Chitinases Play a Key Role in Stipe Cell Wall Extension in theMushroom Coprinopsis cinerea

Jiangsheng Zhou,a* Liqin Kang,a Cuicui Liu,a Xin Niu,a Xiaojun Wang,a Hailong Liu,a Wenming Zhang,a Zhonghua Liu,a

Jean-Paul Latgé,b Sheng Yuana

aJiangsu Key Laboratory for Microbes and Microbial Functional Genomics, Jiangsu Engineering and Technology Research Center for Industrialization of MicrobialResources, College of Life Science, Nanjing Normal University, Nanjing, People’s Republic of China

bInstitut Pasteur, Unité des Aspergillus, Paris, France

ABSTRACT The elongation growth of the mushroom stipe is a characteristic butnot well-understood morphogenetic event of basidiomycetes. We found that extend-ing native stipe cell walls of Coprinopsis cinerea were associated with the releaseof N-acetylglucosamine and chitinbiose and with chitinase activity. Two chitinasesamong all detected chitinases from C. cinerea, ChiE1 and ChiIII, reconstituted heat-inactivated stipe wall extension and released N-acetylglucosamine and chitinbiose.Interestingly, both ChiE1 and ChiIII hydrolyze insoluble crystalline chitin powder,while other C. cinerea chitinases do not, suggesting that crystalline chitin compo-nents of the stipe cell wall are the target of action for ChiE1 and ChiIII. ChiE1- orChiIII-reconstituted heat-inactivated stipe walls showed maximal extension activity atpH 4.5, consistent with the optimal pH for native stipe wall extension in vitro; ChiE1-or ChiIII-reconstituted heat-inactivated stipe wall extension activities were associatedwith stipe elongation growth regions; and the combination of ChiE1 and ChiIIIshowed a synergism to reconstitute heat-inactivated stipe wall extension at a lowaction concentration. Field emission scanning electron microscopy (FESEM) im-ages showed that the inner surface of acid-induced extended native stipe cell wallsand ChiE1- or ChiIII-reconstituted extended heat-inactivated stipe cell walls exhibiteda partially broken parallel microfibril architecture; however, these broken transverselyarranged microfibrils were not observed in the unextended stipe cell walls that wereinduced by neutral pH buffer or heat inactivation. Double knockdown of ChiE1 andChiIII resulted in the reduction of stipe elongation, mycelium growth, and heat-sensitive cell wall extension of native stipes. These results indicate a chitinase-hydrolyzing mechanism for stipe cell wall extension.

IMPORTANCE A remarkable feature in the development of basidiomycete fruitingbodies is stipe elongation growth that results primarily from manifold cell elonga-tion. Some scientists have suggested that stipe elongation is the result of enzymatichydrolysis of cell wall polysaccharides, while other scientists have proposed the pos-sibility that stipe elongation results from nonhydrolytic disruption of the hydrogenbonds between cell wall polysaccharides. Here, we show direct evidence for achitinase-hydrolyzing mechanism of stipe cell wall elongation in the model mush-room Coprinopsis cinerea that is different from the expansin nonhydrolysis mecha-nism of plant cell wall extension. We presumed that in the growing stipe cell walls,parallel chitin microfibrils are tethered by �-1,6-branched �-1,3-glucans, and that thebreaking of the tether by chitinases leads to separation of these microfibrils to in-crease their spacing for insertion of new synthesized chitin and �-1,3-glucans underturgor pressure in vivo.

KEYWORDS chitin, chitinases, Coprinopsis cinerea, stipe elongation, wall extension

Citation Zhou J, Kang L, Liu C, Niu X, Wang X,Liu H, Zhang W, Liu Z, Latgé J-P, Yuan S. 2019.Chitinases play a key role in stipe cell wallextension in the mushroom Coprinopsis cinerea.Appl Environ Microbiol 85:e00532-19. https://doi.org/10.1128/AEM.00532-19.

Editor Marie A. Elliot, McMaster University

Copyright © 2019 American Society forMicrobiology. All Rights Reserved.

Address correspondence to Zhonghua Liu,liuzhonghua8501@163.com, or Sheng Yuan,yuansheng@njnu.edu.cn.

* Present address: Jiangsheng Zhou, the KeyLaboratory of Biotechnology for MedicinalPlants of Jiangsu Province, Jiangsu NormalUniversity, Xuzhou, Jiangsu, People’s Republicof China.

J.Z., L.K., and C.L. contributed equally to thiswork.

Received 4 March 2019Accepted 10 May 2019

Accepted manuscript posted online 24 May2019Published

GENETICS AND MOLECULAR BIOLOGY

crossm

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 1Applied and Environmental Microbiology

18 July 2019

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

One of the remarkable characteristics of the development of basidiomycete fruitingbodies is stipe elongation growth that results primarily from manifold cell elon-

gation (1–5). The stipe cell is surrounded by a thin cell wall that provides the cell withenough strength to withstand turgor pressure while keeping adequate plasticity forextension of stipe cells under turgor pressure (2–4, 6). In almost all fungi, the corestructure of the cell wall consists of chitin and �-1,6 branched �-1,3-glucan, in whichchitin chains associate with each other via interchain hydrogen bonds to form chitinmicrofibrils and are covalently linked to the nonreducing end of branched �-1,3-glucanby a �-1,4-glycoside linkage (7–11).

However, thus far, the molecular mechanism of stipe cell elongation has not beenwell understood. Stipe cell elongation in the stipe is often suggested to be the resultof hydrolysis of cell wall polysaccharides by hydrolytic enzymes, especially �-glucanases(2, 12–15). There are 64 glucanases (16) and eight chitinases (17) in the Coprinopsiscinerea genome (18). However, since scientists have failed to obtain any direct evidencefor this hypothesis, Mol et al. (4) proposed an alternative model of stipe cell elongation,in which the stipe cell wall is initially plastic and its elongation results from creep of thecell wall polysaccharide components due to constant breakage of weak hydrogenbonds between the old existing �-1,3-glucan chains, reformation of the hydrogenbonds between the old existing and new inserted �-1,3-glucan chains, and passivelytransverse alignment of the new synthesized chitin chains under turgor pressure ratherthan from enzymatic hydrolysis. Like the stipe elongation growth of basidiomycetefruiting bodies, plant elongation growth is due mainly to cell wall elongation. In plantcell walls, cellulose microfibrils are associated via hydrogen bonds with a matrix ofhemicelluloses and pectins. Plant cell wall extension was even thought to be mediatedby cell wall polysaccharide hydrolases until McQueen-Mason et al. (19) found expansinproteins by wall extensometer analysis. Expansins lack hydrolytic activity toward cellwall polysaccharides but induce plant cell wall extension by disrupting the hydrogenbonds between cell wall polysaccharides (19–24). Recently, we reported that the thinand long stipes of the basidiomycetes Flammulina velutipes and C. cinerea are verysimilar to cucumber hypocotyls and wheat coleoptiles and suitable for measuring stipecell wall extension by extensometers to elucidate the mechanism of stipe elongation (1,5). In this study, with the aid of extensometer analysis of stipe wall extension, we foundthat extending native stipe walls were associated with release of N-acetylglucosamineand chitinbiose and with chitinase activities, that two chitinases among detectedchitinases from C. cinerea (ChiE1 and ChiIII) reconstituted heat-inactivated stipe wallextension, and that the double knockdown of ChiE1 and ChiIII reduced stipe elonga-tion, mycelium growth, and wall extension. Therefore, a chitinase-hydrolyzing mecha-nism for stipe cell wall extension is proposed.

RESULTSChitinases ChiE1 and ChiIII restore extension activity in inactivated stipe walls.

We found that a cell wall protein extract, rather than a soluble protein extract, fromgrowing apical stipes of C. cinerea fruiting bodies restored endogenous extensionactivity in heat-inactivated stipe walls at acidic pH (Fig. 1A). We attempted to isolateand purify the active protein from the cell wall protein extracts of growing apical stipesbut always failed because the amount of active protein was too low to be purifiedfurther.

We observed that when native growing apical stipe fragments were induced byacidic pH to extend, they released some soluble sugars into the bath solution (Fig. 2A),which were characterized as glucose, N-acetylglucosamine, and chitinbiose (Fig. 2B).After preincubation of the apical stipes in boiling water, the heat-inactivated stipes notonly lost acid-induced, heat-sensitive extension capacity (5) but also no longer releasedN-acetylglucosamine and chitinbiose. The cell wall protein extract-reconstituted ex-tending stipe walls released as much N-acetylglucosamine and chitinbiose as theextending native stipe walls, while the release of glucose was greatly reduced (Fig. 2A),and chitinase activity was detected in the stipe wall protein extract (data not shown).

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 2

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

Thus, we attempted to purify naturally or heterologously expressed recombinantchitinases to detect their cell wall extension-inducing activity. There are eight putativechitinases in the C. cinerea genome (18, 25). We isolated, purified, and characterized aclass V exochitinase, ChiB1, from C. cinerea pilei (26) and heterologously expressed,

FIG 1 Extension of reconstituted heat-inactivated stipe cell walls. (A) Length change (A1) or extension rate (A2) of cell wallprotein- or chitinase-reconstituted heat-inactivated apical stipe under constant load during measurement. The �10-mmlength of heat-inactivated apical stipe fragments clamped to an extensometer with an applied force of 3 � g was suspendedin bathing solution (50 mM sodium acetate, pH 4.5) for 30 min. The bathing solution was then replaced by the same solution(arrows), with or without protein extractions from apical stipes or chitinases from C. cinerea for the next 120 min. All curvesare the mean of five independent experiments. (B) qRT-PCR analysis of the expression of chitinases in C. cinerea during thedevelopment of fruiting bodies. �-Tubulin was used for standardization of mRNA levels. The annotated names of chitinasesand their accession numbers in GenBank are as follows: ChiE1, chitinase (EAU80760.2); ChiE2, chitinase (EAU84887.2); ChiIII,class III chitinase (EAU93428.2); ChiB1, class V chitinase (EAU86796.2); ChiEn1, endochitinase (EAU81461.1); ChiEn2, endochiti-nase (EAU81455.1); ChiEn3, endochitinase (EAU84319.1); and ChiEn4, endochitinase (EAU91084.2). All data come from threeindependent experiments with three replicates (n � 9). (C) Western blotting of the amount of chitinase ChiE1 (C1) and ChiIII(C2) in the wall extracts from stipe fragments of different stipe regions (n � 15 to 30) during the development of C. cinereafruiting bodies.

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 3

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

purified, and characterized a class III endochitinase, ChiIII (17), a class V exochitinase,ChiE1 (27), and three chitinases annotated as endochitinases in the C. cinerea genome(18), ChiEn1 (25), ChiEn2 (GenBank accession number EAU81455.1), and ChiEn3 (28).The other two chitinases, an annotated endochitinase, ChiEn4 (accession no.EAU91084.2), and a putative chitinase, ChiE2 (accession no. EAU84887.2), were ex-pressed heterologously but could not be purified (data not shown). Among these eightchitinases, only one exochitinase, ChiE1, and one endochitinase, ChiIII, reconstitutedheat-inactivated apical stipe wall extension, whereas the other six C. cinerea chitinasesdid not show any wall extension-inducing activity (Fig. 1A). It was observed that among

FIG 2 Soluble sugars are released from extending stipe walls. (A) High-performance anion exchange chromatography with pulsed amperometricdetection (HPAEC-PAD) analysis of soluble sugars released from the stipe fragments in the bath solution in the extensometer after 120 min ofacid-induced native wall extension or cell wall protein- or chitinase-reconstituted heat-inactivated stipe wall extension as shown in Fig. 1A. P1,P2, and P3 indicate product peaks in the HPAEC-PAD chromatogram. Chitin oligosaccharides (GlcNAc)2-6 (i.e., chitinhexaose [dp6], chitinpentose[dp5], chitintetraose [dp4], chitintriose [dp3] and chitinbiose [dp2]), N-acetyl-D-glucosamine (GlcNAc), and glucose were used as standards. Eachchromatogram is representative of an independent analysis of 3 to 6 samples. (B) Electrospray ionization (ESI)-Fourier-transform ion cyclotronresonance mass spectrometry (FTICR-MS) spectra of soluble sugar products, P1 (B1), P2 (B2), and P3 (B3), released from the extending stipefragments in panel A. Intes., intensity.

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 4

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

these eight C. cinerea chitinases, only ChiE1 and ChiIII could degrade insoluble crystalchitin powder, whereas the other six chitinases could not (Table S1). Consistent withthis point, heat-inactivated stipe cell walls released N-acetylglucosamine and chit-inbiose but not glucose under ChiE1- and ChiIII-reconstituted acid-induced exten-sion, whereas heat-inactivated stipe cell walls did not release any soluble sugars underreconstitution by the other chitinases (Fig. 2A).

Reverse transcription-quantitative PCR (qRT-PCR) analysis showed that ChiE1 wasexpressed at higher levels in the growing apical stipe region than in the nongrowingbasal and the basal swollen regions, whereas ChiIII was expressed at lower levels in thegrowing apical stipe region than in the nongrowing basal and the basal swollen regions(Fig. 1B). Among the chitinases lacking wall extension-inducing activity, ChiB1 andChiEn4 were expressed at higher levels in the growing apical stipe region than in thenongrowing basal and basal swollen regions, whereas ChiEn2 was highly expressedin various regions of the stipes, and ChiE2, ChiEn1 and ChiEn3 were not essentiallyexpressed in any regions of the stipes (Fig. 1B). Consistent with the qRT-PCRanalysis, Western blot analysis showed that ChiE1 protein content was highest inthe growing apical stipe region and lowest in the nongrowing basal and swollenplectenchyma regions, whereas ChiIII protein content was lowest in the growingapical and median stipe region and highest in the nongrowing basal and basalswollen stipe regions (Fig. 1C).

Characteristics of ChiE1- and ChiIII-reconstituted heat-inactivated stipe wallextension. The ChiE1- or ChiIII-reconstituted heat-inactivated stipe wall extensionshowed acid dependence, and maximum reconstituted wall extension activities wereobtained at pH 4.5 (Fig. 3A). ChiE1- or ChiIII-reconstituted heat-inactivated stipe wallextension activities increased with increase of the protein concentration. The saturationprotein concentration was 0.18 mg · ml�1 for both ChiE1 and ChiIII (Fig. 3B). Notably, wefound that 0.01 mg · ml�1 ChiE1 or 0.01 mg · ml�1 ChiIII individually showed almostno apparent wall-inducing extension activity. However, mixed 0.01 mg · ml�1 ChiE1and 0.01 mg · ml�1 ChiIII showed a strong reconstituted heat-inactivated stipe wallextension activity, like 0.18 mg · ml�1 individual ChiE1- or ChiIII-reconstituted heat-inactivated stipe wall activity, indicating a synergism of the combination of ChiE1 andChiIII with a synergistic ratio of 9 (Fig. 1A). We previously reported that the stipeelongation growth and stipe cell wall extension activity varied with different regions ofthe stipe, i.e., the apical stipe showed maximum elongation growth and wall extensionactivity, and the median stipe region had lower elongation growth and wall extensionactivity, whereas the basal stipe and the basal swollen plectenchyma regions hadessentially no elongation growth and no wall extension activity (6). In this study, ChiE1and ChiIII showed maximal reconstituted wall extension activities in the apical stiperegion, but showed almost no or only a little reconstituted wall extension activity in thebasal and the basal swollen stipe regions (Fig. 3C). Furthermore, ChiE1 only inducedheat-inactivated stipe extension in the basidiomycetes C. cinerea and F. velutipes butnot in plant cucumber hypocotyl and barley coleoptiles (Fig. 3D).

Cell wall architectures of extended stipes and unextended stipes and localiza-tion of ChiE1 and ChiIII in stipe cell walls. Field emission scanning electron micros-copy (FESEM) (17) was used to observe the architecture of stipe cell walls that were orwere not extended in vitro under constant tension at the extensometer, mimicking thewall extension that existed in the elongating stipe. The observation of the nonlivingmaterials could avoid the interference of the continued deposition of new synthesizedchitin and �-glucan that is seen when observing living stipe cell walls’ reorientation ofmicrofibrils. To induce wall extension, we used acidic pH and ChiE1 and ChiIII. As shownin Fig. 4A, in acid-induced extended native stipes, the chitin microfibril architecture onthe inner surface of the cell walls was partially broken, whereas in the unextendedstipes that were heat inactivated or induced with neutral-pH buffer (5), this partiallybroken chitin microfibril architecture on the inner surface of the cell walls was notobserved. Interestingly, in ChiE1- or ChiIII-reconstituted heat-inactivated extendedstipes, partially broken chitin microfibrils on the inner surface of the cell walls were also

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 5

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

observed, which was consistent with this observation in acid-induced extended nativestipes. On the other hand, in ChiEn1-reconstituted heat-inactivated stipes, which didnot show induced wall extension, the partially broken chitin microfibrils on the innersurface of the cell walls were not observed either.

Immunogold labeling and transmission electron microscopy were used to analyzethe distribution and subcellular localization of chitinases ChiE1 and ChiIII. No goldparticles were observed on the cell walls in control sections of stipe cells treated withpreimmune serum and gold-labeled secondary antibodies. However, when specificantibodies to ChiE1 and ChiIII and gold-labeled secondary antibodies were used tolabel sections of C. cinerea stipes, intense immunolabeling dots representing goldparticles were observed in the cell walls of stipes (Fig. 4B), indicating localization ofChiE1 and ChiIII in the cell walls of C. cinerea stipes.

Effects of dsRNA-induced silencing of ChiE1 and ChiIII on stipe elongation andmycelium growth of C. cinerea. Since targeted gene disruption is particularly intrac-table and is not very efficient in C. cinerea (29, 30), a hairpin double-stranded RNA(dsRNA)-mediated gene silencing strategy was used to downregulate the expression ofChiE1 or/and ChiIII to determine the gene function in vivo in stipe elongation growthof C. cinerea. The C. cinerea homothallic strain AmutBmut, which has a defect in thep-aminobenzoic acid synthetase gene (pab1), was used as a recipient strain. Plasmid

FIG 3 Characteristics of ChiE1-reconstituted wall extension in heat-inactivated stipes. (A) ChiE1-reconstituted (orange) andChiIII-reconstituted (green) wall extension activity in heat-inactivated C. cinerea apical stipes shows an acidic pH dependence. (B)ChiE1-reconstituted (orange) and ChiIII-reconstituted (green) wall extension activity in heat-inactivated C. cinerea apical stipesshows a protein concentration dependence. (C) ChiE1-reconstituted (orange) and ChiIII-reconstituted (green) wall extensionactivity in heat-inactivated C. cinerea stipes varies in different stipe regions. (D) ChiE1-reconstituted (orange) and ChiIII-reconstituted (green) wall extension activity varies with species. All experimental conditions were the same as those shown in Fig.1A, except the pH of the replacing bath solution was adjusted for the pH dependence, the concentration of ChiE1 or ChiIII wasvaried from 30 to 300 �g/ml for the concentration dependence, different stipe region fragments of C. cinerea were used for theregion dependence, and apical stipes and growing plant tissues from various species were used for the species specificity. Inaddition, 12 � g of applied force was used for F. velutipes stipes, and 20 � g of applied force was used for cucumber hypocotylsand wheat coleoptiles. All data come from three independent experiments with three replicates (n � 9).

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 6

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

FIG 4 Ultrastructure analysis of stipe cell walls. (A) Representative FESEM images of the architecture on theinner surface of the cell wall of apical stipes that have been measured for their wall extension as describedin the legend to Fig. 1A prior to preparation of sample for FESEM. (A1) Unextended native apical stipefragments that were first incubated in pH 6.8 solution for 30 min and then incubated in pH 6.8 solution for

(Continued on next page)

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 7

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

pCcchiE1dsRNA containing the hairpin dsRNA of ChiE1 or pCcchiIIIdsRNA containing thehairpin dsRNA of ChiIII, along with pCcpab-1 containing pab1 as a selection marker (Fig.5A), was cotransformed into the haploid oidia to generate single knockdown transfor-mants, ChiE1-RNAi and ChiIII-RNAi, respectively. Ten detected transfomants of ChiE1-RNAi or ChiIII-RNAi did not exhibite any apparent phenotype associated with fruitingbody development or mycelium growth (data not shown). qRT-PCR analysis showedthat expression of ChiIII and other chitinases was upregulated in ChiE1-RNAi knock-down strains (Fig. S1A), and expression of ChiE1 and other chitinases was upregulatedin ChiIII-RNAi knockdown strains (Fig. S1B), indicating that the function of silencedsingle ChiE1 or ChiIII is compensated by upregulation of unsilencing ChiIII or ChiE1expression (31). Thus, plasmids pCcchE1dsRNA, pCcchiIIIdsRNA, and pCcpab-1 werecotransformed to the haploid oidia to generate double-knockdown transformants,ChiE1/ChiIII-RNAi. The empty plasmid pCcExp and pCcpab-1 were cotransformed to thehaploid oidia to generate mock transformants (Fig. 5A). Fifteen detected ChiE1/ChiIII-RNAi transformants or mock transformants were confirmed by genomic PCR (Fig. S2)and Southern blotting (Fig. 5B). Figure 5D shows that in mock transformants, youngfruiting bodies of approximately 2.94 cm in length elongated to approximately 7.11 cmafter 6 h of cultivation. In contrast, in double-knockdown ChiE1/ChiIII-RNAi transfor-mants, only some of the fruiting bodies showed normal elongation growth, and othersshowed little or no elongation growth after 6 h of cultivation. The average rate of stipeelongation in 6 h was approximately 0.72 cm · h�1 in the mock transformants or0.32 cm · h�1 in the double-knockdown transformants. In addition, the number offruiting bodies in double-knockdown ChiE1/ChiIII-RNAi transformants was apparentlyreduced compared to the number of fruiting bodies in mock transformants (Fig. 5D2).Figure 5E shows that the average diameter of the mycelia of colonies of the mocktransformants was 4.58 cm, whereas the average diameter of the mycelia of colonies ofdouble-knockdown ChiE1/ChiIII-RNAi transformants was 3.97 cm after 4 days of inoc-ulation, yielding average mycelium growth rates of 1.70 cm · day�1 in the mock trans-formants and 1.42 cm · day�1 in the double-knockdown transformants on the fourthday, indicating that downregulation of ChiE1/ChiIII resulted in reduced myceliumgrowth. Figure 5F shows that the heat-sensitive protein-mediated wall extensionactivity of the double-knockdown transformants decreased, on average, by 42.0%compared to the heat-sensitive protein-mediated wall extension activity of the mocktransformants. qRT-PCR and Western blot analysis showed that the transcription levelsof ChiE1 and ChiIII in the apical stipe regions (Fig. S1C) and the protein content of ChiE1and ChiIII in the cell wall protein extraction of the apical stipe regions (Fig. 5C) weredecreased in double-knockdown transformants compared to mock transformants.

DISCUSSION

Five lines of evidences support the idea that chitinase hydrolysis mediates stipe cellwall elongation of C. cinerea. First, extending native stipe walls were associated withreleased N-acetylglucosamine and chitinbiose and with chitinase activity. Second,chitinases ChiE1 and ChiIII reconstituted heat-inactivated stipe wall extension and

FIG 4 Legend (Continued)the next 120 min during the measurement of wall extension. (A2) Acid-induced extended native apical stipefragments that were first incubated in pH 6.8 solution for 30 min and then incubated in pH 4.5 solution for thenext 120 min during the measurement of wall extension. (A3) Unextended heat-inactivated apical stipe frag-ments, (A4) ChiE1-reconstituted heat-inactivated extended apical stipe fragments, (A5) ChiIII-reconstitutedheat-inactivated extended apical stipe fragments, and (A6) ChiEn1-reconstituted heat-inactivated unextendedapical stipe fragments; all of these were first incubated in pH 4.5 solution for 30 min and then incubatedin pH 4.5 solution with or without ChiE1 or ChiIII or ChiEn2 for the next 120 min during the measurementof wall extension. Arrows indicate partially broken areas in the transversely arranged microfibril structureon the inner surface of stipe cell walls. Bar, 1 �m. (B) Representative transmission electron microscopy (TEM)images of immunogold labeling of C. cinerea apical stipe cells with antibodies against ChiE1 or ChiIII (n � 6).Intense immunolabeling dots representing gold particles were observed in stipe cell walls with antibodiesagainst ChiE1 (arrows) (B2) or ChiIII (arrows) (B3), but no immunolabeling dot was detected in the controlwith preimmune serum (B1). Bar, 500 nm.

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 8

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

FIG 5 Construction, identification, and phenotypes of double chiE1/chiIII-RNAi transgenic strains. (A) Schematic representation of plasmids pCcExp,pCcpab-1, pCcchiE1dsRNA, and pCcchiIIIdsRNA. The arrows and lines below the plasmids indicate the primers for genomic PCR and the hybridizationprobes for Southern blotting, respectively. (B) Southern blotting shows that the PAbgpdII of pCcExp in mock transformants (M), the chiE1sense ofpCcchiE1dsRNA, and the chiIIIsense of pCcchiIIIdsRNA in the chiE1/chiIII-RNAi transformants (T) were integrated into the genome. Asterisks indicate thebands corresponding to the endogenous gene locus in the mock transformants. (C) Western blotting of ChiE1 and ChiIII in cell wall protein extract ofapical stipes of the mock transformants (M) or chiE1/chiIII-RNAi transformants (T) using anti-ChiE1 and anti-ChiIII. (D) Growing fruiting bodies (D1) of thefive representatives of mock transformants (M) and chiE1/chiIII-RNAi transformants (T) at 10:00 a.m. and 4:00 p.m., respectively, and the stipe elongationgrowth rate (D2) of the fruiting bodies of 15 mock transformants (n � 231 fruiting bodies) and 15 chiE1/chiIII-RNAi transformants (n � 95 fruiting bodies)with three repeats of each transformant during the same 6-h period as that in panel D1. (E) Colonies (E1) of the five representatives of the mocktransformants and chiE1/chiIII-RNAi transformants after 4 days of inocunation, and growth rates (E2) of all colonies of 15 mock transformants andchiE1/chiIII-RNAi transformants with three repeats of each transformant between the third and fourth days of inoculation. (F) Heat-sensitive wallextension activity of native apical stipes from the mock transformants (M) and the chiE1/chiIII-RNAi transformants (T) with five samples (n � 5) for eachtransformant. Heat-sensitive stipe wall extension activity is calculated by the native stipe wall extension rate minus the heat-inactivated stipe wallextension rate (5). An asterisk indicates a significant difference (P � 0.01) according to Duncan’s test.

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 9

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

released N-acetylglucosamine and chitinbiose. Third, ChiE1- or ChiIII-reconstitutedheat-inactivated stipe walls showed maximal extension activity at pH 4.5, consistentwith the acid pH dependence of native stipe wall extension (5), although the optimalpH for the chitin hydrolysis activity of ChiE1 (27) and ChiIII (17) is 5.0. This smalldifference between the pH optima of the hydrolysis activity and the wall extensionactivity of ChiE1 and ChiIII may be due to low bond energy of the N–H···O hydrogenbonds between chitin chains in the stipe cell wall that are easily destroyed in acidicsolution (5, 32–34), resulting in an apparent optimal pH of 4.5 for maximum wallextension. Fourth, the ChiE1- and ChiIII-reconstituted heat-inactivated stipe wall exten-sion activities were associated with stipe elongation growth regions, i.e., the maximalreconstituted wall extension activities occurred in the fast-growing apical stipe region,but almost no or only a little reconstituted wall extension activity appeared in theessentially nongrowing basal and basal swollen stipe regions. Fifth, double knockdownof ChiE1 and ChiIII resulted in suppression of stipe elongation growth and in a decreasein the heat-sensitive cell wall extension of native stipes in which expressions of bothChiE1 and ChiIII were downregulated. Furthermore, we previously reported a proteinfrom snails that reconstituted the heat-inactivated stipe wall extension of F. velutipesand C. cinerea fruiting bodies; no hydrolytic activity of this protein against cell wallpolysaccharides was detected under the experimental conditions employed (1, 5).However, when we retested the snail protein for its hydrolysis activity, we found thatif the protein concentration was increased and the reaction time was prolonged, justlike the conditions for ChiE1 and ChiIII, the snail protein could hydrolyze chitin powders(Fig. S3), supporting the idea that chitinase hydrolysis mediates cell wall extension ofC. cinerea fruiting bodies.

This study found that among the eight chitinases from C. cinerea, only ChiE1 andChiIII reconstituted heat-inactivated stipe cell wall extension. ChiIII is an endo-actingchitinase with two carbohydrate-binding modules (CBMs) (17), and ChiE1 is an exo-acting chitinase without CBMs (27); therefore, the capacity of the chitinases to inducestipe wall extension does not depend on their mode of exo- or endo-action or on theirCBMs (35). It is noteworthy that both ChiE1 (27) and ChiIII (17) showed a remarkablefeature to hydrolyze insoluble crystalline chitin powder, while the other chitinases didnot (25, 26, 28, Table S1). Although ChiE1 contains only a single catalytic domainwithout CBMs, it can bind to and degrade insoluble chitin powder and colloidal chitin(27). These results suggest that crystalline chitin components of the stipe cell wall arethe target of action of chitinases for wall extension. FESEM observations on theultrastructure of cell walls from unextended and extended apical stipe fragments of C.cinerea support the use of this chitinase-hydrolyzing mechanism for stipe cell wallextension. On the inner surface of acid-induced extended native stipe cell walls, thetransverse microfibril arrangement was partially broken, with some microfibrils sepa-rated but remaining essentially parallel. Similarly, ChiE1- and ChiIII-reconstituted ex-tended heat-inactivated stipe cell walls also showed similar broken parallel microfibrilson their inner surfaces. However, these broken transversely arranged microfibrils werenot observed on the inner surfaces of unextended stipe cell walls that were induced bya neutral pH buffer, heat inactivated, or ChiEn1 reconstituted and heat inactivated. Amore plausible hypothesis is that in the growing stipe cell walls, roughly parallel chitinmicrofibrils are tethered by �-1,6-branched �-1,3-glucans, and the breaking of thetethers by chitinases, such as ChiE1 and ChiIII, allows the chitin microfibrils to be freeto separate to increase their spacing for the insertion of new chitin chains and �-glucanpolymers under turgor pressure in vivo (Fig. 6). The putative role of chitin synthases hasbeen suggested to be involved in the formation of fruiting bodies in ascomycetes (36).This partial breakage of old existing chitin chains linked to �-glucan, the immediatelinkage of newly inserted chitin chains to �-glucan, and association of new insertedchitin chains with old existing chitin chains via hydrogen bonds to form new microfi-brils ensure cell wall integrity and limit breakage of cell walls for stipe elongationgrowth. Because stipe cell wall extension in vitro lacked continuous chitin microfibrilsynthesis, a broken parallel microfibril architecture during in vitro extension could be

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 10

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

observed on the inner surface of cell walls due to creep of stipe cell wall polysaccha-rides under strain force in the extensometer. Thus, stipe cell walls must maintain arelatively low concentration of chitinases because a higher concentration would tip thebalance between hydrolysis and synthesis of cell walls. We did find that application ofhigher concentrations of ChiE1 or/and ChiIII in reconstituted stipe wall extension led tostipe breakage (data not shown). This study found that a low concentration of ChiE1and ChiIII is enough to efficiently induce wall extension via a synergism strategy; mixed0.01 mg · ml�1 ChiE1 and 0.01 mg · ml�1 ChiIII showed a strong reconstituted heat-inactivated stipe wall extension activity similar to that for 0.18 mg · ml�1 of eitherChiE1- or ChiIII, individually. This synergism may explain why it is difficult to purifyChiE1 and ChiIII from stipe tissues.

Although ChiE1 exhibited greater expression in the growing apical stipe region thanin the nongrowing basal and basal swollen stipe regions, ChiIII exhibited lower expres-sion in the growing apical stipe region than in the nonelongating basal and basalswollen stipe regions. Because ChiE1- and ChiIII-reconstituted wall extension activitiesoccurred in the elongating apical stipe region rather than in the nonelongating basaland basal swollen stipe regions, the loss of mature stipe cell wall extension activity wasevidently not due to the lack of chitinases in the mature stipe cell wall, but the maturestipe wall is biochemically modified, and therefore it lost its susceptibility to chitinases(6, 37).

FIG 6 Schematic representation of the chitinase-hydrolyzing mechanism of stipe cell wall extension. Thecore structure of the stipe cell wall consists of chitin and �-1,6 branched �-1,3-glucan in which chitinchains associate with each other through interchain hydrogen bonds to form chitin microfibrils, whichare transversely arranged on the inner surface and are covalently cross-linked to the nonreducing endof branched �-1,3-glucan via �-1,4-glycoside linkages (A). In the growing stipe cell walls, the chitin chainsextending from existing chitin microfibrils and linked to the nonreducing end of branched �-1,3-glucanare partially cleaved by exo- or endochitinases, so that these existing chitin microfibrils are locallyseparated to create some gaps between microfibrils under turgor pressure in vivo; at the same time, thenewly synthesized chitins and �-glucans are inserted into the gaps between existing microfibrils toenlarge the cell surface area (B). This partial breakage of old chitin chains linked to �-glucan, theimmediate linkage of newly inserted chitin chains to �-glucan, and the concomitant association of newchitin chains and old chitin chains through interchain hydrogen bonds work together to form newmicrofibrils, ensure cell wall integrity, and limit breakage for stipe elongation growth (C). In this model,the roles of glucanases are not denied, although they need to be elucidated further in the future.

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 11

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

This study explores the possibility that double knockdown of ChiE1 and ChiIII alsoimpaired mycelium growth of C. cinerea, indicating that hyphal growth and stipeelongation growth share a mechanism of chitinase hydrolysis. It was suggested yearsago that hydrolytic enzymes may function in hyphal tip growth in filamentous fungi(38, 39). However, lacking direct evidence for enzyme-mediated plasticity at the hyphalapex, some researchers suggested that hyphal tip growth does not involve hydrolyticenzymes; instead, they hypothesized that the new synthesized wall is initially plastic atthe growing hyphal apex until it is made rigid at the nongrowing hyphal zone behindthe apex by cross-linkage between chitin and �-glucan chains (39). Because deletion ofa single chitinase gene in different fungal species (40–43), even all five endochitinasegenes in Aspergillus fumigatus (44), Chi1 to Chi5, did not result in apparent growthdefects, except for one report that deletion of the chitinase Chit-1 gene in Neurosporacrassa leads to a reduction in hyphal growth (45), some researchers concluded thatchitinases may have only minor effects on hyphal tip growth (46), whereas otherscientists attributed the lack of phenotype in the deletion mutants to redundancybetween many members within the chitinase family (7, 8). In contrast, Saccharomycescerevisiae has only two chitinases, Cts1 and Cts2 (8, 47), and knockout of the Cts1-coding gene leads to a defect in yeast cell separation and the formation of yeast cellaggregates due to the existence of chitin in the yeast primary septum, indicating thatchitinases function at sites at which hydrolysis of the cell wall is necessary. Fortunately,though C. cinerea contains 8 chitinases, only two of them, ChiE1 and ChiIII, possess thecapacity to hydrolyze insoluble crystalline chitin powder. Therefore, when these twogenes were simultaneously knocked down, the phenotype could be observed.

At present, the roles of ChiE1 and ChiIII in stipe elongation in at least the twoexamined mushroom species, C. cinerea and F. velutipes, are clear. In the future, it willbe necessary to determine whether the conclusion could be extended to othermushroom-forming basidiomycetes. However, the Protein BLAST search in the NationalCenter for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov/)explores ChiE1 and ChiIII homologs in many basidiomycete genomes, including thegenomes of Agaricus bisporus (48) and Lentinula edodes (49). L. edodes chitinase Chi1(50) and Chi3 (51) are the homologs of C. cinerea chitinase ChiE1 and ChiIII, respectively.Vetchinkina et al. (52) reported that chi1 showed a higher transcription level at themycelial mat, primordium, and fruiting body stages of L. edodes than at vegetativemycelium. Sakamoto et al. (51) found that the transcription levels of chi1 and chi3, aswell as chitinase activity, increased in postharvest fruiting bodies of L. edodes. Thesetranscriptome analyses indicated that the homologs of C. cinerea chitinase ChiE1 andChiIII are important for cell wall degradation in L. edodes.

Remarkably, the chitinase-hydrolyzing mechanism of mushroom stipe cell wallextension is different from the expansin nonhydrolysis mechanism of plant cell wallextension (19–24). In plant cell walls, cellulose microfibrils are linked to matrix poly-saccharides, such as xyloglucan and arabinoxylan, via hydrogen bonds; therefore,expansins without hydrolytic activity can induce plant cell wall extension only bydisrupting the hydrogen bonds between cellulose microfibrils and matrix polysaccha-rides (19–24). So, in FESEM images of plant cell walls, the ultrastructures of acid-inducedextended native cell walls and expansin-reconstituted extended heat-inactivated cellwalls were indistinguishable from those of neutral buffer-treated unextended nativecell walls and heat-inactivated unextended cell walls. All of them exhibited similarlytransverse cellulose microfibrils (53). However, the chitin microfibrils in fungal cell wallsare covalently linked to the nonreducing end of �-glucans (7, 9, 10, 54); therefore, onlyhydrolysis can disrupt this covalent cross-linkage between chitin microfibrils and�-glucans to induce fungal cell wall extension.

MATERIALS AND METHODSChemicals and enzymes. All chitin oligosaccharides used in this study were purchased from Elicityl

Oligotech (27).Antibodies against ChiE1 (anti-ChiE1) or ChiIII (anti-ChiIII) raised in New Zealand White rabbits by

recombinant ChiE1 or ChiIII were prepared commercially by GenScript.

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 12

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

Chitinases ChiIII, ChiEn1, ChiB1, ChiE1, and ChiEn3 were prepared according to previous reports (17,25–28). Chitinase activity and protein amount were analyzed as described in Niu et al. (17).

Strains and cultures. C. cinereus strain ATCC 56838 and strain AmutBmut (A43mut B43mut pab1-1)were purchased from the American Type Culture Collection (ATCC) and Japan Collection of Microorgan-isms (JCM), respectively. Mycelium and fruiting bodies of ATCC 56838, AmutBmut, and transformants ofAmutBmut were grown on potato dextrose-yeast extract agar (PDYA) medium according to previousmethods (5, 55). For production of oidia, the AmutBmut strain and transformants of AmutBmut werecultured on YMG agar medium (4 g yeast extract, 10 g malt extract, 4 g glucose, 10 g agar per liter) inpetri dishes 6.5 cm in diameter according to the method of Dörnte and Kües (56).

Protein extraction. For preparation of soluble and wall-associated protein extraction from stipefragments for the wall extension assay, 100 g of apical stipe segments without pilei was homogenizedin a 100-ml prechilled grind buffer (25 mM HEPES [pH 7.0] and 2 mM sodium metabisulfite) with a Waringblender. The wall debris was collected by filtration through a nylon screen (500 mesh), and the filtratewas designated the soluble protein extraction. Wall debris was washed three times with the grind bufferand then extracted in 50 ml of high-salt buffer (20 mM HEPES [pH 7.0], 1 M NaCl, 2 mM EDTA, and 3 mMsodium metabisulfite) at 4°C for 1 h. The cell wall protein extraction was filtered through a nylon screen(500 mesh) and collected. After centrifugation, the cell wall proteins were precipitated from theextraction between 40% and 60% saturation of ammonium sulfate. The precipitate was dissolved in50 mM sodium acetate (NaAc)-acetic acid (HAc) (pH 4.5), dialyzed overnight against 50 mM NaAc-HAc(pH 4.5), and further desalted on a Bio-Gel P-6 column (50 by 2.5 cm; Bio-Rad), which was designated thewall protein extraction.

For preparation of wall protein extractions from stipe fragments for Western blotting, 1 g stipefragments from different regions of fruiting bodies of 60-mm length was ground in liquid nitrogen to finepowder, extracted in 1 ml of grind buffer (25 mM HEPES [pH 7.0], 2 mM sodium metabisulfite, 0.1% TritonX-100, and 5 mM phenylmethylsulfonyl fluoride [PMSF]) at 4°C for 10 min, and centrifuged at 4°C and10,000 � g for 10 min. The wall debris was suspended in 2 ml grind buffer and vortexed slightly at 4°Cfor 10 min, then centrifuged again to wash out soluble proteins from cell walls; washing was repeatedtwice. The wall debris was extracted in 0.5 ml of high-salt buffer at 4°C for 1 h, then centrifuged at 4°Cand 10,000 � g for 10 min. The supernatant and wall debris pellets were collected, and extraction wasrepeated twice. These three supernatants were combined, dialyzed against 50 mM NaAc-HAc buffer (pH4.5) at 4°C, and centrifuged at 4°C and 12,000 � g for 10 min; the supernatant was collected as the wallprotein extraction.

Measurement of wall extension. The measurement of cell wall extension was performed on aconstant-load extensometer under a constant tension force (19). Approximately 10-mm fragments ofdifferent regions of C. cinerea stipes, F. velutipes apical stipes, cucumber apical hypocotyls, andwheat apical coleoptiles were treated and measured under the same conditions as previouslydescribed (1, 5, 19).

Analysis and characterization of soluble sugars released from extending stipes. At the end ofthe measurement of wall extension, the bathing solution was combined with boiled water to 1 ml andthen heated at 100°C for 10 min. After centrifugation and filtration, the supernatant was analyzed byCarboPac PA-1 high-performance anion exchange chromatography with pulsed amperometric detection(HPAEC-PAD) (27). The different soluble sugar fractions from the CarboPac PA-1 column were collectedprior to being mixed with sodium hydroxide to flow through the IC amperometric detector, lyophilized,dissolved in 50 �l of 0.5% methanol, and subjected to characterization by SolariX 9.4T Fourier-transformion cyclotron resonance mass spectrometry (FTICR-MS) coupled with an electrospray ionization (ESI)source (Bruker) in positive ion mode (57).

FESEM. Preparation of stipe fragments and observation of cell wall architecture by FESEM wereperformed as described by Niu et al. (6).

Immunogold labeling and electron microscopy. The stipe fragments were fixed in 2% glutaral-dehyde in phosphate-buffered saline (PBS; 10 mM, pH 7.2 to 7.4) for 15 h at 4°C and postfixed in 1% OsO4

in PBS for 2 h at 4°C. After washing, these fragments were dehydrated through 30%, 50%, 70%, 80%, 90%,and 100% acetone, then embedded in Eponate 12 resin (Ted Pella) and successively polymerized at 30°C,45°C, and 60°C. The resin block containing stipe fragments was cut to 90- to100-nm thickness using anUltracut R microtome (Leica). Sections on the grids were first incubated with a blocking solution(10 mg/ml bovine serum albumin [BSA] in Tris-buffered saline [TBS]) overnight, then incubated withrabbit anti-ChiE1 (1:500), anti-ChiIII (1:500), or preimmune serum (for control) in TBS with Tween 20 (TBST;20 mM Tris [pH 8.0], 500 mM NaCl, and 0.05% Tween 20) for 4 h, and finally incubated with goatanti-rabbit IgG (whole molecule)-gold antibody (10 nm-gold, 15-fold dilution, catalog no. G7402; Sigma)in TBST for 2 h. After each antibody incubation, grids were washed once with TBST containing 1% BSAfor 5 min, followed by five washes with TBS for 25 min total. After immunolabeling, sections were stainedwith 2% aqueous uranyl acetate for 30 min and lead citrate for 6 min. After each stain, sections werewashed three times with bidistilled H2O and then observed using a Hitachi H7650 transmission electronmicroscope at 80 kV (57).

Construction of gene silencing plasmids and DNA transformation. For construction of genesilencing plasmids, a 300-bp fragment of the Agaricus bisporus gpdII promoter, a 57-bp nonfunctional“loop” sequence of Escherichia coli uidA with an NcoI site at the 5= end and KpnI at the 3= end, and an805-bp fragment of the Aspergillus nidulans trpC terminator were cloned into the multicloning site ofplasmid pUC19 at the EcoRI and HindIII site to generate plasmid pCcExp using the ClonExpress MultiSone-step cloning kit (C113; Vazyme). Nucleotide base pairs (bp) 750 to 1 of the antisense fragmentsequence and bp 101 to 750 of the sense fragment sequence of chiE1 or chiIII were ligated into Noc1 and

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 13

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

KpnI sites, respectively, of the plasmid pCcExp to generate plasmids pCcchiE1dsRNA and pCcchiIIIdsRNA,respectively. A 3,929-bp PCR fragment of the p-aminobenzoic acid synthetase gene (Ccpab1) with itspromoter and terminator was ligated into the cloning site of plasmids pEASY-Blunt Zero (CB501;Transgen) to generate plasmid pCcpab-1 (29, 30, 58).

TABLE 1 Primers used in PCR in this study

Primer name Oligonucleotide sequence (5=–3=)Primers used in qRT-PCR

�-Tubulin-F GGAGAGACCTTTTGGGAGATGC�-Tubulin-R CATGGTCGACTTGGTCGAAATATACQ-EAU80760-F GTCGGATACTTCGTGAACTGGGQ-EAU80760-R GGTTGATGTTGGCAAAGGCATAQ-EAU84887-F CCCTCTGGCAAGAAACACCGQ-EAU84887-R GGAGACGACGACAAAGGATGAAAQ-EAU93428-F CGGTGAATGGAGTGCAGTGAGQ-EAU93428-R ATCGTAGGCGACGGAAGAGGQ-EAU86796-F GACCCCTACTCCGACGAACAGAQ-EAU86796-R CCACCCGCCAATAGACAAAAGQ-EAU81461-F TTGAACGCCACGCAAGTCCTQ-EAU81461-R TCGTCGTCGCAAAAGCAAACQ-EAU81455-F ATCCATCCTCTTGTCGCTGCTGQ-EAU81455-R ACCCGTGGTCGTGTCCTTCAQ-EAU84319-F TCGTCGCACTTCTCAGCACTCQ-EAU84319-R GGGTATCCCGTCGTAGCATGQ-EAU91084-F GCTTACTTTTGCCCAGTTGCCQ-EAU91084-R GATGAGATCGTCTGTCGGTGCT

Primers used in PCR for construction of gene silencing plasmidsCcpab1-F CGAAGCAACTGAAGGAGCGTTGAGAGCCcpab1-R GGATCCTTCCGAGCGTCCTCTCGATATCI-PAbgpdII-F GTTGTAAAACGACGGCCAGTGAATTCTGCGATGAGGTTGTGTATGTAGCGAAGI-PAbgpdII-R TCGTTGGCAATACTCCACCCATGGCGATGAGCTTGTTGTGTGTAGATGI-TAntrpC-F TGCCAACGAACCGGATACCCGTCCGCAAGGTGCACGGGAATATTTCGCGGTACCAGTA

GATGCCGACCGGGATCCACI-TAntrpC-R GCTATGACCATGATTACGCCAAGCTTTGCATGCCTGCAGGTCGAGTGI-EAU80760-a-F CACACAACAAGCTCATCGCCATGGTCTGGTCCAGCGCTTCCCGTAGI-EAU80760-a-R TCGTTGGCAATACTCCACCCATGGATCTTCTTCAAAGCCGGACAATACTCTGI-EAU80760-s-F TGCACGGGAATATTTCGCGGTACCTGCCCACTGAACCGTCTCCAACI-EAU80760-s-R ATCCCGGTCGGCATCTACTGGTACCTCTGGTCCAGCGCTTCCCGTAGI-EAU93428-a-F CACACAACAAGCTCATCGCCATGGCGAGTACCAAAGACCAAAGTTCCAGTTCGAGI-EAU93428-a-R TCGTTGGCAATACTCCACCCATGGATGCTTGTCTTCTGTACGGGGCTCGTCI-EAU93428-s-F TGCACGGGAATATTTCGCGGTACCACTCGTATGGGGCAGGTCATTCAGATCTTGI-EAU93428-s-R ATCCCGGTCGGCATCTACTGGTACCCGAGTACCAAAGACCAAAGTTCCAGTTCGAG

Primers used in genomic PCRG-extraPCcpab1-up-F CAGGAAACAGCTATGACCATGATTACGCG-PCcpab1-up-R GCGTGAATGAGTCGTACGAATCGACG-TCcpab-down-F GGTGAGGAAGTTGAGGTCGGTATGGG-extraTCcpab1-down-R GTAAAACGACGGCCAGTGAATTGTAATACG-extraPAbgpdII-F GCACCATATGCGGTGTGAAATACCGG-PAbgpdII-R TGGGAGAAAACGGAGATGGTGGATGG-TAntrpC-F GACTGAGGAATCCGCTCTTGGCTCCG-extraTAntrpC-R GCTTCCGGCTCGTATGTTGTGTGGG-PAbgpdII-F1 TGTTCCCGCGTCTCGAATGTTCG-EAU80760-a-R TCAGATGTTTGGGCCGACAAAGACG-EAU80760-s-F CCATCTATTCGGAAACTTCAAGGCTATCG-TAntrpC-R1 TGGAAGAGGTAAACCCGAAACGCG-PAbgpdII-F2 GCGTCATTCTGTGTCAGGCTAGCAGG-EAU93428-a-R GATCGGATATGAGGCCGTTTGGGG-EAU93428-s-F ATATGAGGCCGTTTGGGAACGCG-TAntrpC-R2 CGCGTTTTATTCTTGTTGACATGGAG

Primers used in PCR for Southern blot probesS-PAbgpdII-F TGCGATGAGGTTGTGTATGTAGCGAAGS-PAbgpdII-R GGCGATGAGCTTGTTGTGTGTAGATGS-EAU80760-s-F TGCCCACTGAACCGTCTCCAACS-EAU80760-s-R TCTGGTCCAGCGCTTCCCGTAGS-EAU93428-s-F ACTCGTATGGGGCAGGTCATTCAGATCTTGS-EAU93428-s-R CGAGTACCAAAGACCAAAGTTCCAGTTCGAG

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 14

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase“Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotrans-formed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods(56, 59). The mycelia of transformants grown on standard minimal medium (SMM) agar were picked upand checked, and the confirmed transformants were inoculated onto YMG agar medium for productionof oidia. The resulting oidium suspension in sterile double-distilled H2O was mixed with an equal volumeof sterile 50% glycerol and kept at �80°C for inoculation for determination of mycelium and fruitingbody growth.

Genomic PCR analysis. Genomic DNA was prepared from the mycelia of transformants using aUNlQ-10 column fungal genomic DNA isolation kit (catalog no. B511375; Sangon). The genomic DNApreparations were amplified by PCR using two pairs of primers for each plasmid (Table 1). For confir-mation of integration of pCcpab-1 in the genome, a fragment between the plasmid backbone andPCcpab1 and a fragment between TCcpab1 and the plasmid backbone were amplified; for confirmationof integration of pCcExp in the genome, a fragment between the plasmid backbone and PAbgpdII anda fragment between TAntrpC and the plasmid backbone were amplified; for confirmation of integrationof pCcchiE1dsRNA in the genome, a fragment between PAbgpdII and chiE1antisense and a fragmentbetween chiE1sense and TAntrpC were amplified; and for confirmation of integration of pCcchiE1dsRNAin the genome, a fragment between PAbgpdII and chiIIIantisense and a fragment between chiIIIsense andTAntrpC were amplified. PCR was performed using a 2� Taq master mix (Dye Plus) kit (catalog no. P112;Vazyme), and the amplified products were analyzed by 1% agarose gel electrophoresis.

Southern blotting. Genomic DNAs were isolated by a cetyltrimethylammonium bromide (CTAB)method (60), digested with HindIII or KpnI, separated on 0.7% agarose gel, and transferred to a nylonmembrane (Zeta-Probe�, catalog no. 1141724001; Roche). Specific DNA fragments were detected usinga digoxigenin (DIG)-High Prime DNA labeling and detection starter kit II (catalog no. 11585614910;Roche). The hybridization probes were generated by PCR using probe primers (Table 1), DIG-dUTP-containing nucleotide mix (catalog no. 11585614910; Roche), and Taq polymerase.

qRT-PCR analysis. Total RNA was extracted from stipe fragments, first-strand cDNA was synthesizedfrom total RNA, and qRT-PCR analysis was conducted using a pair of specific primers for each gene (Table1) as described by Liu et al. (16).

Western blotting. Protein samples (60 �g) were separated on an SDS-12% PAGE gel and transferredonto polyvinylidene difluoride (PVDF) membranes (Immobilon-P) by using a Trans-Blot semidry transferunit (Bio-Rad). At room temperature, the PVDF membranes were incubated with agitation in TBSTsolution (0.15 M NaCl, 0.02 M Tris [pH 8.0], and 0.05% Tween 20) for 10 min, then blocked with 5%(wt/vol) skim milk in TBST solution for 2 h. After being washed three times with TBST solution for 5 mineach time, the PDVF membranes were incubated with rabbit anti-ChiE1 or anti-ChiIII (dilution 1:3,000) inTBST solution containing 3% BSA for 2 h, washed again with agitation with TBST solution five times for10 min each time, then incubated with goat anti-rabbit IgG, horseradish peroxidase (HRP)-linked anti-bodies (dilution 1:3,000, catalog no. 7074P2; Cell Signal Tech) in TBST solution containing 3% BSA for 2 h,and finally washed with agitation with TBST solution five times for 10 min each time. Western blots weredeveloped using the Enhanced ECL chemiluminescence detection kit (catalog no. E411; Vazyme) andimages were collected with the Tanon-5200 chemiluminescent imaging system.

SUPPLEMENTAL MATERIALSupplemental material for this article may be found at https://doi.org/10.1128/AEM

.00532-19.SUPPLEMENTAL FILE 1, PDF file, 0.5 MB.

ACKNOWLEDGMENTSThis work was supported by the National Natural Science Foundation of China (grant

no. 31570046) and the Priority Academic Development Program of Jiangsu HigherEducation Institutions.

We declare no competing financial interests.

REFERENCES1. Fang HJ, Zhang WM, Niu X, Liu ZH, Lu CM, Wei H, Yuan S. 2014. Stipe wall

extension of Flammulina velutipes could be induced by an expansin-likeprotein from Helix aspersa. Fungal Biol 118:1–11. https://doi.org/10.1016/j.funbio.2013.10.003.

2. Kamada T, Takemaru T, Prosser JI, Gooday GW. 1991. Right and lefthanded helicity of chitin microfibrils in stipe cells in Coprinus cinereus.Protoplasma 165:64 –70. https://doi.org/10.1007/BF01322277.

3. Kües U. 2000. Life history and developmental processes in the basidi-omycete Coprinus cinereus. Microbiol Mol Biol Rev 64:316 –353. https://doi.org/10.1128/MMBR.64.2.316-353.2000.

4. Mol PC, Vermeulen CA, Wessels J. 1990. Diffuse extension of hyphae instipes of Agaricus bisporus may be based on a unique wall structure.Mycol Res 94:480 – 488. https://doi.org/10.1016/S0953-7562(10)80007-3.

5. Zhang WM, Wu XX, Zhou YJ, Liu ZH, Zhang W, Niu X, Zhao Y, Pei SY,Zhao Y, Yuan S. 2014. Characterization of stipe elongation of themushroom Coprinopsis cinerea. Microbiology 160:1893–1902. https://doi.org/10.1099/mic.0.079418-0.

6. Niu X, Liu ZH, Zhou YJ, Wang J, Zhang WM, Yuan S. 2015. Stipe cellwall architecture varies with the stipe elongation of the mushroomCoprinopsis cinerea. Fungal Biol 119:946 –956. https://doi.org/10.1016/j.funbio.2015.07.008.

7. Arroyo J, Farkaš V, Sanz AB, Cabib E. 2016. Strengthening the fungal cell wallthrough chitin-glucan cross-links: effects on morphogenesis and cell integrity.Cell Microbiol 18:1239–1250. https://doi.org/10.1111/cmi.12615.

8. Bowman SM, Free SJ. 2006. The structure and synthesis of the fungal cellwall. Bioessays 28:799 – 808. https://doi.org/10.1002/bies.20441.

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 15

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

9. Cabib E, Arroyo J. 2013. How carbohydrates sculpt cells: chemical controlof morphogenesis in the yeast cell wall. Nat Rev Microbiol 11:648 – 655.https://doi.org/10.1038/nrmicro3090.

10. Langner T, Gohre V. 2016. Fungal chitinases: function, regulation, andpotential roles in plant/pathogen interactions. Curr Genet 62:243–254.https://doi.org/10.1007/s00294-015-0530-x.

11. Latge JP. 2007. The cell wall: a carbohydrate armour for the fungalcell. Mol Microbiol 66:279 –290. https://doi.org/10.1111/j.1365-2958.2007.05872.x.

12. Kamada T, Fujii T, Nakagawa T, Takemaru T. 1985. Changes in (1¡3)-�-glucanase activities during stipe elongation in Coprinus cinereus. CurrMicrobiol 12:257–259. https://doi.org/10.1007/BF01567974.

13. Fukuda K, Hiraga M, Asakuma S, Arai I, Sekikawa M, Urashima T. 2008.Purification and characterization of a novel exo-beta-1,3-1,6-glucanasefrom the fruiting body of the edible mushroom Enoki (Flammulinavelutipes). Biosci Biotechnol Biochem 72:3107–3113. https://doi.org/10.1271/bbb.80213.

14. Sakamoto Y, Irie T, Sato T. 2005. Isolation and characterization of afruiting body-specific exo-�-1,3-glucanase-encoding gene, exg1, fromLentinula edodes. Curr Genet 47:244–252. https://doi.org/10.1007/s00294-005-0563-7.

15. Tao YX, Xie BG, Yang ZY, Chen ZH, Chen BZ, Deng YJ, Jiang YJ, Peer AF.2013. Identification and expression analysis of a new glycoside hydro-lase family 55 exo-�-1,3-glucanase-encoding gene in Volvariella volvaceasuggests a role in fruiting body development. Gene 527:154 –160.https://doi.org/10.1016/j.gene.2013.05.071.

16. Liu ZH, Niu X, Wang J, Zhang WM, Yang MM, Liu CC, Xiong YJ, Zhao Y,Pei SY, Qin Q, Zhang Y, Yu Y, Yuan S. 2015. Comparative study ofnonautolytic mutant and wild-type strains of Coprinopsis cinerea sup-ports an important role of glucanases in fruiting body autolysis. J AgricFood Chem 63:9609 –9614. https://doi.org/10.1021/acs.jafc.5b03962.

17. Niu X, Liu CC, Xiong YJ, Yang MM, Ma F, Liu ZH, Yuan S. 2016. The modesof action of ChiIII, a chitinase from mushroom Coprinopsis cinerea, shiftwith changes in the length of GlcNAc oligomers. J Agric Food Chem64:6958 – 6968. https://doi.org/10.1021/acs.jafc.6b03086.

18. Stajich JE, Wilke SK, Ahren D, Au CH, Birren BW, Borodovsky M, Burns C,Canback B, Casselton LA, Cheng CK, Deng J, Dietrich FS, Fargo DC,Farman ML, Gathman AC, Goldberg J, Guigo R, Hoegger PJ, Hooker JB,Huggins A, James TY, Kamada T, Kilaru S, Kodira C, Kues U, Kupfer D,Kwan HS, Lomsadze A, Li W, Lilly WW, Ma L-J, Mackey AJ, Manning G,Martin F, Muraguchi H, Natvig DO, Palmerini H, Ramesh MA, RehmeyerCJ, Roe BA, Shenoy N, Stanke M, Ter-Hovhannisyan V, Tunlid A, Velaga-pudi R, Vision TJ, Zeng Q, Zolan ME, Pukkila PJ. 2010. Insights intoevolution of multicellular fungi from the assembled chromosomes of themushroom Coprinopsis cinerea (Coprinus cinereus). Proc Natl Acad SciU S A 107:11889 –11894. https://doi.org/10.1073/pnas.1003391107.

19. McQueen-Mason S, Durachko DM, Cosgrove DJ. 1992. Two endogenousproteins that induce cell wall extension in plants. Plant Cell 4:1425–1433.https://doi.org/10.1105/tpc.4.11.1425.

20. Cosgrove DJ. 2000. Loosening of plant cell walls by expansins. Nature407:321–326. https://doi.org/10.1038/35030000.

21. Cosgrove DJ. 2005. Growth of the plant cell wall. Nat Rev Mol Cell Biol6:850 – 861. https://doi.org/10.1038/nrm1746.

22. McQueen-Mason SJ, Cosgrove DJ. 1995. Expansin mode of action on cellwalls—analysis of wall hydrolysis, stress-relaxation, and binding. PlantPhysiol 107:87–100. https://doi.org/10.1104/pp.107.1.87.

23. Qin L, Kudla U, Roze EHA, Goverse A, Popeijus H, Nieuwland J, OvermarsH, Jones JT, Schots A, Smant G, Bakker J, Helder J. 2004. Plantdegradation: a nematode expansin acting on plants. Nature 427:30.https://doi.org/10.1038/427030a.

24. Wang T, Park YB, Caporini MA, Rosay M, Zhong LH, Cosgrove DJ, HongM. 2013. Sensitivity-enhanced solid-state NMR detection of expansin’starget in plant cell walls. Proc Natl Acad Sci U S A 110:16444 –16449.https://doi.org/10.1073/pnas.1316290110.

25. Niu X, Zhou JS, Wang YX, Liu CC, Liu ZH, Yuan S. 2017. Heterologousexpression and characterization of a novel chitinase (ChiEn1) from Co-prinopsis cinerea and its synergism in the degradation of chitin. J AgricFood Chem 65:6943– 6956. https://doi.org/10.1021/acs.jafc.7b02278.

26. Zhou YJ, Kang LQ, Niu X, Wang J, Liu ZH, Yuan S. 2016. Purification,characterization and physiological significance of a chitinase from thepilei of Coprinopsis cinerea fruiting bodies. FEMS Microbiol Lett 363:fnw120. https://doi.org/10.1093/femsle/fnw120.

27. Zhou JS, Chen LL, Kang LQ, Liu ZH, Bai Y, Yang Y, Yuan S. 2018. ChiE1from Coprinopsis cinerea is characterized as a processive exochitinase

and revealed to have a significant synergistic action with endochitinaseChiIII on chitin degradation. J Agric Food Chem 66:12773–12782. https://doi.org/10.1021/acs.jafc.8b04261.

28. Zhou JS, Dai RJ, Wang YX, Li MM, Zhu YT, Chen LL, Kang LQ, Liu ZH, YangY, Yuan S. 2019. A novel thermophilic exochitinase ChiEn3 from Copri-nopsis cinerea exhibits a hyperhydrolytic activity toward 85% deacety-lated chitosan and a significant application to preparation of chitooli-gosaccharides from the chitosan. Carbohydr Polym 207:729 –736.https://doi.org/10.1016/j.carbpol.2018.12.047.

29. Heneghan MN, Costa AM, Challen MP, Mills PR, Bailey A, Foster GD. 2007.A comparison of methods for successful triggering of gene silencing inCoprinus cinereus. Mol Biotechnol 35:283–296. https://doi.org/10.1007/BF02686014.

30. Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A,Chiku H, Kamada T, Sakaguchi K. 2005. Knockdown of LIM15/DMC1 inthe mushroom Coprinus cinereus by double-stranded RNA-mediatedgene silencing. Microbiology 151:3669 –3678. https://doi.org/10.1099/mic.0.28209-0.

31. Adams DJ. 2004. Fungal cell wall chitinases and glucanases. Microbiol-ogy 150:2029 –2035. https://doi.org/10.1099/mic.0.26980-0.

32. Hejazi R, Amiji M. 2003. Chitosan-based gastrointestinal deliverysystems. J Control Release 89:151–165. https://doi.org/10.1016/S0168-3659(03)00126-3.

33. Ortega JK, Truong JT, Munoz CM, Ramirez DG. 2015. Cell wall looseningin the fungus, Phycomyces blakesleeanus. Plants (Basel) 4:63– 84. https://doi.org/10.3390/plants4010063.

34. Ramakrishnan C, Prasad N. 1972. Rigid-body refinement and conforma-tion of �-chitin. Biochim Biophys Acta 261:123–135. https://doi.org/10.1016/0304-4165(72)90321-2.

35. Hartl L, Zach S, Seidl-Seiboth V. 2012. Fungal chitinases: diversity, mech-anistic properties and biotechnological potential. Appl Microbiol Bio-technol 93:533–543. https://doi.org/10.1007/s00253-011-3723-3.

36. Balestrini R, Mainieri D, Soragni E, Garnero L, Rollino S, Viotti A, OttonelloS, Bonfante P. 2000. Differential expression of chitin synthase III and IVmRNAs in ascomata of Tuber borchii vittad. Fungal Genet Biol 31:219 –232. https://doi.org/10.1006/fgbi.2000.1242.

37. Wang YX, Niu X, Guo XL, Yu H, Liu ZH, Zhang ZQ, Yuan S. 2018.Heterologous expression, characterization and possible functions of thechitin deacetylases, Cda1 and Cda2, from mushroom Coprinopsis cinerea.Glycobiology 28:318 –332. https://doi.org/10.1093/glycob/cwy007.

38. Bartnicki-Garcia S. 1973. Fundamental aspects of hyphal morphogenesis.Symp Soc Gen Microbiol 23:245–267.

39. Bartnicki-Garcıa S. 1999. Glucans, walls, and morphogenesis: on thecontributions of J. G. H. Wessels to the golden decades of fungalphysiology and beyond. Fungal Genet Biol 27:119 –127. https://doi.org/10.1006/fgbi.1999.1144.

40. Jaques AK, Tamo F, Diana H, Barton RC, Escott GM, Parkinson T, Hitch-cock CA, Adams DJ. 2003. Disruption of the gene encoding the ChiB1chitinase of Aspergillus fumigatus and characterization of a recombinantgene product. Microbiology 149:2931–2939. https://doi.org/10.1099/mic.0.26476-0.

41. Reichard U, Hung CY, Thomas PW, Cole GT. 2000. Disruption of the genewhich encodes a serodiagnostic antigen and chitinase of the humanfungal pathogen Coccidioides immitis. Infect Immun 68:5830 –5838.https://doi.org/10.1128/iai.68.10.5830-5838.2000.

42. Yamazaki H, Yamazaki D, Takaya N, Takagi M, Ohta A, Horiuchi H. 2007. Achitinase gene, chiB, involved in the autolytic process of Aspergillus nidulans.Curr Genet 51:89–98. https://doi.org/10.1007/s00294-006-0109-7.

43. Yamazaki H, Tanaka A, Kaneko J, Ohta A, Horiuchi H. 2008. Aspergillusnidulans ChiA is a glycosylphosphatidylinositol (GPI)-anchored chitinasespecifically localized at polarized growth sites. Fungal Genet Biol 45:963–972. https://doi.org/10.1016/j.fgb.2008.02.008.

44. Alcaura-Fuoli L, Clavaud C, Lamarre C, Aimanianda V, Seidl-Seiboth V,Mellado E, Latge JP. 2011. Functional analysis of the fungal/plant classchitinase family in Aspergillus fumigatus. Fungal Genet Biol 48:418 – 429.https://doi.org/10.1016/j.fgb.2010.12.007.

45. Tzelepis GD, Melin P, Dan FJ, Stenlid J, Karlsson M. 2012. Functionalanalysis of glycoside hydrolase family 18 and 20 genes in Neurosporacrassa. Fungal Genet Biol 49:717–730. https://doi.org/10.1016/j.fgb.2012.06.013.

46. Langner T, Merve Ö, Hartmann S, Cord-Landwehr S, Moerschbacher B,Walton JD, Göhre V. 2015. Chitinases are essential for cell separation inUstilago maydis. Eukaryot Cell 14:846 – 857. https://doi.org/10.1128/EC.00022-15.

Zhou et al. Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 16

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from

47. Kuranda MJ, Robbins PW. 1991. Chitinase is required for cell separa-tion during growth of Saccharomyces cerevisiae. J Biol Chem 266:19758 –19767.

48. Morin E, Kohler A, Baker AR, Foulongne-Oriol M, Lombard V, Nagy LG,Ohm RA, Patyshakuliyeva A, Brun A, Aerts AL, Bailey AM, Billette C,Coutinho PM, Deakin G, Doddapaneni H, Floudas D, Grimwood J, HildénK, Kües U, Labutti KM, Lapidus A, Lindquist EA, Lucas SM, Murat C, RileyRW, Salamov AA, Schmutz J, Subramanian V, Wösten HA, Xu J, EastwoodDC, Foster GD, Sonnenberg AS, Cullen D, de Vries RP, Lundell T, HibbettDS, Henrissat B, Burton KS, Kerrigan RW, Challen MP, Grigoriev IV, MartinF. 2012. Genome sequence of the button mushroom Agaricus bisporusreveals mechanisms governing adaptation to a humic-rich ecologicalniche. Proc Natl Acad Sci U S A 109:17501–17506. https://doi.org/10.1073/pnas.1206847109.

49. Shim D, Park SG, Kim K, Bae W, Lee GW, Ha BS, Ro HS, Kim M, Ryoo R,Rhee SK, Nou IS, Koo CD, Hong CP, Ryu H. 2016. Whole genome de novosequencing and genome annotation of the world popular cultivatededible mushroom, Lentinula edodes. J Biotechnol 223:24 –25. https://doi.org/10.1016/j.jbiotec.2016.02.032.

50. Sakamoto Y, Nakade K, Sato T. 2009. Characterization of the post-harvest changes in gene transcription in the gill of the Lentinulaedodes fruiting body. Curr Genet 55:409 – 423. https://doi.org/10.1007/s00294-009-0255-9.

51. Sakamoto Y, Nakade K, Sato S, Yoshida K, Miyazaki K, Natsume S, KonnoN. 2017. Lentinula edodes genome survey and postharvest transcriptomeanalysis. Appl Environ Microbiol 83:e02990-16. https://doi.org/10.1128/AEM.02990-16.

52. Vetchinkina E, Kupryashina M, Gorshkov V, Ageeva M, Gogolev Y, Ni-kitina V. 2017. Alteration in the ultrastructural morphology of mycelialhyphae and the dynamics of transcriptional activity of lytic enzyme

genes during basidiomycete morphogenesis. J Microbiol 55:280 –288.https://doi.org/10.1007/s12275-017-6320-z.

53. Marga F, Grandbois M, Cosgrove DJ, Baskin TI. 2005. Cell wall extensionresults in the coordinate separation of parallel microfibrils: evidencefrom scanning electron microscopy and atomic force microscopy. PlantJ 43:181–190. https://doi.org/10.1111/j.1365-313X.2005.02447.x.

54. Teparic R, Mrša V. 2013. Proteins involved in building, maintaining andremodeling of yeast cell walls. Curr Genet 59:171–185. https://doi.org/10.1007/s00294-013-0403-0.

55. Kamada T, Hamada Y, Takemaru T. 1982. Autolysis in vitro of the stipecell wall in Coprinus macrorhizus. J Gen Microbiol 128:1041–1046.https://doi.org/10.1099/00221287-128-5-1041.

56. Dörnte B, Kües U. 2012. Reliability in transformation of the basidiomy-cete Coprinopsis cinerea. Curr Trends Biotechnol Pharm 6:340 –355.

57. Shams-Ud-Doha K, Kitova EN, Kitov PI, St-Pierre Y, Klassen JS. 2017.Human milk oligosaccharide specificities of human galectins. Compari-son of electrospray ionization mass spectrometry and glycan microarrayscreening results. Anal Chem 89:4914 – 4921. https://doi.org/10.1021/acs.analchem.6b05169.

58. Wälti MA, Villalba C, Buser RM, Grünler A, Aebi M, Künzler M. 2006.Targeted gene silencing in the model mushroom Coprinopsis cinerea(Coprinus cinereus) by expression of homologous hairpin RNAs. EukaryotCell 5:732–744. https://doi.org/10.1128/EC.5.4.732-744.2006.

59. Binninger DM, Skrzynia C, Pukkila PJ, Casselton LA. 1987. DNA-mediatedtransformation of the basidiomycete Coprinus cinereus. EMBO J6:835– 840. https://doi.org/10.1002/j.1460-2075.1987.tb04828.x.

60. Klimyuk VI, Nussaume L, Harrison K, Jones JD. 1995. Novel GUS expres-sion patterns following transposition of an enhancer trap Ds element inArabidopsis. Mol Gen Genet 249:357–365.

Chitinases Play a Role in Stipe Cell Wall Expansion Applied and Environmental Microbiology

August 2019 Volume 85 Issue 15 e00532-19 aem.asm.org 17

on May 22, 2021 by guest

http://aem.asm

.org/D

ownloaded from