chikungunya rna
TRANSCRIPT
-
8/10/2019 Chikungunya Rna
1/8
-
8/10/2019 Chikungunya Rna
2/8
classical symptoms of CHIK [15 ]. Samples were
obtained from the outpatient department of three Pri-
mary Health Centres (Olavanna, Beypore and Chaliyum)
in the district. 2-5ml of whole blood was collected from
patients who were clinically diagnosed with CHIK and
had a history of fever of 1-5 days duration. Samples
were transported to the laboratory in wet-ice; serum
was separated and stored in aliquots at -80C. Standard
ethical and bio-safety guidelines were followed, and
informed consent was obtained from all the patients
prior to blood withdrawal.
For virus detection in mosquitoes, households of
CHIK patients, whose serum samples were confirmed in
the laboratory by RT-PCR, were subsequently visited
and larval sampling was done. Stagnant water collected
in discarded articles such as coconut shells, broken
earthern-wares, plastic bottles and damaged drains were
searched for Ae. albopictus larvae. Third and fourth
instar larvae and pupae were phenotypically identified
in situ using standard keys and these were collected and
transferred to containers with fresh water. Four house-
holds each in Olavanna and Chaliyum, and three house-
holds in Beypore were surveyed. Larvae and pupae
collected from each location were made into a single
pool. In the laboratory, these three pools were indepen-
dently reared in bowls with water, kept in mosquito
cages at an ambient temperature of 25-30C and a rela-
tive humidity 60-70%. The newly emerged adult mosqui-
toes were collected and frozen at -20C for 30 minutes.
Whole-mosquito tissue extracts were prepared by
Figure 1 Map of Kerala showing the location of sample collection areas.
Niyas et al. Virology Journal2010, 7 :189
http://www.virologyj.com/content/7/1/189
Page 2 of 8
-
8/10/2019 Chikungunya Rna
3/8
homogenizing pools of adult mosquitoes [each pool with
30 individual mosquitoes (both males and females)
representing a single location]. Frozen mosquitoes were
homogenized in 700 l of Dulbecos Modified Eagles
Medium (DMEM) using a micropestle. These were then
clarified by centrifugation at 800 gat 4C and steri-
lized by filtering through 0.2 M membrane filter
(Millex GV, Millipore) and used for RNA isolation.
RNA isolation from the 70 patient serum samples and
the three extracts from mosquito samples were carried
out using QIAamp Viral RNA Mini kit (Qiagen, GmBH,
Hilden) exactly as per the kit protocol. Single-step RT
PCR was done using 10 l of the isolated RNA from all
the samples using Fidelitaq RT-PCR kit (USB, Cleveland,
Ohio), as previously described [14]. PCR primers (Table
1; Figure 2) for CHIKV detection PCR were designed
based on earlier reports [16 ] and on the conserved
genomic regions of local strains of CHIKV [14]. Theconditions for RT PCR were: a reverse transcription
step at 50C for 45 min; followed by 35 cycles of ther-
mal cycling, which included denaturation at 95C for 1
min, annealing at 55C for 1 min, and an extension at
68C for 2 min. Extreme care was taken to avoid PCR-
contamination, by carrying out the pre-and post amplifi-
cation steps in laboratories located in separate buildings
and also by including a non-template control in all
amplifications.
For nucleotide sequencing and phylogenetic analysis,
15 clinical samples and all the three mosquito-derived
samples were used. Only clinical samples that gave a
high intensity amplicon in the primary detection PCR
were selected to ensure that sufficient DNA would be
available for sequencing reactions. Five clinical samples
each from Olavanna, Beypore and Chaliyum were used,
making a total of 15 samples. Selected regions of the
CHIKV genome (nucleotide position, with respect to
S27 reference sequence AF369024: nsP2 3134-3636; E2
8832-9332; E1 10246-10539; Table 1; Figure 2) were
amplified by RT PCR as described above using new sets
of primers (Table1; Figure 2). These specific regions
were chosen as they showed nucleotide variability and
novel mutations in our previous study with the local
strains of CHIKV [14], making them suitable for phylo-
genetic analysis. Purified PCR products were directly
subjected to automated DNA sequencing as per manu-
facturers directions in an ABI-Prism 3730 Genetic ana-
lyzer (PE Applied Biosystems, Foster City, CA). The
sequences were aligned with corresponding CHIKV
sequences obtained from NCBI GenBank using Clustal
W program of MEGA3.1 [17] software, with Kimura-2
distance correction. To get representation from different
gene segments in the evolution of the CHIKV strains,
the partial sequences of nsP2, E2 and E1 genes werearranged in tandem to obtain a 1311 bp sequence (Fig-
ure 3a), which was then used for phylogenetic analysis.
The phylogeny was reconstructed by Neighbor-Joining
method with 10,000 bootstrap replications using the
MEGA 3.1 program. 100 L of the mosquito extracts or
patient serum samples were used for CHIKV isolation
in confluent monolayer of Vero cells cultured in 75cm2
flasks, as per standardized protocols [14]. The titration
of CHIKV in the infected cultures was done by plaque
assay using a carboxymethyl-cellulose overlay method
[18] on Vero cells.
CHIKV RNA was detected in 49 out of the 70 patient
samples (70%) and in adult mosquitoes derived from lar-
vae from Chaliyum and Olavanna by RT PCR (Figure4).
All the three mosquito derived samples were positive for
CHIKV, as indicated by cytopathic effects and RT PCR
(Figure4), in the 3rd passage of virus isolation in Vero
Table 1 Details of the primers used for PCR amplification in the study
Primer Name Sequence (5!3); location with respect to S27 sequence(GenBank AccessionAF369024)
Target Ta(C)
Amplicon size Reference
RT PCR for CHIKV detection in patient and adult mosquitoes derived from larvae
E1 F tacccatttatgtggggc (10246-10263) 52 294bp [16]
E1 R gcctttgtacaccacgatt (10539-10521) E1
NSP2F tgccatgggaataatagagactccg (1682-1699)
ChR6 gcgagtcaaccgtacgtgcag (2390-2370) nsP2 55 709bp This study
ChF27 gtcccctaagagacacattg (11486-11505)
ChR28 tacgtccctgtgggttcggagaat (11798-11780) 3NTR 52 313bp [14]
RT PCR of partial sequences CHIKV genes for sequencing and phylogenetic analysis
E1Fseq1 gctccgcgtcctttacc (10389-10405)
E1Rseq1 atggcgacgcccccaaagtc (10943-10924) E1 55 555bp This study
ChF21 gggacacttcatcctggc (8832-8849) [14]
ChR22 acatttgccagcggaaac (9332-9315) E2 55 501bp
ChF8 cctatcctcgaaacagcg (3134-3151) [14]
ChR9 gtgactctcttagtaggc (3636-3619) nsP2 45 503bp
Niyas et al. Virology Journal2010, 7 :189
http://www.virologyj.com/content/7/1/189
Page 3 of 8
http://www.ncbi.nlm.nih.gov/pubmed/369024?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/369024?dopt=Abstract -
8/10/2019 Chikungunya Rna
4/8
cell monolayer cultures. In plaque assays, the culture
supernatants from these infected cells had a virus titre
of 2.0 1011 , 3.3 1010 , 1.4 1010 plaque forming
units (pfu) ml-1 for samples from Olavanna, Chaliyum
and Beypore, respectively.
Analysis of the partial nucleotide sequences of nsP2
(378 bp; position 3246-3623), E1 (position 10427-10931)
and E2 (position 8893- 9320) revealed a few random
nucleotide changes in the CHKV isolates studied (Addi-
tional File 1) with respect to the corresponding
sequences of the previous isolates from Kerala [14]. The
nucleotide change T3297C observed in the 2007 & 2008Kerala isolates, causing an L539 S mutation in the nsP2
protein, was absent in CHIKV strains of the present
outbreak. A novel substitution (T3296C) was consis-
tently o bs erved in a f ew s trains f ro m patients
(RGCB711, RGCB730, and RGCB755) and in all the
three isolates from mosquito samples. However, this was
a synonymous substitution. The E1 sequence of all the
strains had the C10670T substitution resulting in the
A226V mutation identified in the recent isolates of
CHIKV [3,14]. Another new substitution (E1 G10864A)
detected consistently in all the mosquito-derived strains
and two of the clinical isolates (RGCB711 & RGCB755)can result in an amino acid change of V291I. Two
nucleotide substitutions (A9114G and T9170A) were
observed in the E2 coding region of all the strains stu-
died from the outbreak. The latter substitution resulted
in an amino acid change L210Q in the predicted
sequence of amino acids of the E2 protein. Phylogenetic
analysis revealed that the strains involved in the out-
break were closely related to the East-Central South
African genotype of the CHIKV (Figure 3b). The gene
sequences of CHIKV obtained from mosquito and
patient samples formed a close cluster, distinct from the
strains isolated previously from Kerala [14], rest of India
and other parts of the world. This show a common
genetic origin of the virus strains from patients and
mosquitoes in this outbreak.
Apart from these genetic changes, an interesting
observation in the study was the detection of CHIKV
from adult mosquitoes derived from larval samples.
Considering that these mosquitoes were freshly
emerged in the laboratory from the larvae collected
from areas encountering a CHIK outbreak and did not
have a blood-meal, the possibility of acquiring thevirus through transovarial transmission (TOT) can be
thought of. Even though TOT has been proven in fla-
viviruses [19-23], the occurrence of this phenomenon
in alphaviruses is still inconclusive [24-27]. Studies
using a Runion Island isolate of the CHIKV from
2006 outbreak [Strain 06.21; GenBank: AM258992]
could not demonstrate vertical transmission in the
mosquito vector [25 ]. The mosquito infectivity of
alphaviruses is modulated by mutations in specific viral
proteins [28-31]. Amino acid residues 200-220 of the
E2 protein determine the cellular receptor tropism and
mid-gut infectivity in Ae. aegypti mosquitoes [28,30].An E2 I211T mutation was found to strongly enhance
Ae.albopictus infectivity of CHIKV strains with the E1
A226V change [31]. Both the mutations were present
in the isolates in this study and also in the recent
Indian isolates [10,12,14] (Figure 5). Interestingly, the
novel mutation in E2 (L210Q) that was detected exclu-
sively in these 2009 CHIKV strains was adjacent to the
E2-211 position. This substitution of the aliphatic
amino acid leucine with glutamine, an amino acid with
polar side chains, can have critical effects on local
Figure 2 Location of primers in the CHIKV genome . Positions are numbered with respect to S27 sequence (GenBank Accession AF369024).
Niyas et al. Virology Journal2010, 7 :189
http://www.virologyj.com/content/7/1/189
Page 4 of 8
http://www.ncbi.nlm.nih.gov/pubmed/369024?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/369024?dopt=Abstract -
8/10/2019 Chikungunya Rna
5/8
-
8/10/2019 Chikungunya Rna
6/8
evolution. Emergence of newer strains with altered viru-
lence and transmission potential is a possible out come
of the long term viral persistence in the community.
Further entomological and virological studies with these
new CHIKV strains would help to understand the chan-
ging epidemiology of this re-emerging virus.
Figure 4 RT PCR based detection of CHIKV RNA in adult
mosquitoes derived from larvae. WE-mosquito whole extract; P1,
P2, P3-RNA from viral passage 1, 2 & 3 in Vero cells; M-molecular
weight marker.
Figure 5 Alignment of predicted amino acid sequences of the partial E2 protein of CHIKV strains . The newly identified L210Q mutation
in Kerala strains is indicated. The CHIKV strain from Runion island, which was previously used in vertical transmission studies [ 25], is marked as
** .
Niyas et al. Virology Journal2010, 7 :189
http://www.virologyj.com/content/7/1/189
Page 6 of 8
-
8/10/2019 Chikungunya Rna
7/8
Additional material
Additional file 1: Clustal W alignment of the partial nucleotide
sequences of Chikungunya virus nsP2, E2 and E1 protein coding
region.
Acknowledgements
The authors are thankful to the medical staff of the primary health centres
(PHC) in Olavanna, Beypore and Chaliyum for the help extended for the
patient sample collection. The financial assistance by Department of
Biotechnology, Government of India as intramural funding and the
encouragement and support by the Director, RGCB, are gratefully
acknowledged.
Author details1Molecular Virology Laboratory, Rajiv Gandhi Centre for Biotechnology
(RGCB), Thycaud P.O., Thiruvananthapuram-695014, Kerala, India. 2State
Disease Control and Monitoring Cell (SDCMC), National Rural Health Mission
(NRHM), Government of Kerala, Thiruvananthapuram-695014, Kerala, India.3
Department of Community Medicine, Medical College, Thiruvananthapuram,Kerala, India.
Authors contributions
KPN, SN, AM, and AI obtained patient samples, carried out RT PCR and
sequencing studies. RA did the virus isolation. TM made the administrative
arrangements for obtaining samples from the hospitals, and was involved in
identifying CHIK patients and collecting blood samples. RNU did the
collection, identification and rearing of mosquito larvae. ES conceived the
study and drafted the manuscript. All authors read and approved the final
manuscript.
Competing interestsThe authors declare that they have no competing interests.
Received: 18 March 2010 Accepted: 13 August 2010
Published: 13 August 2010
References
1. Powers AM, Logue CH: Changing patterns of chikungunya virus:
re-emergence of a zoonotic arbovirus. J Gen Virol2007, 88:2363-2377.
2. Staples JE, Breiman RF, Powers AM:Chikungunya fever: anepidemiological review of a re-emerging infectious disease. Clin Infect Dis
2009,49:942-948.
3. Schuffenecker I, Iteman I, Michault A, Murri S, Frangeul L, Vaney MC,Lavenir R, Pardigon N, Reynes JM, Pettinelli F, et al:Genome
microevolution of chikungunya viruses causing the Indian Ocean
outbreak.PLoS Med2006,3 :e263.
4. Rezza G, Nicoletti L, Angelini R, Romi R, Finarelli AC, Panning M, Cordioli P,
Fortuna C, Boros S, Magurano F, et al: Infection with chikungunya virus in
Italy: an outbreak in a temperate region. Lancet2007,370:1840-1846.
5. Chandak NH, Kashyap RS, Kabra D, Karandikar P, Saha SS, Morey SH,
Purohit HJ, Taori GM, Daginawala HF:Neurological complications of
Chikungunya virus infection. Neurol India2009, 57:177-180.6. Das T, Jaffar-Bandjee MC, Hoarau JJ, Krejbich Trotot P, Denizot M, Lee-Pat-
Yuen G, Sahoo R, Guiraud P, Ramful D, Robin S, et al:Chikungunya fever:
CNS infection and pathologies of a re-emerging arbovirus. Prog Neurobiol
2009,91:121-9.
7. Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S:A single mutation inchikungunya virus affects vector specificity and epidemic potential. PLoS
Pathog2007, 3:e201.
8. Vazeille M, Moutailler S, Coudrier D, Rousseaux C, Khun H, Huerre M,
Thiria J, Dehecq JS, Fontenille D, Schuffenecker I, et al: Two Chikungunya
isolates from the outbreak of La Reunion (Indian Ocean) exhibit
different patterns of infection in the mosquito, Aedes albopictus. PLoS
One2007, 2:e1168.
9. Yergolkar PN, Tandale BV, Arankalle VA, Sathe PS, Sudeep AB, Gandhe SS,
Gokhle MD, Jacob GP, Hundekar SL, Mishra AC: Chikungunya outbreaks
caused by African genotype, India. Emerg Infect Dis 2006, 12:1580-1583.
10. Arankalle VA, Shrivastava S, Cherian S, Gunjikar RS, Walimbe AM, Jadhav SM,Sudeep AB, Mishra AC:Genetic divergence of Chikungunya viruses in
India (1963-2006) with special reference to the 2005-2006 explosive
epidemic.J Gen Virol2007, 88:1967-76.11. Kumar NP, Joseph R, Kamaraj T, Jambulingam P:A226V mutation in virus
during the 2007 chikungunya outbreak in Kerala, India. J Gen Virol2008,
89:1945-1948.
12. Santhosh SR, Dash PK, Parida MM, Khan M, Tiwari M, Lakshmana Rao PV:
Comparative full genome analysis revealed E1: A226V shift in 2007
Indian Chikungunya virus isolates. Virus Res 2008, 135:36-41.
13. Kannan M, Rajendran R, Sunish IP, Balasubramaniam R, Arunachalam N,
Paramsivan R, Tewari SC, Samuel PP, Tyagi BK: A study on chikungunya
outbreak during 2007 in Kerala, south India. Indian J Med Res 2009,
129:311-315.
14. Sreekumar E, Issac A, Nair S, Hariharan R, Janki MB, Arathy DS, Regu R,
Mathew T, Anoop M, Niyas KP, Pillai MR: Genetic characterization of 2006-
2008 isolates of Chikungunya virus from Kerala, South India, by whole
genome sequence analysis. Virus Genes 2010,40:14-27.15. WHO/SEARO (2008) Chikungunya Fever, a re-emerging disease in Asia.
WHO South East Asia Regional Office. [http://www.searo.who.int/en/
Section10/Section2246.htm].16. Hasebe F, Parquet MC, Pandey BD, Mathenge EG, Morita K,
Balasubramaniam V, Saat Z, Yusop A, Sinniah M, Natkunam S, Igarashi A:
Combined detection and genotyping of Chikungunya virus by a specific
reverse transcription-polymerase chain reaction. J Med Virol2002,
67:370-374.
17. Kumar S, Tamura K, Nei M: MEGA3: Integrated software for Molecular
Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform
2004,5 :150-163.
18. Escobar-Herrera J, Medina-Ramirez FJ, Gutierrez-Escolano AL: A
carboxymethyl-cellulose plaque assay for feline calicivirus. J Virol Methods2007,146:393-396.
19. Rosen L, Shroyer DA, Tesh RB, Freier JE, Lien JC:Transovarial transmission
of dengue viruses by mosquitoes Aedes albopictus and Aedes aegypti.
Am J Trop Med Hyg 1983, 32:1108-1119.20. Gunther J, Martinez-Munoz JP, Perez-Ishiwara DG, Salas-Benito J:Evidence
of vertical transmission of dengue virus in two endemic localities in thestate of Oaxaca, Mexico. Intervirology2007,50 :347-352.
21. Mishra AC, Mourya DT:Transovarial transmission of West Nile virus in
Culex vishnuimosquito. Indian J Med Res 2001, 114:212-214.
22. Rosen L, Shroyer DA, Lien JC: Transovarial transmission of Japanese
encephalitis virus by Culex tritaeniorhynchus mosquitoes. Am J Trop Med
Hyg1980,29:711-712.
23. Aitken TH, Tesh RB, Beaty BJ, Rosen L: Transovarial transmission of yellow
fever virus by mosquitoes (Aedes aegypti). Am J Trop Med Hyg1979,28:119-121.
24. Mourya DT:Absence of transovarial transmission of Chikungunya virus in
Aedes aegypti&Ae. albopictusmosquitoes. Indian J Med Res 1987,85:593-595.
25. Vazeille M, Mousson L, Failloux AB:Failure to demonstrate experimental
vertical transmission of the epidemic strain of Chikungunya virus in
Aedes albopictus from La Reunion Island, Indian Ocean. Mem Inst
Oswaldo Cruz2009,104:632-635.
26. Zytoon EM, el-Belbasi HI, Matsumura T:Transovarial transmission ofchikungunya virus by Aedes albopictus mosquitoes ingesting
microfilariae ofDirofilaria immitisunder laboratory conditions. Microbiol
Immunol1993,37 :419-421.
27. Thavara U, Tawatsin A, Pengsakul T, Bhakdeenuan P, Chanama S,
Anantapreecha S, Molito C, Chompoosri J, Thammapalo S,Sawanpanyalert P, Siriyasatien P:Outbreak of chikungunya fever in
Thailand and virus detection in field population of vector mosquitoes,
Aedes aegypti(L.) and Aedes albopictus Skuse (Diptera: Culicidae).Southeast Asian J Trop Med Public Health 2009,40:951-962.
28. Myles KM, Pierro DJ, Olson KE:Deletions in the putative cell receptor-
binding domain of Sindbis virus strain MRE16 E2 glycoprotein reduce
midgut infectivity in Aedes aegypti. J Virol2003,77:8872-8881.
Niyas et al. Virology Journal2010, 7 :189
http://www.virologyj.com/content/7/1/189
Page 7 of 8
http://www.biomedcentral.com/content/supplementary/1743-422X-7-189-S1.PDFhttp://www.ncbi.nlm.nih.gov/pubmed/17698645?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17698645?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19663604?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19663604?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19663604?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18061059?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18061059?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19439849?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19439849?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20026374?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20026374?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18069894?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18069894?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18069894?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17176577?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17176577?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18632966?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18632966?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18384900?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18384900?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19491425?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19491425?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19491425?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19851853?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19851853?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19851853?dopt=Abstracthttp://www.searo.who.int/en/Section10/Section2246.htmhttp://www.searo.who.int/en/Section10/Section2246.htmhttp://www.ncbi.nlm.nih.gov/pubmed/12116030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12116030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15260895?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15260895?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15260895?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17719097?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17719097?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17719097?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12040765?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12040765?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12040765?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12040765?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/434305?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/434305?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/434305?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/434305?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12885905?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19842379?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/8394983?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19722089?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/3666861?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/434305?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/434305?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6250416?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12040765?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12040765?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17700030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/6625066?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17719097?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17719097?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15260895?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/15260895?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12116030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/12116030?dopt=Abstracthttp://www.searo.who.int/en/Section10/Section2246.htmhttp://www.searo.who.int/en/Section10/Section2246.htmhttp://www.ncbi.nlm.nih.gov/pubmed/19851853?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19851853?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19851853?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19491425?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19491425?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18384900?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18384900?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18632966?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18632966?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17554030?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17176577?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17176577?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18000540?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18069894?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18069894?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20026374?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/20026374?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19439849?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19439849?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18061059?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18061059?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/16700631?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19663604?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19663604?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17698645?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17698645?dopt=Abstracthttp://www.biomedcentral.com/content/supplementary/1743-422X-7-189-S1.PDF -
8/10/2019 Chikungunya Rna
8/8
29. Pierro DJ, Powers EL, Olson KE:Genetic determinants of Sindbis virus
strain TR339 affecting midgut infection in the mosquito Aedes aegypti. J
Gen Virol2007, 88:1545-1554.
30. Pierro DJ, Powers EL, Olson KE:Genetic determinants of Sindbis virusmosquito infection are associated with a highly conserved alphavirus
and flavivirus envelope sequence. J Virol2008, 82:2966-2974.
31. Tsetsarkin KA, McGee CE, Volk SM, Vanlandingham DL, Weaver SC, Higgs S:Epistatic roles of E2 glycoprotein mutations in adaption of chikungunya
virus to Aedes albopictusand Ae. aegyptimosquitoes. PLoS One 2009,4 :
e6835.
doi:10.1186/1743-422X-7-189Cite this article as: Niyas et al.: Molecular characterization ofChikungunya virus isolates from clinical samples and adultAedesalbopictus mosquitoes emerged from larvae from Kerala, South India.
Virology Journal2010 7 :189.
Submit your next manuscript to BioMed Centraland take full advantage of:
Convenient online submission
Thorough peer review
No space constraints or color figure charges
Immediate publication on acceptance
Inclusion in PubMed, CAS, Scopus and Google Scholar
Research which is freely available for redistribution
Submit your manuscript atwww.biomedcentral.com/submit
Niyas et al. Virology Journal2010, 7 :189
http://www.virologyj.com/content/7/1/189
Page 8 of 8
http://www.ncbi.nlm.nih.gov/pubmed/17412985?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17412985?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17412985?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17412985?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18160430?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18160430?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18160430?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/19718263?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18160430?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18160430?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/18160430?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17412985?dopt=Abstracthttp://www.ncbi.nlm.nih.gov/pubmed/17412985?dopt=Abstract