) up to day 5, with daily medium change. The results of the highest 347
RT activity obtained with each drug are shown in Fig. 3: a low-level PERT activity was 348
induced with 1.25 g/ml AzaC, which peaked at day 3, whereas the peak PERT activity 349
induced with 200 g/ml IUdR was seen at day 4 (Fig. 3). It was noted that a comparable 350
peak of RT activity was seen with 100 g/ml IUdR at day 3 (Fig. 2). The RT activity 351
with IUdR was lower than AzaC at all tested drug concentrations (data not shown). No 352
reproducible PERT activity (> 10 pU per l) was seen in the case of NaBut at any drug 353
concentration (1 - 6 mM) at 24 h or at 48 h drug exposure times (Fig. 2C; Fig. 3; and data 354
not shown). Additionally, in a separate experiment, if cells were treated with different 355
drug concentrations for only 24 h (equivalent to about 1.5 PDT), the PERT activity was 356
lower and seen only at higher drug concentrations as compared with 48 h drug treatment 357
(data not shown). 358
Evaluation of retroviral sequences in the RT activity produced from drug-treated 359
VERO cells. To determine whether the drug-induced PERT activity was associated with 360
endogenous retrovirus particles, cell-free supernatants containing peak RT activity from 361
drug-treated cells (Fig. 3) were ultracentrifuged and the pelleted material (10x or 1000x) 362
was analyzed by RT-PCR assays. Consensus SERV/SRV primers amplified fragments 363
from the LTR-gag, pol, and env regions in 10x pelleted material of supernatant from 364
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
17
AzaC- and IUdR-treated VERO cells (Fig. 4A, lanes 2 and 3, respectively) whereas no 365
fragments were amplified from untreated cells or from NaB-treated cells (lanes 1 and 4, 366
respectively). The results of the first round of PCR amplification are shown in Fig. 4A, 367
which indicated greater virus induction with AzaC than with IUdR and directly correlated 368
with the PERT results (Fig. 3). Expected size fragments were PCR-amplified from 369
cellular RNAs of untreated and drug-treated cells; increased band intensities were seen in 370
the gag and env regions with all three drugs as compared with untreated cells. The 371
SERV-related sequences amplified from VERO cells were designated as SERVagm-372
VERO. 373
BaEV primers amplified fragments from the gag and env regions by nested RT-PCR 374
of 1000x pelleted supernatant from AzaC-VERO cells (Fig. 4B; supernatant panel, lanes 375
2). A pol fragment was seen after the first round of PCR amplification in the pelleted 376
supernatant from AzaC-VERO cells, as well as weakly in the pellet prepared from 377
supernatant of untreated cells (supernatant panel: lanes 2 and 1, respectively). PCR-378
amplified fragments were seen at about the same intensities in cellular RNAs of untreated 379
and drug-treated cells after the 1st round of PCR amplification with gag and pol primers 380
and strongly in AzaC-treated cells with env primers (cellular panel: lane 2). The size of 381
the gag and pol PCR-amplified fragments corresponded to the expected size based upon 382
the primers used whereas the env fragment had 4 nucleotides absent (discussed below). 383
The BaEV-related sequences amplified from VERO cells were designated as BaEVagm-384
VERO 385
No fragments were amplified using -actin primers from 10x supernatant indicating 386
the absence of contamination with cellular sequences (Fig. 4C) or from 1000x 387
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
18
supernatant (data not shown). To demonstrate the absence of contaminating DNA in the 388
cellular RNA preparations, PCR amplification was done with -actin primers in the 389
absence of RT: no fragments were seen whereas expected size fragments were seen in the 390
presence of RT. 391
Nucleotide sequence anlaysis of SERVagm-VERO DNAs cloned from supernatant 392
pellets of AzaC-treated VERO cells indicated a high degree of homology (94-96%) in 393
the gag, pol, and env regions with SERVbab as compared with SRV-1, SRV-2, and SRV-394
3/MPMV (60-81%) (Table 1). Interestingly, nucleotide sequence comparison of 395
SERVagm-VERO and simian retrovirus 1 isolate SRV_Vero, a recently described 396
endogenous simian retrovirus sequence assembled from DNA fragments originating from 397
VERO cells, indicated less homology [90-92%; GenBank accession number. HM43845; 398
(85)] than that seen with SERVbab. Nucleotide sequence analysis of BaEVagm-VERO 399
DNAs cloned from pelleted supernatant of AzaC-treated cells indicated high degree of 400
identity to BaEV (95-97%) in the pol region whereas the env sequences were highly 401
related (92-94%) to those present in SERVbab (83). (Table 2). There was 83-86% 402
sequence homology in gag with BaEV and 83-90% homology was seen in the gag and 403
pol with BaEV recombinant virus, PcEV. Additionally, there was 69-87% nucleotide 404
sequence homology in the gag, pol, and env regions to RD114, an endogenous retrovirus 405
in cats that contains BaEV env (80). Further analysis of env was done by determining 406
nucleotide sequences of 5 BaEVagm-VERO cloned DNAs. The results indicated 4 407
identical clones (represented by 519); clone 524 had 4 different nucleotides. Alignment 408
of BaEVagm-VERO env sequences with the analogous region in SERV and BaEV is 409
shown in Fig. 5. The results indicated that the BaEVagm-VERO env sequences were 410
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
19
closely related to SERV than to BaEV, except in the regions of the PCR primers; 411
however, they were distinct from SERV env due to the absence of four nucleotides, as 412
well as from previously described clones 23.1 and 25.5 that were obtained from baboon 413
DNA using the same BaEV env primers (82). It should be noted that the four-nucleotide 414
deletion in BaEVagm-VERO sequences would result in the absence of env expression 415
and therefore particles encoded from these sequences should be noninfectious. Similar 416
analysis of cloned DNAs from the gag, pol, and env regions indicated genetic 417
heterogeneity in the particles produced from SERVagm and BaEVagm sequences in 418
VERO DNA. 419
To further demonstrate that the PERT activity produced from drug-treated VERO cells 420
was particle-associated, pellets from concentrated, cell-free supernatants of normal and 421
drug-treated cells were analyzed by TEM for viruses and other microbial agents (Fig. 6). 422
Only retrovirus-like particles were reported, albeit few. There were 1.7 x 106
virus-like 423
particles calculated in the AzaC-induced virus pellet prepared from 160 ml supernatant, 424
which is near the limit of detection by TEM. No viral-like particle could be seen in the 425
pellet prepared from the control sample and the IUdR-induced supernatant, which was 426
expected since this had much lower RT activity than the AzaC-sample. Additionally, no 427
particles were seen in cell pellets. 428
Infectivity analysis. To evaluate whether the RT-containing particles induced from 429
VERO cells were replication-competent, AzaC- and IUdR-induced supernatant and cells 430
were used to infect/coculture with cell lines known to be susceptible to replication of 431
different type D simian retroviruses such as Raji and A204 for SRV and Cf2Th for 432
SMRV. Additionally, A204 and Cf2Th are susceptible to replication of BaEV (45), 433
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
20
which contains an SERV env via recombination with SERVbab (83) and Raji to other 434
SERV-recombinant viruses (24, 59). To enhance the detection of infectious virus, 435
supernatant and cells were used directly upon collection, without freeze and thaw. 436
Additionally, drug-treated VERO cells were continued in an extended culture to allow for 437
amplification of any potential virus with an ecotropic host range. The results using the 438
highly-sensitive STF-PERT assay, which can detect 1-10 retrovirus particles (53) 439
demonstrated detection of only RT activity in the starting material, which was gradually 440
reduced to background or undetectable levels, but without amplification, even upon long-441
term culture. These results indicated the absence of an infectious virus that could 442
replicate in VERO cells or that was similar in its host range properties to various known 443
infectious type D simian retroviruses (Fig. 7). 444
445
DISCUSSION 446
447
About 8-10% of the genome of NHPs contains endogenous retrovirus-related 448
sequences (23). Although the majority of these sequences are defective, full-length virus 449
genomes may exist that potentially can encode infectious viruses (71). Endogenous 450
retroviruses have been isolated from Old World monkeys, such as the baboon, langur, 451
colobus monkey and macaques, and from New World monkeys, such as the woolly 452
monkey, squirrel monkey, and owl monkey, as well as from the gibbon ape and a 453
prosimian tree shrew (9, 21, 33, 62, 67, 76-79). However, there has been no report of 454
endogenous retrovirus particles of AGM origin even though endogenous retroviral 455
sequences related to type C gammaretrovirus murine leukemia virus (MLV) and type D 456
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
21
betaretrovirus SRV are present in the genome of African green monkeys and in cell lines 457
derived from this species (56, 83, 85), and MLV-related viral DNAs cloned from AGM 458
tissue were shown to contain functional long terminal repeats (LTRs) (36). Furthermore, 459
African green monkey cell lines such as VERO and CV-1 (30) have been widely used in 460
research and diagnostics without any report of spontaneous release of virus particles. 461
Additionally, VERO cells have been extensively tested for the presence of viruses, 462
including virus-induction assays for the detection of endogenous retroviruses, and were 463
found to be negative (29, 74). 464
We recently developed a step-wise approach to evaluate the presence of inducible 465
virus sequences by chemical induction that outlines a strategy for determining optimum 466
induction conditions based upon evaluation of cell growth properties, drug treatment 467
conditions and use of sensitive assays for known and novel virus detection (37). The 468
study indicated that maximum virus induction was obtained when the drug was added to 469
the cells in the early log phase, when there was a high percentage of cells in the S phase, 470
and the cells were treated for greater than one PDT before nearing the end of the log 471
phase. Additionally, the optimum drug dose was found to be the highest dose that still 472
had good cell recovery. We used this strategy to investigate whether endogenous 473
retroviral sequences present in AGMs were inducible for virus particles using the well-474
characterized VERO cell line. Inducers known to activate endogenous retroviruses such 475
as IUdR, AzaC, and NaBut (16, 17) were used in combination with sensitive broad 476
detection assays for retroviruses such STF-PERT assay (53). In contrast to previous 477
studies (74) and to our initial experiments using induction conditions that had been 478
optimized for K-BALB mouse cells (data not shown), a low-level of PERT activity was 479
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
22
detected in cell-free supernatants of IUdR- and AzaC- treated VERO cells by following 480
the step-wise virus induction strategy (37). Further characterization of the induced RT 481
activity showed that it could be pelleted by ultracentrifugation and was therefore likely to 482
be particle-associated. RT-PCR and nucleotide sequence analysis identified SERV- and 483
BaEV-related sequences in the pellets of RT-containing supernatant from VERO cells; 484
the presence of gag, pol, and env sequences further confirmed the RT activity was 485
associated with retrovirus particles. TEM analysis demonstrated induced particles in 486
AzaC-treated VERO cells. 487
A low-level of replication-defective retroviral particles were produced from VERO 488
cells under optimized conditions of drug treatment. Efforts to increase virus production 489
under various cell culture and drug conditions known to induce viruses were not 490
successful (e.g., cell synchronization by using serum-free medium for 1 and for 2 days, 491
dexamethasone + IUdR [200 g/ml] or AzaC [1.25 g/ml] (3, 16); and IUdR [200 g/ml] 492
+ AzaC [1.25 g/ml] (40). It should be noted that a high dose of IUdR (200 g/ml) has 493
also been used to activate endogenous retrovirus from culture of the prosimian tree shrew 494
(21). These results indicate a stringent control of virus gene expression in primate cells. 495
It should be noted that the results of chemical virus induction were different in cellular 496
RNA expression and in supernatant RNAs that measured virus production. For example, 497
SERV-gag and -env RNAs were induced in cells treated AzaC, IUdR, and NaBut 498
whereas particle-associated RNAs were induced in the supernatant with only AzaC and 499
IUdR. In the case of BaEV-related RNAs, induction of gag and pol RNAs was not 500
noticed in the cell but only upon analysis of the supernatant. This discordancy in the 501
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
23
results emphasizes the need to evaluate cell-free, particle-associated RNAs for 502
investigating the potential of endogenous retrovirus sequences to encode virions. 503
Analysis of the induced virus particles from VERO cells in infection/coculture studies 504
using cell lines susceptible to SRV, BaEV, and recombinant SERVs (24, 59) followed by 505
detection with the highly-sensitive STF-PERT assay demonstrated absence of replication-506
competent virus. Additionally, long-term culture of the drug-treated VERO cells alone 507
did not result in increased PERT activity. Chemical induction studies indicated the 508
presence of endogenous retrovirus sequences in VERO cells that have the potential to 509
encode noninfectious virus-like particles containing RNAs. Although copackaging of 510
defective retroviral RNAs could result in recombination to generate an infectious virus 511
genome, based upon our data and the extensive testing of VERO cells used for 512
biologicals, there has been no evidence of emergence of an infectious retrovirus. Studies 513
are ongoing to physically and genetically characterize the retroviral particles induced 514
from VERO cells for further evaluation of the potential to generate novel recombinants. 515
SERV- and BaEV-related sequences have previously been reported in the genomes of 516
baboons and other NHP species including AGM (83, 85). It should be noted that the 517
SERV sequences in baboon have been misnamed as SRV-1 in the database [GenBank 518
accession number U85505; (83)]; furthermore, the recently reported assembled, 519
endogenous retrovirus sequences originating from VERO cells, which are related to 520
SERV in baboons, have also been designated as simian retrovirus 1 isolate SRV_Vero 521
[GenBank accession number HM143845; (85)]. It is important to recognize that SERVs 522
are distinct from SRVs, which are exogenously transmitted and pathogenic in macaques. 523
Interestingly, the SERVagm-VERO sequence associated with induced virus particles had 524
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
24
greater nucleotide sequence homology to SERVbab than to SRV_Vero sequence, 525
indicating that it originated from an ERV family in the AGM-VERO genome that is 526
distinct from SRV_Vero. The presence of multiple, related but distinct families in the 527
AGM genome has been previously described (56). Furthermore, analysis of SERVagm 528
and BaEVagm cloned DNAs in this study demonstrated sequence heterogeneity in the 529
particles induced from VERO cells. 530
The study demonstrates the presence of inducible retroviral sequences in the AGM 531
genome by use of an algorithm for determining chemical induction conditions optimized 532
for VERO cells. Moreover, this step-wise strategy may be used with emerging broad 533
virus detection technologies to identify novel endogenous retroviruses that can be 534
produced from other primate cells as well as from cell of other species. This approach 535
may also enhance the sensitivities of the currently available virus detection methods for 536
evaluating new cell substrates used for production of biological products by providing a 537
virus amplification step prior to detection. 538
539
ACKNOWLEDGEMENTS AND DISCLAIMERS 540
541
We thank Robin Levis, Andrew Lewis, Keith Peden, Hana Golding, Laraine Henchal, 542
Konstantin Chumakov, and Marion Gruber for review of the manuscript. The work done 543
in CBER, FDA has been funded by DMID/NIAID/NIH Interagency Agreement no. Y1-544
A1-4893-02. The content of this publication does not necessarily reflect the views or 545
policies of the Department of Health and Human Services, nor does mention of trade 546
names, commercial products, or organizations imply endorsement by the U.S. 547
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
25
Government. The findings and conclusions in this article have not been formally 548
disseminated by the Food and Drug Administration and should not be construed to 549
represent any Agency determination or policy. 550
551
552
REFERENCES 553
1. Aaronson, S. A., G. R. Anderson, C. Y. Dunn, and K. C. Robbins. 1974. 554
Induction of type-C RNA virus by cycloheximide: increased expression of virus-555
specific RNA. Proc Natl Acad Sci U S A 71:3941-5. 556
2. Aaronson, S. A., and C. Y. Dunn. 1974. Endogenous C-type viruses of BALB-c 557
cells: frequencies of spontaneous and chemical induction. J Virol 13:181-5. 558
3. Ahmed, M., G. Schidlovsky, K. R. Harewood, M. Manousos, and S. A. 559
Mayyasi. 1977. Expression of Mason-Pfizer and simian type C viruses in the 560
presence of 5-iododeoxyuridine and dexamethasone. J Natl Cancer Inst 58:1515-561
8. 562
4. Anderson, G. W., and P. G. Plagemann. 1995. Expression of ecotropic murine 563
leukemia virus in the brains of C58/M, DBA2/J, and in utero-infected CE/J mice. 564
J Virol 69:8089-95. 565
5. Anderssen, S., E. Sjottem, G. Svineng, and T. Johansen. 1997. Comparative 566
analyses of LTRs of the ERV-H family of primate-specific retrovirus-like 567
elements isolated from marmoset, African green monkey, and man. Virology 568
234:14-30. 569
6. ATCC, posting date. CCL-81 Vero cells. [Online.] 570
7. Bather, R., B. C. Becker, G. Contreras, and J. Furesz. 1985. 571
Heterotransplantation studies with tissue culture cell lines in various animal and 572
in vitro host systems. J Biol Stand 13:13-22. 573
8. Benveniste, R. E., R. Heinemann, G. L. Wilson, R. Callahan, and G. J. 574
Todaro. 1974. Detection of baboon type C viral sequences in various primate 575
tissues by molecular hybridization. J Virol 14:56-67. 576
9. Benveniste, R. E., M. M. Lieber, D. M. Livingston, C. J. Sherr, G. J. Todaro, 577
and S. S. Kalter. 1974. Infectious C-type virus isolated from a baboon placenta. 578
Nature 248:17-20. 579
10. Benveniste, R. E., and G. J. Todaro. 1974. Evolution of type C viral genes: I. 580
Nucleic acid from baboon type C virus as a measure of divergence among primate 581
species. Proc Natl Acad Sci U S A 71:4513-8. 582
11. Boeke, J. D., Stoye, J.P. 1997. Retrotransposons, endogenous retroviruses, and 583
the evolution of retroelements. , p. 343-435. In J. M. Coffin, Hughes, S.H., 584
Varmus, H. (ed.), Retroviruses. Cold Spring Harbor Laboratory, Cold Spring 585
Harbor, New York 586
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
26
12. Boller, K., K. Schonfeld, S. Lischer, N. Fischer, A. Hoffmann, R. Kurth, and 587
R. R. Tonjes. 2008. Human endogenous retrovirus HERV-K113 is capable of 588
producing intact viral particles. J Gen Virol 89:567-72. 589
13. Boyd, A. L., J. G. Derge, and B. Hampar. 1978. Activation of endogenous type 590
C virus in BALB/c mouse cells by herpesvirus DNA. Proc Natl Acad Sci U S A 591
75:4558-62. 592
14. Christensen, T., P. Dissing Sorensen, H. Riemann, H. J. Hansen, M. Munch, 593
S. Haahr, and A. Moller-Larsen. 2000. Molecular characterization of HERV-H 594
variants associated with multiple sclerosis. Acta Neurol Scand 101:229-38. 595
15. Christensen, T., L. Pedersen, P. D. Sorensen, and A. Moller-Larsen. 2002. A 596
transmissible human endogenous retrovirus. AIDS Res Hum Retroviruses 18:861-597
6. 598
16. Coffin, J. M. 1984. Endogenous retroviruses, p. 1109-1203. In R. Weiss, Teich, 599
N., Varmus, H., Coffin, J. (ed.), RNA tumor viruses, 2nd ed, vol. 1. Cold Spring 600
Harbor Laboratory, Cold Spring Harbor. 601
17. Coffin, J. M. 1982. Endogenous retroviruses, p. 1109-1203. In R. Weiss, Teich, 602
N., Varmus, H., Coffin, J. (ed.), RNA tumor viruses: Molecular biology of tumor 603
viruses, second ed, vol. 1. Cold Spring Harbor Laboratories, Cold Spring Harbor, 604
N.Y. 605
18. Contreras, G., R. Bather, J. Furesz, and B. C. Becker. 1985. Activation of 606
metastatic potential in African green monkey kidney cell lines by prolonged in 607
vitro culture. In Vitro Cell Dev Biol 21:649-52. 608
19. Eichberg, J. W., S. S. Kalter, R. L. Heberling, D. A. Lawlor, J. D. Morrison, 609
A. K. Bandyopadhyay, C. C. Levy, S. Yoshinoya, and R. M. Pope. 1981. In 610
vivo activation of the baboon endogenous virus. Proc Soc Exp Biol Med 166:271-611
6. 612
20. Faff, O., A. B. Murray, J. Schmidt, C. Leib-Mosch, V. Erfle, and R. 613
Hehlmann. 1992. Retrovirus-like particles from the human T47D cell line are 614
related to mouse mammary tumour virus and are of human endogenous origin. J 615
Gen Virol 73 ( Pt 5):1087-97. 616
21. Flugel, R. M., H. Zentgraf, K. Munk, and G. Darai. 1978. Activation of an 617
endogenous retrovirus from Tupaia (tree shrew). Nature 271:543-5. 618
22. Furesz, J., A. Fanok, G. Contreras, and B. Becker. 1989. Tumorigenicity 619
testing of various cell substrates for production of biologicals. Dev Biol Stand 620
70:233-43. 621
23. Gibbs, R. A., J. Rogers, M. G. Katze, R. Bumgarner, G. M. Weinstock, E. R. 622
Mardis, K. A. Remington, R. L. Strausberg, J. C. Venter, R. K. Wilson, M. 623
A. Batzer, C. D. Bustamante, E. E. Eichler, M. W. Hahn, R. C. Hardison, K. 624
D. Makova, W. Miller, A. Milosavljevic, R. E. Palermo, A. Siepel, J. M. 625
Sikela, T. Attaway, S. Bell, K. E. Bernard, C. J. Buhay, M. N. Chandrabose, 626
M. Dao, C. Davis, K. D. Delehaunty, Y. Ding, H. H. Dinh, S. Dugan-Rocha, L. 627
A. Fulton, R. A. Gabisi, T. T. Garner, J. Godfrey, A. C. Hawes, J. 628
Hernandez, S. Hines, M. Holder, J. Hume, S. N. Jhangiani, V. Joshi, Z. M. 629
Khan, E. F. Kirkness, A. Cree, R. G. Fowler, S. Lee, L. R. Lewis, Z. Li, Y. S. 630
Liu, S. M. Moore, D. Muzny, L. V. Nazareth, D. N. Ngo, G. O. Okwuonu, G. 631
Pai, D. Parker, H. A. Paul, C. Pfannkoch, C. S. Pohl, Y. H. Rogers, S. J. Ruiz, 632
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
27
A. Sabo, J. Santibanez, B. W. Schneider, S. M. Smith, E. Sodergren, A. F. 633
Svatek, T. R. Utterback, S. Vattathil, W. Warren, C. S. White, A. T. 634
Chinwalla, Y. Feng, A. L. Halpern, L. W. Hillier, X. Huang, P. Minx, J. O. 635
Nelson, K. H. Pepin, X. Qin, G. G. Sutton, E. Venter, B. P. Walenz, J. W. 636
Wallis, K. C. Worley, S. P. Yang, S. M. Jones, M. A. Marra, M. Rocchi, J. E. 637
Schein, R. Baertsch, L. Clarke, M. Csuros, J. Glasscock, R. A. Harris, P. 638 Havlak, A. R. Jackson, H. Jiang, et al. 2007. Evolutionary and biomedical 639
insights from the rhesus macaque genome. Science 316:222-34. 640
24. Grant, R. F., S. K. Windsor, C. J. Malinak, C. R. Bartz, A. Sabo, R. E. 641
Benveniste, and C. C. Tsai. 1995. Characterization of infectious type D 642
retrovirus from baboons. Virology 207:292-6. 643
25. Grolle, P. F., P. Bentvelzen, and M. J. van Noord. 1973. Activation of 644
endogenous C-type on oncornavirus by 5-bromodeoxyuridine in cultured 645
embryonic rat fibroblasts. Biomedicine 19:148-51. 646
26. Haltmeier, M., W. Seifarth, J. Blusch, V. Erfle, R. Hehlmann, and C. Leib-647
Mosch. 1995. Identification of S71-related human endogenous retroviral 648
sequences with full-length pol genes. Virology 209:550-60. 649
27. Heberling, R. L., S. S. Kalter, S. T. Barker, and O. S. Weislow. 1975. Isolation 650
and biological properties of endogenous baboon (Papio cynocephalus) type C 651
viruses. Bibl Haematol:158-60. 652
28. Hefti, E., J. Ip, W. E. Giddens, Jr., and S. Panem. 1983. Isolation of a unique 653
retrovirus, MNV-1, from Macaca nemestrina. Virology 127:309-19. 654
29. Horaud, F. 1992. Absence of viral sequences in the WHO-Vero Cell Bank. A 655
collaborative study. Dev Biol Stand 76:43-6. 656
30. Hronovsky, V., V. Plaisner, and R. Benda. 1978. CV-1 monkey kidney cell line 657
-- a highly susceptible substrate for diagnosis and study of arboviruses. Acta Virol 658
22:123-9. 659
31. Johansen, T., T. Holm, and E. Bjorklid. 1989. Members of the RTVL-H family 660
of human endogenous retrovirus-like elements are expressed in placenta. Gene 661
79:259-67. 662
32. Johnson, J. B., P. D. Noguchi, W. C. Browne, and J. C. Petricciani. 1981. 663
Tumorigenicity of continuous monkey cell lines in in vivo and in vitro systems. 664
Dev Biol Stand 50:27-35. 665
33. Kalter, S. S., and R. L. Heberling. 1976. Discovery of baboon endogenous type 666
C virus. Cancer Res 36:4197. 667
34. Kalter, S. S., R. L. Heberling, A. Hellman, G. J. Todaro, and M. Panigel. 668
1975. C-type particles in baboon placenta. Proc R Soc Med 68:135-40. 669
35. Kato, S., Matsuo, K., Nishimura, N., Takahashi, N., and Takano, T. 1987. 670
The entire nucleotide sequence of baboon endogenous virus DNA: a chimeric 671
genome structure of murine type C and simian type D retroviruses. Jpn. J. Genet. 672
62:127-137. 673
36. Kessel, M., and A. S. Khan. 1985. Nucleotide sequence analysis and enhancer 674
function of long terminal repeats associated with an endogenous African green 675
monkey retroviral DNA. Mol Cell Biol 5:1335-42. 676
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
28
37. Khan, A. S., W. Ma, Y. Ma, A. Kumar, D. K. Williams, J. Muller, H. Ma, and 677
T. A. Galvin. 2009. Proposed algorithm to investigate latent and occult viruses in 678
vaccine cell substrates by chemical induction. Biolgicals 37:196-201. 679
38. Khan, A. S., T. Maudru, A. Thompson, J. Muller, J. F. Sears, and K. W. 680
Peden. 1998. The reverse transcriptase activity in cell-free medium of chicken 681
embryo fibroblast cultures is not associated with a replication-competent 682
retrovirus. J Clin Virol 11:7-18. 683
39. Khan, A. S., J. Muller, and J. F. Sears. 2001. Early detection of endogenous 684
retroviruses in chemically induced mouse cells. Virus Res 79:39-45. 685
40. Khan, A. S., and J. F. Sears. 2001. Pert analysis of endogenous retroviruses 686
induced from K-BALB mouse cells treated with 5-iododeoxyuridine: a potential 687
strategy for detection of inducible retroviruses from vaccine cell substrates. Dev 688
Biol (Basel) 106:387-92; discussion 392-3. 689
41. Khan, A. S., J. F. Sears, J. Muller, T. A. Galvin, and M. Shahabuddin. 1999. 690
Sensitive assays for isolation and detection of simian foamy retroviruses. J Clin 691
Microbiol 37:2678-86. 692
42. Kim, H. S., B. H. Hyun, and O. Takenaka. 2002. Isolation and phylogeny of 693
endogenous retrovirus HERV-F family in Old World monkeys. Brief report. Arch 694
Virol 147:393-400. 695
43. Komurian-Pradel, F., G. Paranhos-Baccala, F. Bedin, A. Ounanian-Paraz, 696
M. Sodoyer, C. Ott, A. Rajoharison, E. Garcia, F. Mallet, B. Mandrand, and 697 H. Perron. 1999. Molecular cloning and characterization of MSRV-related 698
sequences associated with retrovirus-like particles. Virology 260:1-9. 699
44. Langat, D. K., E. O. Wango, G. O. Owiti, E. O. Omollo, and J. M. Mwenda. 700
1998. Characterisation of retroviral-related antigens expressed in normal baboon 701
placental tissues. Afr J Health Sci 5:144-52. 702
45. Lavelle, G., L. Foote, R. L. Heberling, and S. S. Kalter. 1979. Expression of 703
baboon endogenous virus in exogenously infected baboon cells. J Virol 30:390-3. 704
46. Lerche, N. W., and K. G. Osborn. 2003. Simian retrovirus infections: potential 705
confounding variables in primate toxicology studies. Toxicol Pathol 31 706
Suppl:103-10. 707
47. Lerner-Tung, M. B., S. L. Doong, Y. C. Cheng, and G. D. Hsiung. 1995. 708
Characterization of conditions for the activation of endogenous guinea pig 709
retrovirus in cultured cells by 5-bromo-2'-deoxyuridine. Virus Genes 9:201-9. 710
48. Levenbook, I. S., J. C. Petricciani, and B. L. Elisberg. 1984. Tumorigenicity of 711
Vero cells. J Biol Stand 12:391-8. 712
49. Lieber, M. M., and G. J. Todaro. 1973. Spontaneous and induced production of 713
endogenous type-C RNA virus from a clonal line of spontaneously transformed 714
BALB-3T3. Int J Cancer 11:616-27. 715
50. Long, C. W., W. A. Suk, and C. Greenawalt. 1978. Activation of endogenous 716
type C virus by amino acid alcohols. Virology 88:194-6. 717
51. Lower, R., J. Lower, H. Frank, R. Harzmann, and R. Kurth. 1984. Human 718
teratocarcinomas cultured in vitro produce unique retrovirus-like viruses. J Gen 719
Virol 65 ( Pt 5):887-98. 720
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
29
52. Lyden, T. W., P. M. Johnson, J. M. Mwenda, and N. S. Rote. 1994. 721
Ultrastructural characterization of endogenous retroviral particles isolated from 722
normal human placentas. Biol Reprod 51:152-7. 723
53. Ma, Y. K., and A. S. Khan. 2009. Evaluation of different RT enzyme standards 724
for quantitation of retroviruses using the single-tube fluorescent product-enhanced 725
reverse transcriptase assay. J Virol Methods. 726
54. Manohar, M., B. Orrison, K. Peden, and A. M. Lewis, Jr. 2008. Assessing the 727
tumorigenic phenotype of VERO cells in adult and newborn nude mice. 728
Biologicals 36:65-72. 729
55. Marracci, G. H., R. D. Kelley, K. Y. Pilcher, L. Crabtree, S. M. Shiigi, N. 730
Avery, G. Leo, M. C. Webb, L. M. Hallick, M. K. Axthelm, and et al. 1995. 731
Simian AIDS type D serogroup 2 retrovirus: isolation of an infectious molecular 732
clone and sequence analyses of its envelope glycoprotein gene and 3' long 733
terminal repeat. J Virol 69:2621-8. 734
56. Martin, M. A., T. Bryan, T. F. McCutchan, and H. W. Chan. 1981. Detection 735
and cloning of murine leukemia virus-related sequences from African green 736
monkey liver DNA. J Virol 39:835-44. 737
57. Martin, M. A., T. Bryan, S. Rasheed, and A. S. Khan. 1981. Identification and 738
cloning of endogenous retroviral sequences present in human DNA. Proc Natl 739
Acad Sci U S A 78:4892-6. 740
58. Mayer, R. J., R. G. Smith, and R. C. Gallo. 1974. Reverse transcriptase in 741
normal rhesus monkey placenta. Science 185:864-7. 742
59. Nandi, J. S., S. Van Dooren, A. K. Chhangani, and S. M. Mohnot. 2006. New 743
simian beta retroviruses from rhesus monkeys (Macaca mulatta) and langurs 744
(Semnopithecus entellus) from Rajasthan, India. Virus Genes 33:107-16. 745
60. Paul, J. 1975. Cell and tissue culture, 5th ed. Churchill Livingstone, Edinburgh, 746
London and New York. 747
61. Power, M. D., P. A. Marx, M. L. Bryant, M. B. Gardner, P. J. Barr, and P. A. 748
Luciw. 1986. Nucleotide sequence of SRV-1, a type D simian acquired immune 749
deficiency syndrome retrovirus. Science 231:1567-72. 750
62. Rabin, H., C. V. Benton, M. A. Tainsky, N. R. Rice, and R. V. Gilden. 1979. 751
Isolation and characterization of an endogenous type C virus of rhesus monkeys. 752
Science 204:841-2. 753
63. Rasheed, S., J. Bruszewski, R. Rongey, P. Roy-Burman, H. P. Charman, and 754
M. B. Gardner. 1976. Spontaneous release of endogenous ecotropic type C virus 755
from rat embryo cultures. J Virol 18:799-803. 756
64. Reitz, M. S., N. R. Miller, F. Wong-Staal, R. E. Gallagher, R. C. Gallo, and 757
D. H. Gillespie. 1976. Primate type-C virus nucleic acid sequences (woolly 758
monkey and baboon types) in tissues from a patient with acute myelogenous 759
leukemia and in viruses isolated from cultured cells of the same patient. Proc Natl 760
Acad Sci U S A 73:2113-7. 761
65. Seifarth, W., H. Skladny, F. Krieg-Schneider, A. Reichert, R. Hehlmann, and 762
C. Leib-Mosch. 1995. Retrovirus-like particles released from the human breast 763
cancer cell line T47-D display type B- and C-related endogenous retroviral 764
sequences. J Virol 69:6408-16. 765
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
30
66. Serafino, A., E. Balestrieri, P. Pierimarchi, C. Matteucci, G. Moroni, E. 766
Oricchio, G. Rasi, A. Mastino, C. Spadafora, E. Garaci, and P. S. Vallebona. 767 2009. The activation of human endogenous retrovirus K (HERV-K) is implicated 768
in melanoma cell malignant transformation. Exp Cell Res 315:849-62. 769
67. Sherwin, S. A., and G. J. Todaro. 1979. A new endogenous primate type C virus 770
isolated from the Old World monkey Colobus polykomos. Proc Natl Acad Sci U 771
S A 76:5041-5. 772
68. Shih, A., E. E. Coutavas, and M. G. Rush. 1991. Evolutionary implications of 773
primate endogenous retroviruses. Virology 182:495-502. 774
69. Smith, C. A., and H. D. Moore. 1988. Expression of C-type viral particles at 775
implantation in the marmoset monkey. Hum Reprod 3:395-8. 776
70. Sonigo, P., C. Barker, E. Hunter, and S. Wain-Hobson. 1986. Nucleotide 777
sequence of Mason-Pfizer monkey virus: an immunosuppressive D-type 778
retrovirus. Cell 45:375-85. 779
71. Stoye, J. P. 2001. Endogenous retroviruses: still active after all these years? Curr 780
Biol 11:R914-6. 781
72. Stromberg, K., and R. Benveniste. 1983. Efficient isolation of endogenous 782
rhesus retrovirus from trophoblast. Virology 128:518-23. 783
73. Stromberg, K., and R. I. Huot. 1981. Preferential expression of endogenous 784
type C viral antigen in Rhesus placenta during ontogenesis. Virology 112:365-9. 785
74. Swanson, S. K., S. J. Mento, C. Weeks-Levy, B. D. Brock, K. J. Kowal, R. E. 786
Wallace, M. B. Ritchey, and F. R. Cano. 1988. Characterization of Vero cells. J 787
Biol Stand 16:311-20. 788
75. Todaro, G. J., R. E. Benveniste, C. J. Sherr, J. Schlom, G. Schidlovsky, and 789
J. R. Stephenson. 1978. Isolation and characterization of a new type D retrovirus 790
from the asian primate, Presbytis obscurus (spectacled langur). Virology 84:189-791
94. 792
76. Todaro, G. J., R. E. Benveniste, S. A. Sherwin, and C. J. Sherr. 1978. MAC-1, 793
a new genetically transmitted type C virus of primates: "low frequency" activation 794
from stumptail monkey cell cultures. Cell 13:775-82. 795
77. Todaro, G. J., M. M. Lieber, R. E. Benveniste, and C. J. Sherr. 1975. 796
Infectious primate type C viruses: Three isolates belonging to a new subgroup 797
from the brains of normal gibbons. Virology 67:335-43. 798
78. Todaro, G. J., C. J. Sherr, and R. E. Benveniste. 1976. Baboons and their close 799
relatives are unusual among primates in their ability to release nondefective 800
endogenous type C viruses. Virology 72:278-82. 801
79. Todaro, G. J., C. J. Sherr, A. Sen, N. King, M. D. Daniel, and B. 802
Fleckenstein. 1978. Endogenous New World primate type C viruses isolated 803
from owl monkey (Aotus trivirgatus) kidney cell line. Proc Natl Acad Sci U S A 804
75:1004-8. 805
80. van der Kuyl, A. C., J. T. Dekker, and J. Goudsmit. 1999. Discovery of a new 806
endogenous type C retrovirus (FcEV) in cats: evidence for RD-114 being an 807
FcEV(Gag-Pol)/baboon endogenous virus BaEV(Env) recombinant. J Virol 808
73:7994-8002. 809
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
31
81. van der Kuyl, A. C., J. T. Dekker, and J. Goudsmit. 1995. Distribution of 810
baboon endogenous virus among species of African monkeys suggests multiple 811
ancient cross-species transmissions in shared habitats. J Virol 69:7877-87. 812
82. van der Kuyl, A. C., J. T. Dekker, and J. Goudsmit. 1995. Full-length 813
proviruses of baboon endogenous virus (BaEV) and dispersed BaEV reverse 814
transcriptase retroelements in the genome of baboon species. J Virol 69:5917-24. 815
83. van der Kuyl, A. C., R. Mang, J. T. Dekker, and J. Goudsmit. 1997. Complete 816
nucleotide sequence of simian endogenous type D retrovirus with intact genome 817
organization: evidence for ancestry to simian retrovirus and baboon endogenous 818
virus. J Virol 71:3666-76. 819
84. van Steenis, G., and A. L. van Wezel. 1981. Use of the ATG-treated newborn 820
rat for in vivo tumorigenicity testing of cell substrates. Dev Biol Stand 50:37-46. 821
85. Victoria, J. G., C. Wang, M. S. Jones, C. Jaing, K. McLoughlin, S. Gardner, 822
and E. L. Delwart. Viral nucleic acids in live-attenuated vaccines: detection of 823
minority variants and an adventitious virus. J Virol 84:6033-40. 824
86. Weiss, R. A. 2000. Ancient and modern retroviruses. Acta Microbiol Immunol 825
Hung 47:403-10. 826
87. Yasumura Y, K. Y. 1963. Studies on SV40 in tissue culture - preliminary step 827
for cancer research in vitro. Nihon Rinsho 21:1201-1215. 828
829
830
831
832
833
834
835
836
837
838
839
840
841
842
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
1
FIGURE LEGENDS 1
2
FIG. 1. VERO cell growth curves. Cells were planted in 25-cm2 flasks and total viable 3
cells were counted at various times post planting: 16 h, 20 h, 24 h, 28 h, 40 h, 44 h, 48 h, 4
52 h, and 64 h post planting. The initial number of cells planted are indicated at 0 h: 0.5 x 5
106, -- ; 1 x 10
6, --. 6
7
FIG. 2. Drug dose evaluation and PERT activity. Drug dose range for IUdR (A), AzaC 8
(B), and NaBut (C) was determined by evaluating the VERO cell viability after drug 9
treatment with varying concentrations for 48 h. Cell toxicity was determined at day 0 10
(day of drug removal) (open bars) and cell recovery was determined on day 3 (closed 11
bars) and expressed as the percent cell confluence ratio (percent of the ratio of the total 12
number of viable cells in the drug treated flask and the total number of viable cells in a 13
confluent untreated 25-cm2 flask). Cells (1 x 10
6) were planted for 16 h before the drug 14
was added: IUdR: 100 800 g/ml, shown (50 3000 g/ml tested); AzaC: 0 40 15
g/ml; and NaBut: 0 5 mM (6 mM, not shown). High cell toxicity with the 800 g/ml 16
dose of IUdR was due to 0.01 N NH4OH present in the drug. Filtered supernatant from 17
day 3 was analyzed by STF-PERT and results are indicated (-o-). No RT activity was 18
detected in untreated cells. 19
20
FIG. 3. Evaluation of virus induction from drug-treated VERO cells. VERO cells were 21
treated under optimized cell culture conditions and drug concentrations and evaluated for 22
latent virus induction. Cells (1.0 x 106) were planted in 25-cm
2 flasks for 16 h at which 23
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
2
time drug was added [IUdR (200 g/ml), AzaC (1.25 g/ml) and NaBut (3 mM)]. Forty-24
eight hours later, filtered supernatant was collected (day 0) before removing the drug, 25
cells were washed, refed with fresh medium. Supernatants were collected daily with 26
medium change, and filtered for STF-PERT assay. Control cell cultures were grown in 27
medium without drug. 28
29
FIG. 4. RT-PCR analysis of drug-treated VERO cells. RNAs were prepared from cells 30
and from filtered supernatant of AzaC-treated cells for RT-PCR using SERV/SRV 31
consensus primers (A), BaEV primers (B), and -actin primers (C). RNAs from untreated 32
cells were collected on day 2 after planting the cells (lanes 1) and from drug-treated cells 33
on day 4 (medium was changed on day 1 after drug removal) using AzaC, 1.25 g/ml, 34
IUdR, 200 g/ml, and NaBut, 3 mM) (lanes 2 4, respectively). Results using 35
SERV/SRV primers from the LTR-gag, pol and env regions are shown after the 1st round 36
of PCR with cellular RNAs and with 10x filtered supernatant RNAs (A). Results using 37
BaEV primers from the gag, pol, and env regions are shown after 1st round of PCR with 38
cellular RNAs; in the case of 1000x filtered supernatant RNAs, results are shown from 1st 39
round of PCR using pol primers and from 2nd
round of PCR using gag and env primers 40
(B). Virus identity was determined by nucleotide sequence analysis. The absence of 41
contaminating cellular DNA in the cellular RNA preparation was demonstrated by RT-42
PCR with -actin primers without adding RT (-). No fragment was amplified with -43
actin primers from 10x supernatant RNAs (C) or from 1000x supernatant preparation (not 44
shown). 45
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
3
FIG. 5. Nucleotide sequence analysis of BaEVagm-VERO env. BaEV env-related 46
clones 519 and 524, isolated from VERO cells in this study, were aligned with SERVbab 47
and BaEV, as well as with SERVagm-VERO, which was also obtained in this study using 48
consensus SERV/SRV primers). Different nucleotides are shown; dashes indicate 49
identity; dots indicate missing bases. Nucleotide positions are indicated: SERVbab, based 50
upon simian type D virus 1 (accession no. U85505); BaEV, according to the published 51
BaEV sequence of Kato et al (35); 519, 524 and SERVagm-VERO, based upon start of 52
the DNA sequences shown. 53
54
FIG. 6. TEM analysis. Ultrastructural evaluation of filtered, ultracentrifuged supernatant 55
from normal (without drug treatement) VERO cells (A), and AzaC-treated VERO cells 56
(B). Arrow indicates retrovirus-like particle. Bar = 100 nm. 57
58
FIG. 7. Infectivity analysis of drug-induced retrovirus from VERO cells. VERO cells (1 59
x 106) were planted in 25 cm
2 flasks for 16 h and treated with 1.25 g/ml AzaC or 200 60
g/ml IUdR for 48h. In the case of one flask, medium was replaced daily with fresh 61
medium and filtered supernatant collected for STF-PERT assay (D). In the case of the 62
other flasks, which were used in infectivity/coculture studies, medium was changed on 63
day 0 and d 1; on day 4 cells and supernatant were collected, pooled and used for 64
coculture with target cells at predetermined ratios for equivalent growth of test and target 65
cells (see materials and methods): Cf2Th cells (A); A204 cells (B); Raji cells (C). 66
Filtered supernatant was collected from the cocultured cells starting at the first cell 67
passage on day 4 post coculture until its termination at day 32. Samples were assayed in 68
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
4
the STF-PERT assay. Results from the AzaC-treated cells and cocultures are shown. 69
Similar results were seen in the case of IUdR-treated cells, where the induced peak PERT 70
activity was 20-fold less. 71
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
1
Table 1. Comparative nucleotide sequence analysis of cloned SERVagm-VERO DNAsa.
______________________________________________________________________
Cloned DNAsb Position (nt)
c Nucleotide Sequence Identity (%)
d
SRV-1e SRV-2
f MPMV
g SERVbab
h
______________________________________________________________________
LTR-gag (4) 395 - 947 77-78 81 78-79 95-96
pol (6) 4047 - 4656 74-75 76 73 95-96
env (4) 6501 - 7048 60-61 64-65 61-62 94-95
______________________________________________________________________
aDNAs were obtained by RT-PCR from 1000x supernatant of AzaC-treated VERO
bregions of PCR amplification; number of cloned DNAs analyzed are indicated in
parenthesis
cnucleotide positions according to the published SERV sequence of van der Kuyl et al
(83)
drange of values indicate results obtained from analysis of individual clones
eaccession no. M11841; simian SRV-1 type D retrovirus (L47.1) (61)
faccession no. M16605; simian retrovirus 2 (55)
gaccession no. M12349; Simian Mason-Pfizer D-type retrovirus (MPMV/6A) (70)
haccession no. U85505; simian type D virus 1 (83)
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
2
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
1
Table 2. Comparative nucleotide sequence analysis of cloned BaEVagm-VERO DNAsa.
______________________________________________________________________
Cloned DNAsb Position (nt)
c Nucleotide Sequence Identity (%)
d
SERVbabe
PcEVf RD114
g BaEV
h
______________________________________________________________________
gag (4) 1135 - 1420 0 83-86 73-74 83-86
pol (3) 3505 - 3871 0 88-90 85-87 95-97
env (5) 6281 - 6488 92-94 0 69-71 79-81
_______________________________________________________________________
aDNAs were obtained by RT-PCR from 1000x supernatant of AzaC-treated VERO
bregions of PCR amplification with number of cloned DNAs that were analyzed
indicated in parenthesis
drange of values indicate results obtained from analysis of individual clones
dnucleotide positions according to the published BaEV sequence of Kato et al (35)
eaccession no. U85505; simian type D virus 1 (83)
faccession no. AF142988; PcEV
gaccession no. AB559882; RD114
haccession no. D10032; BaEV
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
0 20 40 60 80105
106
Time (hours)
Via
ble
ce
ll n
um
be
r
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
0 100 200 400 8000
25
50
75
100
125
150
175
200
IUdR (g/ml)
Cell
Co
nflu
en
ce R
ati
o (
%)
0
25
50
75
100
125
150
175
200
0
5
10
15
100 200 400 800
IUdR (g/ml)
Cell
Co
nflu
en
ce R
ati
o (
%) P
ER
T A
ctiv
ity (p
U/
l, -o-)
0.00
00
0.31
25
0.62
50
1.25
00
2.50
00
5.00
00
10.0
000
20.0
000
40.0
000
0
25
50
75
100
125
150
175
200
AzaC (g/ml)
Ce
ll C
on
flu
en
ce
Ra
tio
(%
)
0
25
50
75
100
125
150
175
200
0
100
200
300
400
500
0.31
25
0.62
51.25 2.
55.0
10.0
20.0
40.0
AzaC (g/ml)
Cell
Co
nflu
en
ce R
ati
o (
%) P
ER
T A
ctiv
ity (p
U/
l, -o-)
0 2 3 4 50
25
50
75
100
125
150
175
200
NaB (mM)
Cell C
on
flu
en
ce R
ati
o (
%)
A.
B.
C.
DAY O DAY 3
0
25
50
75
100
125
150
175
200
0.0
0.2
0.4
0.6
0.8
1.0
2 3 4 5
NaB (mM)
Cell
Co
nflu
en
ce R
ati
o (
%) P
ER
T A
ctiv
ity (p
U/
l, -o-)
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
0
100
200
300
400
500
AzaC
Untreated
IUdR
NaBut
0 1 2 3 4 5
Days post drug-treatment
PE
RT
Acti
vit
y (
pU
/ l)
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
425 bp
1 2 3 4
- + - + - + - +
1 2 3 4
RT + + + +
pol367 bp
1 2 3 4 1 2 3 4
A. B.
LTR-gag 553 bp
pol610 bp
env548 bp
Supernatant Cellular
gag286 bp
1 2 1 2 3 4
env203 bp
Supernatant Cellular
C. Supernatant Cellular
-actin
590 bp
367 bp
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
SERVbab CTATGCAGGTTTTGATGACCCTCGTAAAGCGAGAGAATTAATACGAAAACAATACGGCCA 6121
SERVagm --------------G---------------A----G----C------------------- 60
519 ---C--G--G-----C--------------A----G----C------------------- 60
524 ---C--G--G-----C--------------A-A--G----C----------------T-- 60
BaEV ---C-G-G-----C--------C-----C-T----C--G---A---G-G---T----G 6341
SERVbab GCCTTGTGACTGCAGCGGAGGACAAATATCTGAACCTCCGTCAGACAGAATCACCCAGGT 6181
SERVagm ---------------A--G----------------------------------------- 120
519 ---------------A--G-------------------------....------------ 116
524 ---------------A--G-------------------------....----G------- 116
BaEV A--A--C--T---------------G-G--C--G--C-----------GG---GT--A-- 6401
SERVbab GACTTGCTCGGGCAAGACAGCGTACTTAATGCCAGACCAGTCGTGGAAATGTAAGTCTAC 6241
SERVagm ------------------------------------------------------------ 180
519 ------------------------------------------------------------ 176
524 -------------------------------------T---------------------- 176
BaEV ---------A-----------T-----------C-----AAGA--------------A-T 6461
SERVbab CCCAAGAGACACCTCCCCTAGCGGGCC 6268
SERVagm ---------------G----AT----- 207
519 ------------------A-------- 203
524 ------------------A-------- 203
BaEV T----A------------A-------- 6488
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
A. B.
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/
-
0
100
200
300
Cf2Th + untreated-VERO
Cf2Th + AzaC-VERO
Cf2Th
Days post coculture
PE
RT
Acti
vit
y (
pU
/ l)
4 6 8 11 15 20 25 32
0
100
200
300 A204 + AzaC-VERO
A204 + untreated-VEROA204
Days post coculture
PE
RT
Acti
vit
y (
pU
/ l)
4 6 8 11 15 20 25 32
0
100
200
300 Raji + Azac-VERO
Raji
Raji + untreated-VERO
Days post coculture
PE
RT
Acti
vit
y (
pU
/ l)
4 6 8 11 15 20 25 32
0
100
200
300AzaC-VERO
0 2 4 6 8 111315 182022 252729
untreated-VERO
3234
Days post drug treatment
PE
RT
Acti
vit
y (
pU
/ l)
A. B.
C. D.
on April 30, 2018 by guest
http://jvi.asm.org/
Dow
nloaded from
http://jvi.asm.org/