Chemoprotective Effects of Overexpression of Milnesium tardigradum Rad51 Gene in HUVEC Cells

Christopher Parker, Department of Biological Science, York College

Project SummaryDamage to DNA in humans from environmental factors such as radiation promotes tumorigenesis. Tardigrades have a much higher resistance to DNA damaging agents such as radiation through their DNA repair and protection mechanisms. One of the most significant mechanisms is Rad51 which promotes DNA repair through homologous recombination. Through isolation of tardigrade RNA, a plasmid could be built containing the tardigrade Rad51 gene which could be then transfected into human cells. In this study, tardigrade RNA was isolated and the Rad51 gene was successfully amplified. The tardigrade Rad51 gene if expressed in HUVEC cells could encourage homologous recombination resulting in a decrease of cell death in the presence of reagents that cause double stranded breaks in DNA such as doxorubicin.

IntroductionTardigrades have been able to survive in a wide array of hostile environments including high radiation through DNA protection and repair systems.

Rad51 is thought to be one of the most significant mechanisms in the tardigrades ability to survive in radiation because it repairs double stranded breaks (DSB) through homologous recombination.

Rad51 displaces RPA from ssDNA and guides recombination mediators BRCA1 and BRCA2. The Rad51 protein is able to catalyze strand exchange interactions between sister chromatids in order to repair DSB in DNA.

Radiation as well as cisplatin, miomycin C, and doxorubicin all cause DSB in DNA. DNA damage from these reagents can promote tumorigenesis. Rad51 can suppress the homologous recombination repair system when it is mutated and prone to make mistakes.

Humans have a homolog of the Rad51 gene although it does not provide the same amount of resistance. The expression of the tardigrade Rad51 gene in human cells could provide a greater resistance to reagents that cause DSB in DNA.

Review of LiteratureStudy proposed Rad51 is one of the most significant components in the tardigrade DNA repair mechanisms. Sequenced Rad51 gene and is where primer design for this study was obtained (Beltrán-Pardo et al. 2013).

Review of Literature (continued)Rad51 was showed only to be effective in the presence of reagents that cause DSB such as cisplatin and mitomycin C. The study also showed that the down regulation of Rad51 gave less resistance to these reagents (Slupianek et al. 2001).

Mouse MmRad51 over and under expressed in CHO cells negative for P53. The study showed that CHO cells overexpressing the MmRad51 gene had a lower frequency of tumors and the tumors grew slower compared with the CHO cells not expressing MmRad51 (Bertrand et al. 2003).

Figure1. shows the that the overexpression ofRad51 had a lower percent of CHO cells with tumors compared to those that had Rad51 Inhibited (Bertrand et al. 2003).

Hamster Rad51 was overexpressed in CHO cells and exposed to increasing amounts of radiation. The study showed that in the late S and G2 phase the overexpressed cells had a greater resistance to radiation exposure. This was concluded to be caused by the lack of formation of the sister chromatids in the earlier phases (Vispe et al. 1998).

Soft tissue sarcoma cells showed a lower resistance to doxorubicin, a reagent that causes DBS in DNA, when anti Rad51 siRNA was present (Hannay et al. 2007).

Hypotheses/ObjectivesThere will be a significantly less amount of dying HUVEC cells expressing Rad51 than the amount of dying wild type HUVEC cells in the presence of higher concentrations of doxorubicin.

HUVEC cells expressing the Rad51 gene will be able to survive a significantly greater dosage of doxorubicin than wild type HUVEC cells.

Isolate RNA from Milnesium tardigradum using TRIzol

Create cDNA library using Reverse Transcription kit

Amplify Rad51 by doing a PCR using primer sets RadMT-70F/RadMT1135R and 366F/Rad-Ext-R

RadMT-70F: CACCTCTCGTGAGTTCTTCGCTTG, RadMT1135R: CCGGTAGACACGGAGAATCGTAG, 366F: AAGATGGTTCCGATGGGCTTC, Rad-Ext-R: CCTCATTAGCGATCGCGAACA

Inset Rad51 gene into G418 plasmid

Transform E. coli and select for plasmid using ampicillin

Isolate plasmid and transfect HUVEC cells using Liptofectamine2000

Culture transformed HUVEC cells and control HUVEC cells in 0.1, 0.5, 1.0, and 2.0 µmol of doxorubicin

Chemoprotective effects of Rad51 will be quantified by an MTS assay every four hours for forty-eight

hours. The amount of viable cells will be compared between groups of the same concentration.

Preliminary Results 100bp L1P1 L1P2 L1C L2P1 L2P2 L2C 500bp

Figure 2. G418 plasmid contains EGFP and ampicillin Resistance (Pierce, 2014).

Figure 3. a gel after PCR reaction. L refers to which library I used and the P is for which primer set with RadMT being 1 and 366 being 2.The 100bp ladder is at the beginning and the 500bp ladder is at the end. The two bands in lanes 4 and 7 are 18S control. The band in lane 6 is the Rad51 gene amplified using primers 336F and Rad-Ext-R. The band’s size was expected to be around 756 bp. The PCR reaction used 95˚C to denature,56˚C to anneal, and 72˚ to extend.

Expected Results

Figure 4. Possible result for comparison of control andRad51 expressed HUVEC cells over the course of fourty-eight hours in 1.0 µmol of doxorubicin. Rad51 HUVECCells would be expected to have greater resistance.

Literature CitedBeltrán-Pardo, Eliana A., Ingemar Jönsson, Andrzej Wojcik, Siamak Haghdoost, Rosa María Bermúdez Cruz, and Jaime E. Bernal Villegas."Sequence Analysis of the DNA-repair Gene Rad51 in the Tardigrades Milnesium Cf. Tardigradum, Hypsibius Dujardini and Macrobiotus Cf. Harmsworthi." Journal of Limnology 72.1s (2013): 80-91.

Bertrand, Pascale, Sarah Lambert, Christophe Joubert, and Bernard S. Lopez. "Overexpression of Mammalian Rad51 Does Not Stimulate Tumorigenesis While a Dominant-negative Rad51 Affects Centrosome Fragmentation, Ploidy and Stimulates Tumorigenesis, in P53-defective CHO Cells." Oncogene 22.48 (2003): 7587-592.

Hannay, J. A.f., J. Liu, Q.-S. Zhu, S. V. Bolshakov, L. Li, P. W.t. Pisters, A. J.f. Lazar, D. Yu, R. E. Pollock, and D. Lev. "Rad51 Overexpression Contributes to Chemoresistance in Human Soft Tissue Sarcoma Cells: A Role for P53/activator Protein 2 Transcriptional Regulation."Molecular Cancer Therapeutics 6.5 (2007): 1650-660.

Pierce, Andrew. "PGCGFP-G418 (Plasmid #31264)." Addgene: PGCGFP-G418. Addgene,

Slupianek, Artur, Christoph Schmutte, Gregory Tombline, Malgorzata Nieborowska-Skorska, Grazyna Hoser, Michal O. Nowicki, Andrew J. Pierce, Richard Fishel, and Tomasz Skorski. "BCR/ABL Regulates Mammalian RecA Homologs, Resulting in Drug Resistance."Molecular Cell 8.4 (2001): 795-806.

Vispe, S., C. Cazaux, C. Lesca, and M. Defais. "Overexpression of Rad51 Protein Stimulates Homologous Recombination and Increases Resistance of Mammalian Cells to Ionizing Radiation." Nucleic Acids Research26.12 (1998): 2859-864.

AcknowledgementsI would like to thank Dr. Ronald Kaltreider for being my mentor and aiding mein the development of my thesis.

http://apod.nasa.gov/apod/ap130306.html

http://www.rcsb.org/pdb/explore.do?structureId=1SZP

0 4 8 12 16 20 24 28 32 36 40 44 480

20

40

60

80

100

Time (hours)

% V

iabl

e C

ells

Rad51Control

Methods