Effect of Female Sex Hormones on

Chlamydia trachomatis Growth and Gene Expression

By

Ashkan Amirshahi B.Sc., Grad. Cert. in Biotech

May 2009

School of Life Sciences

Queensland University of Technology

Submitted to Queensland University of Technology for the degree of Masters

i | P a g e

Abstract Transmissible diseases are re-emerging as a global problem, with Sexually Transmitted

Diseases (STDs) becoming endemic. Chlamydia trachomatis is the leading cause of

bacterially-acquired STD worldwide, with the Australian cost of infection estimated at $90 -

$160 million annually.

Studies using animal models of genital tract Chlamydia infection suggested that the hormonal

status of the genital tract epithelium at the time of exposure may influence the outcome of

infection. Oral contraceptive use also increased the risk of contracting chlamydial infections

compared to women not using contraception. Generally it was suggested that the outcome of

chlamydial infection is determined in part by the hormonal status of the epithelium at the

time of exposure.

Using the human endolmetrial cell line ECC-1 this study investigated the effects of C.

trachomatis serovar D infection, in conjunction with the female sex hormones, 17β-estradiol

and progesterone, on chlamydial gene expression. While previous studies have examined the

host response, this is the first study to examine C.trachomatis gene expression under different

hormonal conditions. We have highlighted a basic model of C. trachomatis gene regulation in

the presence of steroid hormones by identifying 60 genes that were regulated by addition of

estradiol and/or progesterone. In addition, the third chapter of this thesis discussed and

compared the significance of the current findings in the context of data from other research

groups to improve our understanding of the molecular basis of chlamydial persistence under

hormonal different conditions. In addition, this study analysed the effects of these female sex

hormones and C. trachomatis Serovar D infection, on host susceptibility and bacterial

growth. Our results clearly demonstrated that addition of steroid hormones not only had a

great impact on the level of infectivity of epithelial cells with C.trachomatis serovar D, but

also the morphology of chlamydial inclusions was affected by hormone supplementation.

ii | P a g e

Contents ABSTRACT ................................................................................................................................................................. I CONTENTS ................................................................................................................................................................II LIST OF FIGURES .................................................................................................................................................. IV LIST OF TABLES ...................................................................................................................................................... V LIST OF ABBREVIATIONS .................................................................................................................................. VI DECLARATION ................................................................................................................................................... VIII ACKNOWLEDGEMENTS ..................................................................................................................................... IX

CHAPTER 1 ................................................................................................................................................................... INTRODUCTION AND LITERATURE REVIEW ................................................................................................... 1. INTRODUCTION ................................................................................................................................................... 2

1.1 Chlamydia -------------------------------------------------------------------------------------------------------------------- 2 1.1.1 History and Taxonomy ............................................................................................................................ 2 1.1.2 C. trachomatis ......................................................................................................................................... 3 1.1.3 Epidemiology .......................................................................................................................................... 5 1.1.4 Structure and Genomics ........................................................................................................................... 6 1.1.5 The chlamydial development cycle ......................................................................................................... 8 1.1.6 Alternate growth modes and persistence ............................................................................................... 11 1.1.7 C. trachomatis Treatment ...................................................................................................................... 12

1.3 Female Reproductive Tract (FRT) ----------------------------------------------------------------------------------- 12 1.4 Female Reproductive Cycle ------------------------------------------------------------------------------------------- 15

1.4.1 Menstrual Phase ..................................................................................................................................... 17 1.4.2 Follicular and Proliferative Phases ........................................................................................................ 17 1.4.3 Luteal and Secretory Phases .................................................................................................................. 18 1.4.4 Menopause ............................................................................................................................................. 18

1.5 Female Sex Hormones ------------------------------------------------------------------------------------------------- 20 1.5.1 Estrogen ................................................................................................................................................. 21 1.5.2 Progesterone .......................................................................................................................................... 28 1.5.3 Oral contraceptives ................................................................................................................................ 31

1.2 HYPOTHESIS ..................................................................................................................................................... 33

1.3 AIMS ..................................................................................................................................................................... 33

CHAPTER 2 ................................................................................................................................................................... 2.1 INTRODUCTION ............................................................................................................................................... 38

2.1.1 Effect of steroid hormones on sexually transmitted infections (STI) in humans ------------------------------ 39 2.1.2 Effect of steroid hormones on STI in animal model studies ------------------------------------------------------ 41

2.2 MATERIALS AND METHODS ........................................................................................................................ 45 2.2.1 Cell lines ------------------------------------------------------------------------------------------------------------------- 45 2.2.2 C. trachomatis serovar D growth and propagation ----------------------------------------------------------------- 45 2.2.3 C. trachomatis Serovar D semi purification ------------------------------------------------------------------------- 46 2.2.4 Titration of C. trachomatis serovar D -------------------------------------------------------------------------------- 46 2.2.5 Hormone preparation ---------------------------------------------------------------------------------------------------- 47 2.2.6 Hormonal suppliment of FRT cell lines ------------------------------------------------------------------------------ 48 2.2.7 Statistical analysis -------------------------------------------------------------------------------------------------------- 48

2.3 RESULTS ............................................................................................................................................................. 49

iii | P a g e

2.3.1 Growth of C.trachomatis in ECC-1 cell line under normal conditions ----------------------------------------- 49 2.3.2: Effect of hormone addition on infection of C.trachomatis in ECC-1 cells grown for 1 week ------------- 51 2.3.3: Effect of hormone addition on infection of C.trachomatis ECC-1 cells grown for 26 weeks -------------- 54 2.3.4: Effect of extended hormone pre- suppliment (48 and 72 hrs) on C.trachomatis infection of ECC-1 cells -------------------------------------------------------------------------------------------------------------------------------- 57 2.3.6 Microscopic evidence of chlamydial persistence in hormone treated cultures -------------------------------- 62

2.4 DISCUSSION ....................................................................................................................................................... 63

CHAPTER 3 ............................................................................................................................................................... 70 3.1 INTRODUCTION ............................................................................................................................................... 72

3.1.1 In vitro chlamydial persistence ---------------------------------------------------------------------------------------- 73 3.2 METHODS ........................................................................................................................................................... 77

3.2.1 Cell lines ------------------------------------------------------------------------------------------------------------------- 77 3.2.2 C. trachomatis serovar D growth and propagation ----------------------------------------------------------------- 77 3.2.3 C. trachomatis serovar D semi purification -------------------------------------------------------------------------- 78 3.2.4 Titration of C. trachomatis serovar D -------------------------------------------------------------------------------- 78 3.2.5 Hormone preparation ---------------------------------------------------------------------------------------------------- 79 3.2.6 Hormonal suppliment of FRT cell lines ------------------------------------------------------------------------------ 79 3.2.7 Extraction of total RNA ------------------------------------------------------------------------------------------------- 80 3.2.8 Bacterial RNA Isolation ------------------------------------------------------------------------------------------------- 80 3.2.9 Microarray ----------------------------------------------------------------------------------------------------------------- 81 3.2.9 qRt-PCR ------------------------------------------------------------------------------------------------------------------- 82

3.3 RESULTS ............................................................................................................................................................. 85 3.4 DISCUSSION ....................................................................................................................................................... 92

CHAPTER 4 ................................................................................................................................................................... 4.1 GENERAL DISCUSSION AND CONCLUSIONS ........................................................................................ 102 CHAPTER 5 ............................................................................................................................................................. 108 REFERENCES CITED ........................................................................................................................................... 110

iv | P a g e

List of Figures

FIGURE 1.1: SCHEMATIC OF THE CHLAMYDIA TRACHOMATIS SEROVAR D DEVELOPMENTAL CYCLE. .................... 9

FIGURE 1.2: THIN SECTION ELECTRON MICROSCOPY OF A CELL INFECTED BY C.TRACHOMATIS ........................... 10

FIGURE 1.3: MATURE INCLUSION OF C.TRACHOMATIS ......................................................................................... 10

FIGURE 1.4: SCHEMATIC OF HUMAN FEMALE REPRODUCTIVE TRACT (FRT) ANATOMY ................................... 12

FIGURE 1.5 : SCHEMATIC OF THE HUMAN FEMALE MENSTRUAL CYCLE. ............................................................ 16

FIGURE 1.6: SCIENTIFIC CLASSIFICATION OF SEX STEROIDS ................................................................................ 20

FIGURE 1.7: CHEMICAL STRUCTURE OF ESTRADIOL (E2) .................................................................................... 21

FIGURE 1.8: ENZYMATIC STEPS IN THE CLASSICAL PATHWAY OF ESTRADIOL BIOSYNTHESIS IN THE OVARY ....... 22

FIGURE 1.9: SCHEMATIC DRAWING OF THE MEAN SERUM LEVELS OF E2 ............................................................. 24

FIGURE 1.10: CHEMICAL STRUCTURE OF PROGESTERONE ................................................................................... 29

FIGURE 1.11: OVERVIEW OF PROJECT PLAN. ....................................................................................................... 33

FIGURE 2.1: EXPERIMENTAL PLAN FOR CHAPTER 2 ............................................................................................ 43

FIGURE 2.2: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (IN NORMAL FCS) ................................................... 50

FIGURE 2.2: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS ................................................................................ 50

FIGURE 2.3: PERCENTAGE OF ECC-1 CELLS INFECTED (1 WEEK PASSAGED IN STRRIPED FCS) ........................... 51

FIGURE 2.4: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (1 WEEK PASSAGED IN STRIPPED FCS) .................... 52

FIGURE 2.5: PERCENTAGE OF ECC-1 CELLS INFECTED (26 WEEKS PASSAGED IN STRRIPED FCS) ....................... 54

FIGURE 2.6: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS ( 26 WEEKS PASSAGED IN STRIPPED FCS) ............... 55

FIGURE 2.7: PERCENTAGE OF ECC-1 CELLS INFECTED (48 HRS AND 72 HRS PRE-TREATED WITH HORMONE) ..... 57

FIGURE 2.8: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (48 HRS HORMONE PRE-TREATED) .......................... 58

FIGURE 2.9: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (72 HRS HORMONE PRE-TREATED) .......................... 60

FIGURE 2.10: ABNORMAL MORPHOLOGY OF CHLAMYDIAL INCLUSIONS (ENLARGED RBS) UNDER ESTRADIOL ... 62

FIGURE 3.2: EXPERIEMNTAL PLAN FOR CHAPTER 3 ............................................................................................. 75

FIGURE 3.2: FOLD-CHANGE CHART FOR UP-REGULATED NORMALIZED GENE DATA UNDER P SUPPLIMENT 88

FIGURE 3.3: FOLD-CHANGE CHART FOR DOWN-REGULATED NORMALIZED GENE DATA UNDER P SUPPLIMENT .... 89

v | P a g e

List of Tables

TABLE 1.1: CHLAMYDIA TRACHOMATIS SEROVARS ................................................................................................. 4

TABLE 1.2: SCIENTIFIC CLASSIFICATION OF CHLAMYDIA ..................................................................................... 5

TABLE 1.3: SERUM ESTRADIOL (E2) CONCENTRATIONS DURING INFANCY, CHILDHOOD, DIFFERENT STAGES. .... 25

TABLE 2.1: SUMMARY OF INFLUENCE OF HORMONE SUPPLEMENTATION ON C.TRACHOMATIS SEROVAR D .......... 61

TABLE 3.1: QUALIFICATION AND QUANTIFICATION OF EXTRACTED ECC-1 RNA .............................................. 81

TABLE 3.2: REAL-TIME PCR PRIMERS USED IN THE ABI PRISM 7300 QUANTITATIVE RT-PCR SYSTEM .............. 83

TABLE 3.3: CHLAMYDIAL GENES EXHIBITING REPRODUCIBLE DIFFERENCES IN MRNA EXPRESSION .................. 86

TABLE 3.4: CHLAMYDIAL GENES EXHIBITING DIFFERENCE IN MRNA EXPRESSION ............................................. 87

TABLE 3.5: RELATIVE FOLD CHANGES (UP-REGULATED) FOR DIFFERENTIALLY EXPRESSED C.TRACHOMATIS . .... 88

TABLE 3.6: RELATIVE FOLD CHANGES (DOWN-REGULATED) FOR DIFFERENTIALLY EXPRESSED

C.TRACHOMATIS .................................................................................................................................................. 89

TABLE 3.7: SUMMARY TABLE FOR GENES PRESENTED IN OUR MICROARRAY EXPERIMENT.................................. 99

vi | P a g e

List of Abbreviations ADCC Antibody-dependent cellular cytotoxicity

ADP Adenosine di-phosphate

APC Antigen-presenting cell

ATP Adenosine tri-phosphate

CD Cluster of differentiation

CMI Cell-mediated immunity

CNS Central nervous system

CTL Cytotoxic lymphocytes

DC Dendritic cells

DNA Deoxyribonucleic acid

DGI Disseminated gonococcal infection

dNTP Deoxynucleotide triphosphate

E2 17 β estradiol

EB Elementary body

ER Estrogen receptor

ERE Estrogen response element

FBS Foetal bovine serum

FBS Foetal calf serum

FITC Fluorescein isothiocyanate

FRT Female reproductive tract

FSH Follicle stimulating hormone

GI Gastrointestinal

GM-CSF Granulocyte/Macrophage Colony Stimulating Factor

GnRH Gonadotrophin releasing hormone

hCG Human chorionic gonadotrophin

HEC Human endometrial epithelial cell line

HPO Hypothalamic-pituitary-ovarian

HRE Hormone Response Element

HSP Heat shock proteins

HSV Herpes simplex virus

IDO Indoleamine-2, 3-dioxygenose

IFN Interferon

vii | P a g e

IFU Inclusion forming unit

IgA Immunoglobulin A

IgG Immunoglobulin G

IL Interleukin

LGL Large granular lymphocytes

LGV Lymphogranuloma venereum

LH Luteinising Hormone

LPS Lipopolysacccharide

MØ Macrophages

MHC-II Major Histocompatibility Complex Class II

MOMP Major outer membrane protein

NK Natural killer cell

OM Outer membrane

PCR Polymerase chain reaction

PID Pelvic inflammatory disease

PRE Progesterone response element

RB Reticulate body

RNA Ribonucleic acid

rRNA Ribosomal RNA

SE Standard error

SIV Simian immunodeficiency virus

SPG Sucrose-phosphate-glutamic acid

STD Sexually transmitted diseases

STI Sexually transmissible infection

TCR T cell receptor

TEM Transmission electron microscopy

TER Transepithelial resistance

TGF Transforming growth factor

TLR Toll-like receptors

TNF Tumor necrosis factors

UTI Urinary tract infection

WBC White blood cells

viii | P a g e

Declaration

The work contained in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To the best

of my knowledge and belief, the thesis contains no material previously published or

written by another person except where due reference is made.

Ashkan Amirshahi Signature Date

ix | P a g e

Acknowledgements

This Master‟s project could not have been completed without the time and effort of not only

my supervisors but also some other, very special people. I would like to take this opportunity

to express my gratitude to them individually.

First of all my incredible thanks and gratitude to my supervisors, Professor Peter Timms and

Professor Kenneth Beagley for their trust and providing me this chance to work with them

and gain valuable experience. Equally, my thanks go to my parents, Mina and Siamak

Amirshahi, my younger brother Kourosh, for their love, generous support and the sacrifices

made for me; also my partner Mana Tavahodi for understanding and encouraging my

pursuits. Without the continuous support, inspiration and encouragement from this incredible

band of people, the completion of this study would not have occurred.

Thank you also to Dr Charles Wan for all his expertise and advice in PCR, microarray

analyses and for providing unlimited time and energy beyond the call of duty.

Simultaneously, I am indebted to Dr Jonathan Harris for all his kindness and for supporting

me all these years. I would like to extend a big thank-you to Dr Cameron Hurst for technical

statistical advice.

Thanks and gratitude must also be extended to the staff and students of the department of

infectious diseases at Institute of Health and Biomedical Innovation, Queensland University

of Technology. Specifically Dr Kelly Cunningham, Dr Christina Theodoropoulos, Candice

Mitchell, Elise Pelzer, Alison Carey, Shreema Merchant, Samantha Dando, Steven Bell ,

Dean Andrew and Farshid Dakh for their invaluable advice and supporting me all through

this project.

Finally, thanks also goes to QUT and IHBI for allowing me to undertake this project and for

providing me with a scholarship, travel and research funding.

x | P a g e

Chapter 1

Introduction and literature review

1 | P a g e

2 | P a g e

Introduction

1.1 Chlamydia

1.1.1 History and Taxonomy

Chlamydia-like disease affecting the eyes of people was first described in ancient Chinese and

Egyptian manuscripts (Gambhir et al., 2007). A modern description of Chlamydia-like

organisms was provided by Halberstaedter and von Prowazek who observed it in conjunctival

scrapings from an experimentally infected orangutan as far back as 1907 (Budai, 2007). In 1945,

the term Chlamydia (a cloak) appeared in the literature; however other names such as Bedsonia,

Miyagawanella, ornithosis-, TRIC-, and PLT-agents continued to be used. Two decades later,

Chlamydiae were recognized as bacteria and the genus Chlamydia was validated. In 1971 Storz

and Page created the order Chlamydiales and between 1989 and 1999 new families, genera, and

species were recognized (Budai, 2007; Horn et al., 2004).

By 2006, four chlamydial families, Simkaniaceae Parachlamydiaceae, Waddliaceae and

Chlamydiaceae were recognized and genetic data for over 350 chlamydial lineages had been

reported (Everett et al., 1999). Chlamydiaceae is a family of Gram-negative bacteria that belongs

to the Phylum Chlamydiae, order Chlamydiales and express the family-specific

lipopolysaccharide epitope αKdo-(2→8)-αKdo-(2→4)-αKdo (Everett et al., 1999).

Chlamydiaceae include two genera: Chlamydophila and Chlamydia. The latter genus is classified

into three species: Chlamydia muridarum, Chlamydia suis and Chlamydia trachomatis. C.

muridarum has been found in hamsters and mice, C. suis in swine and C. trachomatis in humans

(Budai, 2007; Everett et al., 1999).

3 | P a g e

1.1.2 C. trachomatis

C. trachomatis is a strictly human pathogen, with a tropism for the genital and conjunctival

epithelia. C.trachomatis infection causes trachoma, an ocular infection that leads to blindness,

and sexually trasmited diseases such as Pelvic inflammatory disease (PID), urethritis, cervicitis,

chronic pelvic pain, ectopic pregnancy and epididimitis (Cevenini et al., 2002; Gambhir et al.,

2007).

C. trachomatis strains were originally identified by their accumulation of glycogen in inclusions

and their sensitivity to sulfadiazine. Based on antigenic differences, C.trachomatis consists of 19

different serovars. In addition to serovars, numerous variants have been characterized. Serovars

A, B , Ba and C infect mainly the conjunctiva and are associated with endemic trachoma,

serovars D, Da, E , F, G, Ga, H, I, Ia, J and K are associated with sexually transmitted diseases,

inclusion conjunctivitis or neonatal pneumonitis in children born to infected mothers. Serovars

L1, L2, L2a and L3 can be found in the inguinal lymph nodes and are associated with

lymphogranuloma venereum (LGV) (Wang and Grayston 1991; Yamazaki et al., 2005).

4 | P a g e

Table 1.1: Chlamydia trachomatis Serovars, Method of Transmission, Associated Human Diseases, and Resultant Human Pathology

Serovars Human Disease Transmission Pathology

A, B, Ba, &

C Ocular Trachoma

Hand-to-Eye,

Fomites, & Eye-

Seeking Flies

Conjunctivitis with

Conjunctival & Corneal

Scarring

D, Da, E, F,

G, H, I, Ia, J,

Ja, & K

Oculogenital

Disease Sexual & Perinatal

Female: - Cervitis,

Endometritis, Pelvic

Inflammatory Disease, Tubal

Infertility, Ectopic Pregnancy

Male: - Orchitis, Urethritis

Epididymitis, Proctitis,

Proctocolitis, Reiter‟s

Syndrome

Children: - Neonatal

Conjunctivitis & Infant

Pneumonia

L1, L2, L3

Lymphogranulo

ma venereum

(LGV)

Sexual

Submucosa & Lymph-node

Invasion, with Necrotising

Granulomas & Fibrosis

(Budai 2007)

Conventional serotyping is performed after C.trachomatis culture using polyclonal and

monoclonal antibodies against the major outer membrane protein (MOMP) of C.trachomatis.

The recently developed method of direct PCR-based restriction fragment length polymorphism

analysis has partially replaced the complicated and less sensitive serotyping technique (Wang

and Grayston 1991). Based on biological chracteristics, the different serovars have been further

grouped into biovars: LGV (four serovars) and trachoma, including all the remaining ones

(Carlson et al., 2005; Yamazaki et al., 2005).

5 | P a g e

Table 1.2: Scientific classification of Chlamydia

Chlamydia species are readily identified and differentiated from other chlamydiales by some

genes signature sequence specifically 16s and 23s rRNA (Cevenini et al., 2002; Wang and

Grayston 1991).

1.1.3 Epidemiology Chlamydia is the most frequently reported sexually transmissible infection (STI) in Australia

with 43,681 notifications in 2006 and is a significant cause of infertility at a time when

Australia‟s population growth is at its lowest (World Health Organisation (WHO) 2006;

Australian Bureau of Statistics (ABS) 2005, 2006).

Statistically, women are more susceptible to C. trachomatis infection than men with young,

heterosexual females, aged 15 – 29 years, at greatest risk of infection (Brunham 2005). To date,

only limited success has been achieved in dealing with the rising rate of STDs, with Australian

infections reported to be increasing at approximately 20% per annum (World Health

Organisation (WHO) 2006; Australian Bureau of Statistics (ABS) 2005, 2006).

Kingdom Bacteria

Phylum Chlamydiae

Order Chlamydiales

Family Chlamydiaceae

Genus Chlamydia

Species C. trachomatis

6 | P a g e

1.1.4 Structure Chlamydiae are a unique bacterial evolutionary group that separated from other bacteria

approximately a billion years ago (Cevenini et al., 2002). Chlamydiae infect eukaryotic cells but

they differ from Rickettsiae, another group of intracellular parasites, in that they have a biphasic

developmental cycle of replication, unique among prokaryotes (Dautry-Varsat et al., 2005;

Hybiske and Stephens 2007). Reports have varied as to whether Chlamydiae are related to

Planctomycetales or Spirochaetes.

Chlamydiae can be either parasites or endosymbionts, depending on the eukaryotic host and

chlamydial species. The infectious, extracellular form is an elementary body (EBs) which is

electron-dense, typically 0.2-0.6 μm in diameter. EBs that have been endocytosed by eukaryotic

cells typically remain in vacuolar inclusions, where the disulfide bonds are reduced and EBs

transform into Reticulate bodies (RBs) (Abdelrahman and Belland 2005). RBs range up to 1.5

μm, take up nutrients from the host cell, and undergo multiple rounds of binary division.

Chlamydiae are spread by aerosol or by contact and require no alternate vector (Dautry-Varsat et

al., 2005; Hybiske and Stephens 2007).

Genome sequencing, however, indicates that 11% of the genes in Candidatus Protochlamydia

amoebophila UWE25 and 4% in Chlamydiaceae are most similar to chloroplast, plant, and

cyanobacterial genes (Dautry-Varsat et al., 2004). Comparison of ribosomal RNA genes has

provided a phylogeny of known strains within Chlamydiae.

Chlamydia spp. were early candidates for genome sequencing given their small genome size,

their enigmatic nature and their importance as pathogens. The first published chlamydial genome

sequence was that of C.trachomatis serovar D (Stephens et al., 1988).

1.1.5 Genome and gene expression

The development of molecular biology and recombinant DNA technology, three decades ago,

opened a new window into infectious diseases research. Since then, many research groups

revealed molecular secrets of microbial infection, gene by gene. Recent studies revealed genome

7 | P a g e

sequence and DNA microarray expression profiling information which showed molecular bases

of gene regulation during the developmental cycle. The sequenced chlamydial genome consists

of a 1,042,519 bp chromosome (60% A=T) and a 7493 bp plasmid. Chlamydial genome study

led to the identification of 894 likely protein-coding genes. Stephens and colleagues (1998)

revealed the inferred functional assignment of 605 (67%) encoded proteins, and 35 (4%) similar

to hypothetical proteins deposited for other bacteria. The 257 (29%) remaining genes predicted

proteins that were not similar to other sequences. Clustering by sequence similarity demonstrated

that 247 chlamydial proteins (27.5%) belong to 59 families of similar genes within the genome

(paralogs), and partially similar to other bacteria such as the Mycoplasmas and Haemophilus

influenzae thst possess small genomes. Currently, the genome list of chlamydial proteins is

classified according to the functional systems in this organism (gene map also available in gene-

bank http://www.genome.jp/kegg/). Belland et al. (2003) carried out a genomic transcriptional

study on the chlamydial developmental cycle demonstrated a small subset of genes that control

the primary (immediate-early genes) and secondary (late genes) differentiation stages of the

cycle. Primary gene products are involved in starting metabolism and modification of the

chlamydial phagosome to escape fusion with lysosomes. Secondary gene products terminate cell

division, control RE to EB conversion and encode structural components which play an

important role in attachment to the new host cells.

Belland et al. (2003) investigated IFN-γ- mediated persistence and demonstrated up-regulation of

genes which are involved in DNA repair, tryptophan and phospholipid utilization, protein

translation and stress. However, by contrast chlamydial secondary (late) genes and also genes

involved in proteolysis, peptide transport and cell division were down-regulated. The Chlamydia

remained metabolically active during persistence despite alteration in biosynthesis. Belland et al.

(2003) revealed a panel of C.trachomatis persistence marker genes. This panel may an important

tool for the validation of persistence, and pothentially more useful than morphological analyses

(confocal and TEM microscopy), particularly considering the altered morphological and genetic

hallmarks of persistent infections are not necessarily co-temporal.

8 | P a g e

Recent bacterial gene regulation studies showed that chlamydia has the ability to adapt to

different environments by regulating developmental changes based on the cell cycle. Chlamydiae

are phylogenetically distinct from other bacterial divisions based on rRNA sequence

comparisons (Belland et al., 2003). This separation is revealed phenotypically by chlamydial

unique obligate intracellular developmental cycle and lifestyle.

1.1.6 The chlamydial development cycle Chlamydiae have a unique biphasic development cycle in which the organism exists in two

distinctive forms; the Elementary Body (EB), which is the infectious form, and Reticulate Body

(RB), the replicating structure. In this developmental cycle, the infectious but metabolically

inactive elementary body, 200 – 300 nm in diameter, is endocytosed by eukaryotic cells and

resides within a cytoplasmic inclusion. Within the inclusion the EBs transform into the non-

infectious but metabolically active reticulate body which is larger, 1000 – 1500 nm in diameter.

The RBs divide by binary fission and transform back to the infectious form before being released

to the cell exterior (Abdelrahman and Belland 2005; Cevenini et al., 2002).

9 | P a g e

Figure 1.1: Schematic of the Chlamydia trachomatis Serovar D Developmental Cycle.

(Abdelrahman and Belland 2005) The RBs of Chlamydiae contain many ribosomes; they are surrounded by the cytoplasmic

membrane and a double-layered outer membrane without any evidence of a peptidoglycan layer.

The EB is derived from the RB by binary fission and appears as a round particle with an irregular

electron-dense central area (the nucleoid) (Abdelrahman and Belland 2005; Belland et al., 2003).

The structure of the membranes resembles that of a Gram-negative bacterial cell.

10 | P a g e

Figure 1.2: Thin section electron microscopy of a cell infected by C.trachomatis

Two early-stage inclusions are evident in the cytoplasm of the infected cell: arrows A indicate the inclusion membrane. Arrows B indicate dividing reticulate bodies inside the inclusion. Note that in the early stage of the development cycle elementary bodies are not yet present. (Cevenini et al., 2002)

Figure 1.3: Mature inclusion of C.trachomatis

Reticulate Body (A) and intermediate forms (B) are present as well as elementary bodies characterized by a electron-dense nucleoid (C). Glycogen-like granules (D) are also present in the inclusion. (Cevenini et al., 2002)

11 | P a g e

1.1.7 Alternate growth modes and persistence

Many chlamydial diseases are associated with a long term or chronic infectious state. In most

cases it is difficult to establish whether chronic or recurrent infections arise through the inability

of the host to resolve the infection or the occurrence of repeated infections with similar species

or genotypes. Despite the unresolved nature of the disease etiology, persistence models of

chlamydial infection have been studied to provide insight into the nature of chronic disease.

Persistence is defined as a long-term association between Chlamydia and their host cell in which

these organisms remain in a viable but culture-negative state (Abdelrahman and Belland 2005;

Hogan et al., 2004). Chlamydial persistence is thought to be due in part to a failure to undergo

secondary differentiation from RB to EB. Molecular consequences include a „blockage‟ in

development involving down-regulation of late gene products in persistent infections (Belland et

al., 2003). The in vitro persistence systems often share altered chlamydial growth characteristics

for example, many studies have described enlarged, and pleomorphic RBs that neither undergo

binary fission, nor differentiate to EBs, but nevertheless continue to replicate their chromosomes.

These changes are generally reversible upon removal of the growth inhibitory factor. Persistent

in vitro infections have been induced by penicillin treatment, amino acid starvation, iron

deficiency, IFN-γ exposure, monocyte infection, phage infection and continuous culture (Hogan

et al., 2004; Morrison 2003).

The patterns of chlamydial gene expression differ between the normal acute infectious form and

the persistent infectious form. A number of studies have begun to demonstrate the molecular

basis of chlamydial persistence. Diverse functional subsets of chlamydial genes have been

reported as being differentially regulated in response to the presence of a persistence-inducing

agent, culminating in the suggestion that a distinct chlamydial persistence phenotype was

observed in specific chlamydial response „stimulon‟ (Belland et al., 2003). Morrison (2003)

demonstrated that incomplete antibiotic eradication of infection or an inappropriate immune

response to a primary infection may set the stage for a cycle of persistent/chronic infections that

are reactivated periodically and as a result drive an ongoing inflammatory immune response over

months or years that ultimately causes salpingitis and PID.

12 | P a g e

1.1.8 C. trachomatis Treatment C. trachomatis infection can be effectively treated with antibiotics once it has been detected.

Current Centers for Disease Control guidelines provide for the following treatments:

Azithromycin 1 gram oral as a single dose, or Doxycycline 100 milligrams twice daily for seven

days or Tetracycline, Erythromycin, Amoxicillin once a day until infection subsides (Mpiga and

Ravaoarinoro 2006).

1.2 Female Reproductive Tract (FRT)

Figure 1.4: Schematic of Human Female Reproductive Tract (FRT) Anatomy

© (http://encarta.msn.com/media_461545224/Female_Reproductive_System.html 2007)

The Female Reproductive Tract (FRT) consists of two distinct compartments structurally

separated by the cervix. The upper compartment consists of the ovaries, the fallopian tubes, and

the glandular endometrium (shown above), and muscular myometrium (not shown) of the uterus

(Martini 2001b). The lower compartment consists primarily of the vagina, and often includes the

cervix, though the cervix is frequently considered a third, separate compartment (Cohen 2005 et

al.; Quayle 2002; Wira et al., 2005).

13 | P a g e

The FRT is immunologically unique in its requirement for tolerance to allogenic sperm to allow

access to ova, and to protect a semi-allogenic embryo throughout gestation (Wira et al., 2005;

Robertson et al., 1997). However, it must also be appropriately protected from, and respond to, a

diverse array of sexually transmitted pathogens. Some of these infections can be lethal (e.g.

Human Immunodeficiency Virus (HIV), Human Papilloma Virus (HPV)), and others (e.g.

Chlamydia trachomatis and Neisseria gonorrhoeae) have long term reproductive sequalae

(Quayle, 2002).

Mucosal surfaces are, to a greater or lesser extent, in contact with an environment rich in micro-

organisms (Martini 2001). Despite this, there is a low incidence of infection, and mucosal host

defence mechanisms create a hostile environment for potential pathogens, minimize

inappropriate microbial load and detect and respond appropriately to pathogen challenges. Innate

and early induced immune responses may prevent establishment of infection, or reduce pathogen

replication until antigen-specific cells are recruited to the local site (Cohen et al., 2005; Quayle,

2002). These responses are antigen non-specific, rapid, and are based on recognition of invariant

molecular structures on pathogens (Wira et al., 2005).

The upper and lower tissues of the FRT consist of morphologically different epithelia, which

confer different immunological functions upon each compartment, thereby inducing different

immunological responses to pathological challenges (Martini 2001c; Kelly, 2003). Importantly,

the epithelium at mucosal surfaces is semi-permeable and apical junctional complexes can be

manipulated by both physiological and pathological events (Wira et al., 2005).

This epithelial barrier is the interface between the endocrine system and the FRT mucosal

immune system, with the hormonally-influenced epithelial cells constituting the first line of

immunological defence by participating in antigen presentation, and secretion of anti-microbials,

chemokines and cytokines (Martini 2001b, 2001c; Quayle, 2002). FRT epithelial cells

concurrently initiate the innate immune response in the FRT lumen (Wira et al., 2005), and the

adaptive immune response via signalling to the FRT stromal cells (Quayle, 2002; Fahey et al.,

2005).

14 | P a g e

Infected epithelial cells contribute to the development of innate and adaptive immune responses

by producing pro-inflammatory mediators including: - IFN-α, and IFN-β, IL-6, IL-8, TNF-α and

TGF-β. IFN-α and β promote the production of IFN-γ to trigger inflammation and promote the

recruitment of immune cells (Wira et al., 2005), while IL-6 has been shown to suppress the HPO

axis and is involved in B-cell differentiation. TNF-α and the chemokine IL-8, also known as the

CXC ligand 8 (CXCL8), stimulate proliferation, differentiation and activation of neutrophils,

monocytes, dendritic cells (DCs) and natural killer (NK) cells, while TGF-β regulates NK

cytokine secretion, antigen presentation, and cellular proliferation, migration and differentiation

(Wira et al., 2005).

Similarly, cytokines act as extracellular stimuli on tight junctions with TNF-α and IFN-γ down

regulating tight junction molecule transcription and TGF-β preventing these cytokine-induced

effects. In vitro, estrogens affect both morphological and biochemical properties of the epithelial

cell tight junction/TER complex, thereby decreasing TER and disrupting epithelial integrity

(Quayle, 2002).

15 | P a g e

1.3 Female Reproductive Cycle The female reproductive cycle, also known as menstrual cycle, lasts an average of 28 days

(Martini 2001b; Cohen, 2005). Oocytes are present at birth, arrested until puberty in prophase of

meiosis I, when the first cycle, or menarche, is initiated in response to various signals including:

the asymptomatic cyclic secretion of Follicle Stimulating Hormone (FSH) and Luteinising

Hormone (LH), adipose tissue percentage and subsequent levels of the peptide hormone leptin

(Martini 2001a, 2001b).

Hormones control both the ovarian/follicular cycle, and the uterine/endometrial cycle, by

employing both positive and negative feedback mechanisms on the hypothalamic-pituitary-

ovarian (HPO) axis (Acron et al., 2001). The major hormones involved in the menstrual cycle

are: - the follicular hormones estrogens, progestins and inhibin, and the anterior pituitary

hormones: - luteinising hormone (LH) and follicle stimulating hormone (FSH). The ova-

containing follicle is the source of estrogens, while the post-ovulatory follicle is the source of

progestins (Martini, 2001a).

16 | P a g e

Figure 1.5: Schematic of the Human Female Menstrual Cycle.

(Martini 2004a) The human female reproductive cycle averages 28 days with two components working harmoniously: - the uterine cycle and the ovarian cycle. The ovarian cycle has two phases: - the Follicular Phase and the Luteal Phase, while the uterine cycle consists of three phases: - the Secretory Phase, the Proliferative Phase and Menses. (a and b). During the Follicular Phase immature follicles are stimulated to grow by the hypothalamic Gonadotrophin Releasing Hormone (GnRH)-induced, anterior pituitary release of Follicle Stimulating Hormone (FSH). (c and d). As the follicle matures it secretes the hormone estrogen in correlation with its size. (b, c and d). At maximum estrogen levels, GnRH pulse and frequency switch, resulting in the anterior pituitary gland-released Luteinising Hormone surge (LH surge). The LH surge causes follicle rupture and release of the oocyte into the fallopian tube (ovulation). Post-ovulation (Luteal Phase), estrogen levels fall and the follicle differentiates into the corpus luteum, which primarily secretes progesterone. (e). As progesterone levels rise, the endometrium thickens to prepare the uterus for implantation (Secretory Phase). If implantation is unsuccessful, progesterone levels

17 | P a g e

drop until the endometrial functional zone undergoes sloughing (Menses). Menses lasts approximately 5-7 days, until rising estrogen levels cause endometrial regeneration (Proliferative Phase), and the cycle re-commences (d). Inhibin is present throughout the menstrual cycle and primarily acts as a FSH inhibitor. (f). Female sex hormones affect basal body temperature throughout the cycle with a drop around ovulation, followed by elevation throughout the secretory phase. Basal body temperatures return to normal with the commencement of Menses.

1.3.1 Menstrual Phase The menstrual phase marks the beginning of the reproductive cycle, and is characterised by

endometrial sloughing known as menses (Martini 2001b). Menses lasts 5 – 7 days and involves

the degradation of the endometrial functional zone and decidua. Sloughing is attributable to the

drop in hormone levels, particularly the fall in progestins, and continues until estrogen levels

rise, and endometrial repair commences (Cohen et al., 2005; Martini 2001b).

Vaginal epithelial thickness is minimal during menses, and increases in thickness throughout the

other two reproductive phases (Wira et al., 2005). The end of the menstrual phase overlaps with

the beginning of the follicular phase (Patton et al., 2000).

1.3.2 Follicular and Proliferative Phases Simultaneous to endometrial repair, ovarian follicles are stimulated to grow and mature. This

initiation is a direct result of hypothalamic gonadotrophin releasing hormone (GnRH) pulse and

frequency signaling the anterior pituitary gland to release FSH (Martini 2001b). Estrogens are

released from the follicle in correlation with follicle size, until at approximately day 10, rising

estrogen levels cause GnRH pulse and frequency to switch signaling, and the anterior pituitary

gland begins releasing LH (Filicori et al., 2003; Goldfien et al., 2001). Around day 14, when

maximal levels of estrogen are reached, a LH surge occurs leading to ovulation, whereby, the

follicle ruptures and the ova is released into the fallopian tubes (O'Connor et al., 2001).

LH/FSH balance initiates and maintains production of estrogen and progestins, and is regulated

by the ovarian hormones themselves, with estrogen increasing GnRH pulses, and progestins

decreasing pulses (Filicori et al., 2003).

18 | P a g e

Post-ovulation, the ruptured follicle differentiates into the endocrine corpus luteum, which

principally releases progestins (O'Connor et al., 2001; Martini 2001b). With decreasing levels of

estrogens and rising levels of progestins, the combination of these hormones increases

endometrial proliferation (Filicori et al., 2003; Goldfien et al., 2001).

1.3.3 Luteal and Secretory Phases

Progestins continue to work at finalising the endometrium for implantation of fertilised ova, with

the ideal implantation period, around day 20 – 24, corresponding to maximal progestin levels

(Martini 2001b, 2001a; Carr et al., 1998). When implantation is achieved, the corpus luteum

secretes human chorionic gonadotrophin (hCG) hormone, inhibiting menses onset (Lessey,

2003).

Approximately 12 days post-ovulation, if no pregnancy occurs, the corpus luteum deteriorates

and becomes the non-functional, fibrous corpus albicans (Goldfien et al., 2001). The subsequent

decrease in progestins levels continues until endometrial thickness cannot be maintained and

menses occurs (Pierro et al., 2001). Approximately seven days post-menses, GnRH pulses

increase in conjunction with immature follicle activation, and the cycle resumes (Martini 2001b;

O'Connor et al., 2001).

1.3.4 Menopause Menopause is the period when no ova are left to mature and the vaginal epithelium is

consistently thinner, with age of onset at 42 – 60yrs. Menopause is defined as the last

spontaneous menstruation (Goldfien et al., 2001). Approximately five years prior to the absolute

failure of ovarian hormone production, the first clinical indicators of disturbances of estrogen

and progesterone production manifest with irregular menstrual bleedings (Cohen et al., 2005).

This phase is referred to as premenopause. Whereas progesterone production drops relatively fast

during that phase, E2 synthesis decreases more gradually. These hormonal changes reflect the

loss of ovarian follicles that may be stimulated. In addition, ovarian blood vessels show

regressive changes and eventually obliterate. With the progression of menopause, the E2 levels

19 | P a g e

in the circulation decrease considerably until they reach concentrations less than 20 pg/mL (Wira

et al., 2005). These concentrations are insufficient to induce adequate endometrial proliferation

and subsequent menstrual bleeding. Ovariectomy in postmenopausal women does not lead to a

further decrease in E2 concentrations, indicating the absolute loss of ovarian function

(Tsavachidou et al., 2002). Because the negative feedback on pituitary gonadotropin secretion is

lost, there is a significant continuous increase in serum LH and FSH concentrations (O'Connor et

al., 2001; Patton et al., 2000). This causes irregular cycles and anovulatory bleeding, with tissue

changes including: - ovary, oviduct, uterine, and vaginal atrophy, with a dehydrated and hyper-

sensitive vaginal mucosa (Wira et al., 2005). Due to the absence of follicles, estrogen and

progesterone are lacking, consequently elevating GnRH, LH and FSH, with FSH elevated more

than LH (Goldfien et al., 2001).

20 | P a g e

1.4 Female Sex Hormones

Female reproductive hormones rarely operate alone, functioning in harmony to either synergise,

or antagonise, different immunological outcomes throughout the FRT (Bentley, 2001; Wira et

al., 1985). Fluctuating hormones regulate both the ovarian and endometrial cycles, with

dysfunction causing irregular cycling (Goldfien, 2001).

The female sex hormones LH and FSH are glycopeptide gonadotrophin hormones, while

estrogens and progestins are steroid lipid hormones (Bentley, 2001; Martini 2001b, 2001a). Both

estrogens and progestins are regulated by the HPO axis and enter cells by diffusion to affect

muscle, bone, liver, kidneys, brain and the immune system (Bentley, 2001; Fahey et al., 2005).

.

Figure 1.6: Scientific classification of sex steroids

Ashkan Amirshahi 2009

Sex steroids, also known as gonadal steroids can be divided into 3 main classes namely

estrogens, androgens and progesterone. Estrogens split to three subclasses estradiol, estriol and

estrone while progestagens divide into progesterone and porgestins. Androgens also classify into

5 subunits namely testosterone, androstenedione, dihyrotestosterone, dehydroepiandrosterone

and anabolic steroids (Martini, 2001b).

21 | P a g e

1.4.1 Estrogen There are three types of circulating estrogens: estrone and estriole are synthesised from

cholesterol, via the P450 aromatase enzyme, and the follicular androgen, androstenedione.

Estradiol (E2) is the principle estrogen in circulation and is synthesised via androstenedione and

testosterone (Bentley, 2001; Goldfien et al., 2001). They all are steroids consisting of 18 carbon

atoms and characterized by an aromatic A ring. For the specific estrogen effect the aromatic A

ring and hydroxy group at positions 3 and 17 are essential (Metzler and Pfeiffer, 2001).

Figure 1.7: Chemical structure of Estradiol (E2)

(Metzler and Pfeiffer, 2001)

Characteristic chemical features of E2 are the aromatic ring (ring A) with a hydroxy group at C3, and a second hydroxy group at the C17 position of ring D. The formula of E2 also indicates the conformation of rings B, C, and D, and the orientation of the C17 hydroxy group.

E2, the most potent and important estrogen in non-pregnant women, is predominantly produced

by the granulosa cells of the active follicle from androgens delivered by the theca interna. During

pregnancy, E3 produced from androgenic precursors provided by the fetus and the mother,

respectively, represent the major estrogen (Dötsch et al., 2001). E1, the third of the major

endogenous estrogens, exists in metabolic equilibrium with E2 due to the action of 17 β-

hydroxysteroid dehydrogenase.In the classic pathway, the estrogen synthesis starts from

cholesterol provided by lipoproteins (Metzler and Pfeiffer, 2001).

22 | P a g e

Figure 1.8: Enzymatic steps in the classical pathway of estradiol biosynthesis in the ovary

Ashkan Amirshahi 2009

Estrogens are biologically inactivated and excreted after sulfation or glucuronidation,

respectively, allowing renal excretion of the inactivated steroids. Although considerable amounts

of conjugated estrogens are excreted into the bile, only a small fraction appears in the feces. The

majority of the conjugates are reabsorbed after hydrolysis by bacteria from the gastrointestinal

tract. The majority of E2 (98%) circulates bound to albumin or to sex hormone binding globulin

( SHBG), a specific carrier protein that bind estrogens and androgens with high affinity

(Bengtsson et al., 2004; Goldfien et al., 2001).

23 | P a g e

Estrogens can enter their target cells via passive diffusion though the cell membrane. After

transport through the cell membrane, estrogens bind to specific receptors located within the

nucleus of the target cells (Wira et al., 2005). There are two different receptors for E2: estrogen

receptor alpha ( ER α) and estrogen receptor beta ( ER β) that can form heterodimers exhibiting

different affinities to specific DNA sequences termed estrogen response elements (Dötsch et al.,

2001; Metzler and Pfeiffer, 2001).

The estrogen receptor (ER) belongs to the thyroid receptor family, and occurs in two isoforms,

ER-α and ER-β. ER may be membrane-bound or, more commonly, a soluble ligand-regulated

nuclear receptor that forms either heterodimers or homodimers (Baxter et al., 2001; Guseva et

al., 2005; Yang et al., 2006). Under basal conditions, ER is confined to the nucleus and

associates with Heat Shock Proteins (HSPs) (Goldfien, 2001). Once activated, HSPs disassociate

to expose the transcription factor Hormone Response Element (HRE), or Estrogen Response

Element (ERE) (Gardner et al., 2001). FRT epithelial and stromal cells both contain ERs, with

ER-α mediating estrogens effects in endothelial cells and ER-β mediating estrogens effects in

muscle (Han et al., 2005; Grant-Tschudy et al., 2004).

24 | P a g e

Figure 1.9: Schematic drawing of the mean serum levels of E2 and E1 in relation to progesterone (P), LH, and FSH during pre- and postmenopause

(Metzler and Pfeiffer 2001)

Increasing concentrations of FSH induce the aromatization of androgens in the granulosa cells of

the ovary, thus elevating E2 concentrations. E2 and FSH increase the FSH receptor concentration

of the granulosa cells of the ovarian follicle. The peripheral E2 concentrations increase further and

lead, together with ovarian inhibin, to a feedback inhibition of FSH secretion.When E2 levels

exceed a certain threshold for a defined period of time, indicating the full maturation of the

ovarian follicle, a massive increase of pituitary LH and FSH secretion is induced resulting in

ovulation and corpus luteum formation (Dötsch et al., 2001). However, the growth of preovulatory

follicles can proceed with minimal concentrations of LH and FSH in the presence of low

peripheral estrogen levels. Oocyte maturation and fertilization may proceed independently of

ambient estrogen levels (Metzler and Pfeiffer, 2001). This leads to the assumption that estrogens

exert a minimal autocrine paracrine function.

The rising E2 levels in the follicular phase result in proliferation of the uterine endometrium and in

an increase of the number of glands. There is an increase in the amount and a change in the

25 | P a g e

physicochemical properties of the cervical mucus termed Spinnbarkeit. The decline of E2 and

progesterone in the late luteal phase leads to a loss of endometrial blood supply and eventually to

the onset of menses (Dötsch et al., 2001).

Table 1.3: Serum estradiol (E2) concentrations during infancy, childhood, different stages.

Age/ Phase Reference values Reference values

(Conventional units) (S1 units)

Girls

1 week – 7 months < 7-55 pg/mL < 26-201 pmol/L

6 – 12 months < 7–44 pg/mL < 26-162 pmol/L

2nd year < 7-24 pg/mL < 26-88 pmol/L

2-7 years < 7-12 pg/mL < 26-44 pmol/L

Women

Follicular phase 30-300 pg/mL 110-1100 pmol/L

Ovulation 300-400 pg/mL 1100-1450 pmol/L

Luteal phase > 130 pg/mL > 470 pmol/L

Postmenopause

< 20 pg/mL < 70 pmol/L

26 | P a g e

It has to be emphasized that the determination of plasma estrogen levels varies considerably with the method used. Therefore, three conditions are compulsory for any specific assay measuring the three major endogenous estrogens E2, E1and E3: (1) reference values must be provided for every assay, (2) the reference values must not be related to the age but to the different developmental stage, i.e., puberty and menopause, and (3) the assay must be specific. The reference values shown above were established using radioimmunoassay after chromatographic separation. Lately, ultrasensitive assays for the determination of E2 concentrations have been introduced. Under certain pathophysiological situations like the premature telarche these new assays allow for discrimination even in prepubertal girls (Metzler and Pfeiffer 2001).

Estrogens have different effects on different tissues and regulate TER, WBCs, Igs, APCs,

chemo/cytokines, anti-microbials, oedema and susceptibility to infection (Wira et al., 2000,

2005a).

Estrogens enhance blood coagulation, increase clear, watery cervical mucus for sperm motility,

decrease bone resorption, reduce bowel mobility, vary enzymatic activity and metabolism,

increase fat deposition, and alter smooth muscle function via modulation of the sympathetic

Central Nervous System (CNS) (Goldfien, 2001). Estrogens also determine secondary sex

characteristics such as: gender-specific distribution of body fat, closing epiphyseal plates,

gender-specific distribution of body hair, voice changes in males and breast development in

females (Martini, 2001a, 2001b; Bentley, 2001).

In vitro, estrogens decrease TER in a dose-dependent manner, and affect both morphological and

biochemical properties of the tight junction/TER complex, thereby disrupting epithelial integrity

(Grant-Tschydy and Wira, 2004).

The mucosal immune system in the female reproductive tract is the first line of defense against

pathogenic organisms. Immunoglobulin A (IgA) and IgG levels in uterine secretions change

markedly during the rat estrous cycle, with higher levels measured at ovulation than during any

other stage of the cycle (Bouman et al., 2005). When ovariectomized animals are treated with

E2, IgA and IgG levels markedly rise relative to untreated controls (Wira and Sandoe, 1987).

These results underline the role of estrogens in the regulation of the local uterine defense

mechanisms, enabling a pathogen free environment for the implantation of the blastocyst

(Ghanem et al., 2005).

27 | P a g e

Estrogens may influence lymphocyte type and concentration throughout the FRT (Ito et al.,

1995; Wira et al., 2003). For example, CD8+ CTL activity is present during the estrogen-

dominant proliferative phase, absent during the progesterone-dominant secretory phase and

maximal in post-menopausal women (White et al., 1997). Therefore, CTL activity may be

hormonally regulated, with decreasing hormone levels increasing cytolytic activity, and vice

versa (White et al., 1997). Similarly, NK cells appear to be hormonally regulated as they

materialise during the proliferative stage and increase in number during the secretory phase

(Sentman et al., 2004). Hence, CMI may be controlled by sex hormones (White et al., 1997).

Equally, estrogens affect humoral immunity by regulating pIgR and IgA translocation

(Richardson et al., 1995; Kaushic et al., 1997). IgA is essential for fighting genital tract

infections and estrogen facilitates SC/IgA binding (Wira et al., 1983; 1985). Both SC and IgA

are at their highest concentrations at estrogen-dominant estrous and their lowest concentrations

during progesterone-dominant diestrous (Kaushic et al., 1997).

In animals, estrogens induce opposite tissue-specific effects on various immune parameters in

both the upper and lower FRT, as seen by estrous decreases of pIgR, IgA and SC in vaginal

tissues and secretions, with simultaneous increases of pIgR, IgA and SC in the uterus. Progestins

have been shown to antagonise these effects in an equally opposing manner (Wira et al., 2005;

Wira and Sandoe, 1987).

Like IgA, vaginal IgG concentrations are lowest at diestrous, and highest at estrous, though the

method of translocation is still controversial (Stern et al., 1992; Wira et al., 1985, 1991, 1995).

In response to proestrous, FRT tissues retain water and it is proposed IgG accesses the FRT

lumen via this estrogen-induced oedema (Goldfien, 2001; Wira et al., 1983).

Uterine antigen presentation is increased by estrogens at proestrous and decreased by progestins

at diestrous; yet vaginal antigen presentation is increased at diestrous and decreased at proestrous

(Wira et al., 2000, 2002, 2005c). Estrogens and progestins even have opposing cell-specific

effects, with antigen presentation increased by estrogens in uterine epithelial cells yet decreased

in uterine stromal cells (Wallace et al., 2001; Wira et al., 2000). MHCs are essential for antigen

28 | P a g e

presentation and induction of the adaptive immune response. MHC-II is also under hormonal

control with expression increased at proestrous and decreased at diestrous (Prabhala et al., 1995).

Most chemo/cytokines are influenced by hormones, with estrogens regulating IFN-β, IFN-γ,

TGF-β (Wira et al., 2003), TNF-α, IL-1 and IL-6 (Eriksson et al., 2004; Grant-Tschudy et al.,

2004). Similarly, anti-microbial action is affected by sex hormones. Bactericidal activity is

highest at proestrus, decreased at diestrous, and absent in menopausal women, therefore,

bacterial colonisation and infection may vary throughout the cycle (Fahey et al., 2005; Kaushic

et al., 2000b).

Occasionally, estrogens act on stromal cells to mediate epithelial effects, and increase vascular

and epithelial permeability for leukocyte migration and IgG translocation (Grant et al., 2003;

Grant and Tschudy 2004). During the normal menstrual cycle, estrogens effects are induced by

complex interactions between epithelial and stromal cells, and their various chemo/cytokines and

antimicrobials (Grant and Tschudy 2004; Sentman et al., 2004).

1.4.2 Progesterone

Progesterone is also synthesised from cholesterol, via the parent compound pregnane, and is the

principle circulating progestin (Martini 2001b, 2001a). Progesterone receptors (PRs) belong to

the steroid receptor family and have two isoforms, PR-A and PR-B that form either heterodimers

or homodimers (Gardner et al., 2001; Goldfien, 2001). Under basal conditions, PR is cytosolic

and forms multimeric complexes with HSPs. Once activated, HSPs disassociate to expose the

nuclear translocation signal which initiates PR nuclear transport to bind with the transcription

factor HRE, or Progesterone Response Element (PRE) (Goldfien et al., 2001; Lessey, 2003).

Receptor expression is hormonally controlled with both isoforms expressed during the follicular

phase, but only PR-B expressed during the mid-secretory phase (Lessey et al., 2003).

Progesterone also weakly binds glucocorticoid and mineralocorticoid receptors (Baxter et al.,

2001; Schmidt et al., 1998).

29 | P a g e

Figure 1.10: Chemical structure of Progesterone

(Metzler and Pfeiffer, 2001)

As with estrogens, progestins affect TER, WBCs, Igs, APCs, MHCs, chemo/cytokines, anti-

microbials, oedema and susceptibility (Kaushic et al., 2003; Wira et al., 2005). Progestins

prepare mammary glands for secretory activities, decrease cervical mucus making it viscous and

cellular, affect respiration, metabolism, insulin levels, kidney function, increase body

temperature and have hypnotic brain effects during pregnancy (Martini 2001b, 2001a;

Richardson et al., 1995).

In general, progestins antagonise estrogen-induced effects on pIgR and SC expression, IgA/IgG

concentrations, antigen presentation, and WBC migration and translocation (Fahey et al., 2005;

Kaushic 2000, 2003, 1997; Wira et al., 2000). However, progestins do not alter estrogen-induced

TER effects and are suggested to be the primary regulators of SC, rather than estrogens (Grant

and Tschudy 2004; Sullivan et al., 1984). Progestins increase Th2 cytokines and inflammatory

responses (Tait et al., 2008), regulate TGF-β and IFN-γ, and induce vaginal epithelial thinning,

thus decreasing vaginal immunity and increasing vaginal infectivity (Kaushic, 2003; Wira et al.,

1985).

Animal studies have emphasised the influences hormones may have on susceptibility to

infection. Intravaginal infection of mice, with human chlamydial serovars and C. muridarum, is

generally only successful when progesterone treatment is employed. Progesterone is

administered to prolong diestrous so all mice are concurrently cycling, and to facilitate consistent

30 | P a g e

genital infection (Kaushic et al., 2000). Without progesterone, the stage of the menstrual cycle

affects infectivity, and extremely high doses of inoculum may be required to achieve infection

(Kaushic et al., 2000).

In contrast, humans and guinea pigs require estrogens to enhance infectivity (Rank et al., 1993).

C. trachomatis infection of rats, at estrous and diestrous, did not result in infection, with E2

administration resulting in absence of infection, and complete protection (Kaushic et al., 200b,

2003). With progesterone administration, C. trachomatis increases local immune responses,

while decreasing systemic immune responses (Baeten et al., 2001).

When both estrogen and progesterone were administered to rats, infection was high

(progesterone effects) yet no inflammation was observed (estrogen effects), with the ratio of E2

to progesterone important for immunological effects (Kaushic et al., 1998, 2000). The human

menstrual cycle has been shown to affect C. trachomatis infectivity with a notable increase in

infection during the proliferative phase (Kaushic et al., 2000).

Similar effects have been observed with other organisms such as: Herpes Simplex Virus 2 (HSV-

2) where progesterone increases murine mortality (Kaushic et al., 2003) and Neisseria

gonorrhoea where estrogens increase murine infection at proestrous (Kita et al., 1981).

Other hormones also contribute to FRT homeostasis; though E2 and progesterone are the major

hormones in C. trachomatis endocervical infection. Therefore, endocrine balance at the time of

infection plays a role in host susceptibility and may be an important determinant for successful

administration of mucosal vaccines (Kaushic et al., 1998; Wira et al., 2000).

31 | P a g e

1.4.3 Oral contraceptives Oral contraceptives are various combinations of estrogens and synthetic progesterone designed

to halt ovulation, with the aim to prevent pregnancy (Rubin et al., 1982). There are generally

four types of oral contraceptives in use, with an estimated effectiveness of 99%: - the most

commonly used fixed-combination contraceptives, where concentrations of estrogens and

progestins remain constant throughout therapy, the biphasic or triphasic contraceptives where

estrogen concentrations remain relatively constant and levels of progestins vary, and the

progesterone-only pill (mini-pill) (Baeten et al., 2001; Lavreys et al., 2004).

Oral contraceptives primarily act at the hypothalamus and pituitary gland to prevent the LH

surge required for successful ovulation; however these oral hormones also alter FRT tissues to

inhibit successful fertilisation and implantation (Rubin et al., 1982).

Oral contraceptives are proposed to decrease IgG responses and increase susceptibility to

infection, with vaginal candidiasis increasing with oral contraceptive use (Washington et al.,

1985). Consistently higher rates of C. trachomatis infection are found amongst oral contraceptive

users, though oral contraceptives are also associated with protection from chlamydial PID

(Baeten et al., 2001). This protection occurs owing to reduced menstrual flow and lack of retro-

grade menstruation, and decreased inoculum reaching the upper FRT due to thickened cervical

mucus (Rubin et al., 1982).

32 | P a g e

1.5 Hypothesis Recently it has become evident that Chlamydia can enter a chronic or persistent infectious form

that may be reactivated at a later stage. This form can be induced in vitro by treatment of

infected cells with some antibiotics or with low doses of IFNHogan et al., 2004). The patterns

of chlamydial gene expression differ between the normal acute infectious form and the persistent

infectious form (Hogan et al., 2003) and it has been suggested that incomplete antibiotic

eradication of infections or an inappropriate immune response to a primary infection may set the

stage for a cycle of persistent/chronic infections that are reactivated periodically that ultimately

causes salpingitis and PID. In addition, studies using animal models of genital tract chlamydial

infection suggested that the hormonal status of the genital tract epithelium at the time of

exposure influence the outcome of infection (Kaushic 1998; Wira et al., 2000). This suggested

that female sex hormones directly regulate host-pathogen interactions and may be important

determinants for successful mucosal vaccines (Beagley and Timms 2000).

If the hormonal status of the epithelium at the time of infection can influence the immune

response then this may indirectly affect the type of chlamydial infection that develops following

exposure. The development of a chlamydial gene array chip provides the unique opportunity to

investigate the effect of sex hormones on the patterns of chlamydial gene expression during

infection and to correlate this with the type of infection that develops.

The current project will use an in vitro infection model to test the hypotheis that the female sex

hormones estradiol and/or progesterone directly affect chlamydial gene expression and that this

may determine the actual outcome of infection ( acut versus persistence )

33 | P a g e

1.6 Aims The development of a chlamydial gene array chip provided a unique opportunity to investigate

the effect of sex hormones on the patterns of chlamydial gene expression during infection and to

compare this with the type of infection that develops. We determined how changes in estradiol

and/or progesterone affected chlamydial gene expression when the hormone-responsive ECC-1

cell line was infected with C.trachomatis serovar D.

The aims of this project were:

1- To determine the effect of female sex hormones on C.trachomats growth and inclusion morphology in ECC-1 cells

2- To determine the effect of steroid hormones on ECC-1 cells infectivity

3- To determine the effect of female sex hormones on chlamydial gene expression

The initial part of the project investigated the susceptibility of the hormone-responsive ECC-1

cell line to infection with C.trachomatis serovar D under different hormonal conditions.

Immunohistochemistry and confocal microscopy were used to monitor infectivity and inclusion

morphology. In the second part of the study a transcriptional analysis of C.trachomatis growth in

ECC-1 cells grown under different hormonal conditions was carried out using gene array

technology.

For the purpose of this experiment, the epithelial cell line (ECC-1) was grown in flasks

containing phenol red-free media and charcoal-stripped foetal calf serum (to remove endogenous

steroids). Twenty-four hours before Chlamydia infection, cells were supplemented with either

no added sex hormones, estradiol, progesterone or estradiol plus progesterone. These cell

cultures were then infected with C. trachomatis serovar D at a Multiplicity of Infection (M.O.I)

of 15. Total RNA was extracted from the infected ECC-1 cell monolayers using TRIzol

(Invitrogen) followed by a purification step. Eukaryotic RNA was removed using a Dynabead

mRNA purification kit and the bacterial mRNA-enriched supernatant was reversed-transcribed

with random primers and copied into dsDNAs.

34 | P a g e

The array was an Affymetrix oligonucleotide array format of 1800 features, covering the full C.

trachomatis genome (870 genes) and containing 8-11 oligonucleotides per target gene, each

designed for optimal hybridisation to C. trachomatis and screened against non-specific

hybridisation with the full human and mouse genomes. After hybridisation and subsequent

washing using the Affymetrix Fluidics station 400, the bound cRNAs were stained with

streptavidin phycoerythrin. The signal was then amplified with a fluorescent-tagged antibody to

streptavidin. Fluorescence was measured using the Affymetrix scanner and the results analyzed

using Affymetrix data analysis software. A total of 8 chlamydial arrays were analyzed under four

culture conditions (no hormone, E, P, E+P) x duplicates.

35 | P a g e

Figure 1.11: Overview of project plan.

Grow C.trachomatis

serovar D in 2 cell lines

Hormone preparation and

suppliments

ECC-1 Cells HEp-2 Cells

1 week culture in hormone-

reduced conditions

C.tachomatis

Growth and Propagation

26 weeks culture in hormone-

reduced conditions

Aim 1: Effect of estradiol and progesterone on the growth of Chlamydia

trachomatis in vitro

Aim 2: Investigate effects of female sex hormones on bacterial gene expression

36 | P a g e

Chapter 2

Effect of estradiol and progesterone on the growth of Chlamydia trachomatis in vitro

37 | P a g e

38 | P a g e

2.1 Introduction Chlamydia trachomatis is a Gram-negative, intracellular bacterium and the cause of the world‟s

most reported sexually transmitted bacterial infection. More than two-thirds of women with

chlamydial cervical inflammation are asymptomatic and are at risk for pelvic inflammatory

disease (PID), ectopic pregnancy and chronic pelvic pain (Cevenini et al., 2002).

It has been accepted and reported in several studies that genital C. trachomatis serovars D to K

are responsible for the epidemic of sexually transmitted infection (Abdelrahman and Belland

2005; Bavoil et al., 2000). The fact that C.trachomatis infection can have consequences for

females, such as PID, tubal factor infertility, and ectopic pregnancy, has been known for many

years and since infection is asymptomatic in the majority of cases; therefore, more attention

should be given to the influence of reproductive hormones on chlamydial infection of the genital

epithelia, both from a clinical and experimental perspective (Cevenini et al., 2002; Paavonen and

Eggert-Kruse 1999).

The female reproductive tract has a unique structure with a specialized mucosal surface with the

main role being to facilitate the growth of an allogeneic fetus while still providing protection

against potential pathogens. A key feature impacting on reproductive physiology, particularly the

uterus, are the female sex hormones, estrogen and progesterone. Estrogen predominates in the

early 10 days following menstruation and is at the highest level at time of ovulation (~14–15

days). Throughout the proliferative phase, the first 15 days, growth of the endometrial glands

occurs and epithelial cells move out of the glands to seed the endometrial surface. Progesterone

concentrations increase during the 10 days after ovulation, the secretory phase, following

decreased progesterone and estrogen; and if implantation does not occur, the fall in progesterone

and estrogen levels will lead to menstruation. In the human female genital tract, mucus

production is directly and/or indirectly under hormonal control (Martini 2004b; Martini 2004a).

39 | P a g e

2.1.1 Effect of steroid hormones on sexually transmitted infections (STI) in humans

Sex hormones play a crucial role in the host's resistance to sexually transmitted infections. This

is demonstrated by differences in the number of cases reported according to the phase of the

menstrual cycle, greater susceptibility during pregnancy (Montes et al., 2000; Rubin et al., 1982;

Washington et al., 1985). The mechanisms by which particular sex hormones modulate the

immune system were reviewed before in the first chapter. This is a complex topic, and

unfortunately, in spite of its potential importance, no clear conclusions have emerged about the

effect of steroid hormones on chlamydial growth in regards to the development of strategies for

controlling genital tract infection.

It has long been known that steroid hormones, especially estadiol (E2) and progesterone (P), can

affect the outcome of many bacterial and viral infections. Data collected over the past 25 years

suggested that female hormones may influence or modulate chlamydial infection. For example, it

was reported that epithelial cells were more susceptible to C. trachomatis serovar E in the

estrogen-dominant stage of the human menstrual cycle (proliferative phase) than in other stages

(Maslow et al., 1988; Wyrick et al., 1994). Since more chlamydial particles can be isolated from

the proliferative stage of the cycle it was concluded that women are more suceptible to infection

under estradiol influence (Sugarman and Agbor 1986).

Steroid hormones regulate the function of numerous separate compartments of the reproductive

system, and many of the mechanisms that lead to resistance to sexually transmitted infections,

such as cervical mucus production, occur through the menstrual cycle (Menon et al., 2007;

Nelson and Helfand 2001; Rolle et al., 2006). Bacterial adherence to mucosal epithelial cells

may be affected by several factors, including sex hormones. Neisseria gonorrhoeae has been

reported to adhere to vaginal epithelial cells, with the degree of adherence varying depending on

the stage in the menstrual cycle (Sweet et al., 1986).

40 | P a g e

Clinical observations have shown the possible interaction between sex hormones and gonococcal

infection. Firstly, gonococcal pelvic infection and disseminated gonococcal infection (DGI) both

have a greater chance of occuring during menstruation and secondly DGI is more commonly

seen in pregnant women (Sweet et al., 1986). However, similar to Chlamydia infection, oral

contraception has been reported as a risk factor for gonococcal infection (Baeten et al., 2001a;

Rubin et al., 1982).

Smith et al. (2000) have shown that hormonal contraceptives are associated with increased

shedding of HIV in cervical and vaginal secretions. Clinical studies have provided evidence that

HIV-infected women who received hormonal contraceptive treatment showed enhanced viral

shedding in their cervico-vaginal secretions (Lavreys et al., 2004).

Hooton et al. (1996) demonstrated a connection between estradiol and urinary tract infection

(UTI) in premenopausal women (Hooton et al., 1996). Their study reported that women were

more likely to present with acute cystitis between 8 and 15 days after the last menstrual cycle

than at any other time of the cycle. This association was true for women with UTI caused by

Escherichia coli and Staphylococcus saprophyticus; moreover, estradiol appeared to have a

protective role against UTI in post-menopausal women (Sonnex, 1998). Some studies have

indicated a higher risk of cervical neoplasia in users of oral contraception and in pregnant

women (Montes et al., 2000). In addition, pregnancy seemed to be associated with persistence of

HPV infection (Shew et al., 2002).

41 | P a g e

2.1.2 Effect of steroid hormones on STI in animal model studies

Since human tissue is of limited availability for research purposes, studies have used mice,

guinea pigs, rats, and rabbits as models to evaluate Chlamydia-host cell interactions. Previous

studies have shown that female sex hormones influence susceptibility to microbial infections in

the reproductive tract in a number of species. Other research reported that the susceptibility of

mice to genital infection with HSV-2 varies throughout the stage of the estrous cycle (Gillgrass

et al., 2005; Parr et al., 1994). A study by Gillgrass et al. (2005) demonstrated that mice treated

with progesterone showed higher rates of infection with herpes virus type 2. On the other hand, a

higher rate of genital tract susceptibility to Neisseria gonorrhoeae was reported in mice at

proestrus, when estrogen levels were at the peak (Kita et al., 1981). Rank et al. (1982) clearly

showed that guinea pigs were more susceptible to chlamydial infection when pre-treated with

estradiol, whereas other studies indicated that infection can be established in mice just after

progesterone pretreatment.

A study done by Berry et al. (2004) in a mouse model showed that mice were more susceptible

to chlamydial infection when they were under the influence of progesterone. Kuashic et al.

(1998b) used a rat model of Chlamydia infection, and found similar results reported for mice, as

pre-treatment of animals with progesterone increased susceptibility and inflammation, while

estradiol seemed to protect from this sexually transmitted bacterial infection. Animal model

studies have demonstrated that female mice were most sensitive to gonococcal infection at the

pro-oestrus stage (Fortenberry et al., 1999; Sweet et al., 1986).

Simian immunodeficiency virus (SIV) infections in a monkey model have shown that hormones

influence infection. Estradiol provided protection from SIV infection whereas progesterone led

to increased vaginal transmission and also viral loads (Marx et al., 1996; Smith et al., 2000).

Clinical examination, animal studies, and in vitro studies suggest that HPV infection may be

affected by sex hormones (Shew et al., 2002). In studies using guinea pigs, Pasley et al. (1985c)

and also Rank et al. (1982) reported that estrogen influences the attachment and infectivity of

chlamydial infections. Studies mentioned above emphasize the importance of understanding the

42 | P a g e

role of hormones in susceptibility to sexually transmitted agents. The exact mechanism which

steroid hormones impact on susceptibility in a species-specific manner is not understood.

Collectively these studies suggested that the outcome of infection may directly or indirectly be

regulated by female sex hormones. The interaction between host and microorganisms is a

complex issue and the role played by steroid hormones should be considered as only one of the

many potentially important influential factors. Since in vitro and in vivo studies from several

different laboratories as well as human clinical trials have implicated a role for female sex

hormones, estradiol and/ or progesterone, in enhancing genital chlamydial attachment and

infectivity, we decided to investigate the effect of female sex hormones on chlamydial growth

and bacterial gene expression.

43 | P a g e

Figure 2.1: Experimental plan for chapter 2: examination of the effect of the hormones, estradiol and/or progesterone, on C.trachomatis growth

Calture C.trachomatis

serovar D in 2 cell lines

Hormone preparations and supplementation

ECC-1 Cells HEp-2 Cells

1 week culture in hormone-

reduced conditions

C.tachomatis

Growth and Propagation

26 weeks culture in hormone-

reduced conditions

Titration in normal FCS on ECC-1 cell line

Staining cell monolayer using

CelLabs Chlamydia Cel

LPS

Infecting ECC-1 cells at an MOI

15 for 48 hrs

44 | P a g e

The hormone responsive human endometrial cell line, ECC-1, was grown in charcoal-stripped FCS to remove endogenous steroid hormones. Since essential growth factors and hormones were removed from culture media the cells growth rate reduced considerably. Cell cultures were split into two distinctive groups. The first group represents cells grown in normal conditions with FCS to 100% confluence in T75 flasks. These cells were then passaged in stripped-FCS for 1 week. The second group involved culturing in stripped-FCS for 26 weeks. C.trachomatis serovar D was grown and propagated on HEp-2 cells and titrated on the ECC-1 cell line. ECC-1 cells were grown on 10mm coverslips, within a 24-well plate, and treated with average physiological concentrations of estradiol and/or progesterone for 24, 48 and 72 hour pre-infection and then infected with C.trachomatis at an M.O.I of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Confocal microscopy was used to illustrate altered shape and size of bacterial inclusions under different hormonal conditions.

Experiment I: Investigate host susceptibility and

compare growth of C.trachomatis on ECC-1 in presence/absence of hormones

Experiment II: Analyze changes in inclusions morphology

in presence of hormones

Experiment III: Investigate effect of hormones on

development of chlamydial inclusions (evidence of chlamydial persistence) using

confocal microscopy

45 | P a g e

2.2 Materials and Methods

2.2.1 Cell lines ECC-1: The ECC-1 is a well-differentiated, steroid responsive human endometrial cell line and

was a kind gift from Dr John Fahey (Department of Physiology, Dartmouth Medical School,

New Hampshire, U.S.A.). ECC-1 cells were maintained in phenol red-free 1x Dulbecco‟s

Modified Eagle Medium/Ham‟s F12 nutrient mix (DMEM/F12 – 1:1) (Invitrogen, Carlsbad, CA,

USA) containing 15mM HEPES and 2.5mM L-glutamine, and supplemented with 15% heat-

inactivated charcoal/dextran-treated foetal bovine serum (FBS) (Hyclone, Logan, Utah, USA),

1M HEPES buffer, 500U/ml penicillin G sodium/5,000µg/ml streptomycin sulphate, 100x

200mM L-glutamine (Invitrogen) and 10mM 100x MEM non-essential amino acids (Thermo

Electron Corporation, Melbourne, Vic, Australia).

HEp-2: The HEp-2 cell line is a human epithelial cell line. The HEp-2 cell line was maintained

in 1x DMEM containing phenol red, 4.5g/L D-glucose, 110mg/L sodium pyruvate, and 584mg/L

L-glutamine, and supplemented with 500U/ml penicillin G sodium/5,000µg/ml streptomycin

sulphate (Invitrogen), 1x non-essential amino acids, and 10% heat-inactivated FBS (JRH

Biosciences, Lenexa, Kansas, USA).

2.2.2 C. trachomatis serovar D growth and propagation C. trachomatis Serovar D seed was grown, maintained and further propagated to create C.

trachomatis Serovar D stock. Stock was grown, maintained and propagated in 75cm2 flasks

(Griener Bio-One, Frickenhausen, Germany) containing the HEp-2 cell line, and using antibiotic-

free 1x DMEM medium, containing 4.5g/L D-glucose, 110mg/L sodium pyruvate and 584mg/L

L-glutamine, and supplemented with 1x non-essential amino acids and 10% heat-inactivated

FBS. Stock was stored with the addition of sucrose-phosphate-glutamic acid (SPG) (74.6g

sucrose [Chem Supply, Gillman, SA, Australia] 0.512g potassium dihydrogen orthophosphate

1.237g di-potassium hydrogen orthophosphate [BDH Chemicals, Port Fairy, Vic, Australia] 5µl

46 | P a g e

100x 200mM L-glutamine [Invitrogen], made up to 1L with Milli-Q H2O and pH 7.2), in 75cm2

flasks at -80°C.

Stocks of infected cells were thawed until “slushy”, lysed via sonication for 5 min and vortexing

for 2 min, and then centrifuged at 200xg ( Beckman Coulter, GS-6R ) for 5 min at 4°C to pellet

cell debris. The supernatant was then utilised to inoculate a 75cm2 flask of 70% confluent HEp-2

cells. Flasks containing inoculated HEp-2 cells were centrifuged at 600xg for 45 min at room

temperature (RT) then incubated at 37°C/5% CO2 for 4 hrs. Host cell proliferation was halted

with the addition of 1µl cyclohexamide (1 mg/µl)/1ml DMEM medium. Infections were

monitored for a further 44 hrs at 37°C/5% CO2, before the addition of 15mls ice-cold SPG.

Flasks were immediately stored at -80°C until chlamydial EB purification.

2.2.3 C. trachomatis Serovar D semi-purification C. trachomatis was semi-purified from the infected HEp-2 cells via sonication and vortexing, as

previously stated. The sonicate was centrifuged at 11,200xg for 30 min at 4°C (SORVALL® RC

26 PLUS ultra-centrifuge, SORVALL® SLA-1500 rotor, Thermo Electron Corporation,

Melbourne, Vic, Australia) to pellet chlamydial bodies. The pellet was re-suspended in 10 mls

SPG, snap-frozen in liquid N2, and stored at -80°C until further purification.

2.2.4 Titration of C. trachomatis serovar D ECC-1 cells were plated, in duplicate, with 1x DMEM supplemented with 10% heat-inactivated

FBS, at 1 x 105 cells/ml, in a 24-well plate containing 10mm diameter coverslips. At

approximately 70% confluence, DMEM medium was replaced with 200µl fresh DMEM

containing 20µl of purified chlamydial EBs. Serial dilutions (1:2) were performed and plates

centrifuged at 400xg for 45 min at RT, then incubated at 37°C/5% CO2 for 4 hrs. Host cell

proliferation was suppressed by the addition of 1 ml DMEM medium containing 1 µl

cyclohexamide 1 mg/µl. Plates were incubated for 24 hrs at 37°C/5% CO2. Infected cells were

then fixed and permeabilised with methanol and stored in PBS at 4°C until staining.

47 | P a g e

Infected cells were stained utilising the CelLabs Chlamydia Cel LPS staining kit, containing the

fluorescein isothiocyanate (FITC)-labelled mouse monoclonal antibody specific for chlamydial

lipopolysaccahride (LPS) (CelLabs, Brookvale, Australia), according to manufacturer‟s

instructions. Coverslips containing infected cells were placed cell-side-up on microscope slides

(Livingstone International Pty. Ltd., Rosebery, Australia), and Chlamydia Cel LPS Reagent was

added to coat each coverslip. Slides were incubated in a humidifier for 30 min at 37°C/5% CO2.

Following incubation, coverslips were removed, washed 3x with PBS, and placed back on the

microscope slide cell-side-up. Rhodamine-stained cells and FITC-stained chlamydial inclusions

were then visualised and counted using a ZEISS MC 63A microscope (Zeiss, Oberkochen,

Germany) and ifu/ml calculated. Rhodamine is a fluorone dye which is commonly used as a

tracer dye to stain eukaryotic cells, which bind to eukaryotic cells and appear as a red light under

fluorescent microscopy.

To calculate ifu/ml, the area of one 24-well plate well (cm2) at 40x magnification, was divided

by the area of the field examined (cm2) at 40x magnification, giving fields/well. A minimum of

40 fields were counted, with the average multiplied by fields/well to calculate the number of

chlamydial inclusions/well (ifu/well). Innoculum/well (µl) was calculated from the 1:2 dilutions

performed and the innoculum/ml calculated. The inclusions/well (ifu) was multiplied by the

innoculum/ml to calculate ifu/ml.

2.2.5 Hormone preparation Lyophilised progesterone and 17β-estradiol (Sigma-Aldrich, St. Louis, MO, USA) were

solubilised in absolute ethanol to 1mg/ml stock. Serum levels of female sex hormones, estradiol

and progesterone, fluctuate throughout the menstrual cycle. In this study mean physiological

concentrations of 17β-estradiol (200pg/ml) and progesterone (20ng/ml), adapted from Williams

et al. (2001) were further diluted using phenol red-free 1x DMEM/F12 medium (1:1) ( 1:1 was

chosen as starting point to investigate effect of both hormones toghetehr) (Invitrogen),

supplemented with 10% charcoal/dextran-treated FBS (Hyclone).

48 | P a g e

2.2.6 Hormonal suppliment of FRT cell lines Once the ECC-1 cells had reached 100% confluence, average physiological concentrations of

17β-estradiol, progesterone, and a combination of 17β-estradiol and progesterone (1:1) were

added to respective wells. Although physiological concentration of progesterone is higher than

estradiol, in this study a combination of 1:1, estradiol and progesterone, was chosen as starting

point to merely determine effect of both hormones togheter. Cells were then incubated for 24 hrs

before continuance of experiments.

2.2.7 Statistical analysis To determine the percentage of cells infected the number of inclusions and the total number of

cells per field of view was counted. These experiments performed in duplicate and each time 25

fields were compared and analyzed. The mean inclusion counts with standard errors were

determined (adapted from Bessho et al. method) (Bessho et al. 2001). Using Prism software the

standard error of the mean (SEM) were measured of how far each field mean was likely to be

from the true population mean. The SEM was calculated by this equation:

The difference between the percentages of infected cells was compared between groups by using

Prism Statistical Software. These data determined by statistically measuring the individual

samples using student‟s t-test with a P-value <0.05 assigned as significantly different.

49 | P a g e

2.3 Results To determine whether the female sex hormones affect ECC-1 cells‟ susceptibility to C.

trachomatis infection, susceptibility to Chlamydia under different hormonal conditions, estradiol

and/or progesterone, was examined.

In this part of the project, we used a human endometrial cell line, ECC-1, where the endogenous

source of hormones was removed to examine how the hormonal environment altered host

susceptibility to C.trachomatis serovar D. In order to investigate how sex hormone

supplementation affects susceptibility to genital chlamydial infection, ECC-1 cells were infected

with C.trachomatis serovar D at a multiplicity of infection of 15 ( Titrated on ECC-1).

2.3.1 Growth of C.trachomatis in ECC-1 cell line under normal conditions In the first part of this experiment the host susceptibility to chlamydial infection was determined

on ECC-1 cells, which were grown in normal FCS. Our data illustrated that by using normal FCS

containing essential hormones and growth factors, the percentage of ECC-1 cells infected with

C. trachomatis serovar D was approximatly 98.3 % (Figure 2.2).

50 | P a g e

Figure 2.2: Confocal micrographs of C.trachomatis (in normal FCS)

A1 A2 Figure 2.2: Confocal micrographs of C.trachomatis inclusions labelled with FITC conjugated anti-chlamydial LPS and counterstained host cells with Rhodamine. Scale bars represent 20 µm. C.trachomatis infection of ECC-1 cells grown in 10 % normal FCS with inclusion size of 10 to 15 µm. [this result was obtained by counting the number of inclusions per field (25x2 for each sample)].

51 | P a g e

2.3.2: Effect of hormone addition on infection of C.trachomatis in ECC-1 cells grown for 1 week in charcoal-stripped FCS In the second part of the experiment, ECC-1 cells were cultured in hormone-reduced medium

only for 1 week to remove endogenous hormones. Inclusion counts made by light and confocal

microscope consistently indicated there were higher percentages of cells infected with

C.trachomatis serovar D in hormone-supplemented sample compared to the sample grown in

charcoal-stripped media. Such a low level of infectivity and inclusions observed in control

samples indicated dramatic differences among hormone-supplemented and samples grown in

charcoal-stripped media. In the absence of any hormones, ECC-1 cells were approximately 2-

fold less susceptible (98.3 to 48 %) to infection with C.trachomatis compared to cells grown in

complete FCS (Figure 2.3).

Figure 2.3: Percentage of ECC-1 cells infected (1 week passaged in strriped FCS)

Control E P

P+E

0

20

40

60

80

100

Treatment Groups

% o

f ce

lls in

fect

ed

Fig 2.3: Influence of hormone supplementation on C.trachomatis serovar D infectivity in human epithelial cell line, ECC-1 with 24 hrs hormonal pre-supplement. Control represents no hormone supplement, E represents 17β-estradiol, P represents Progesterone and E+P represents combination of both hormones. Standard error of the mean (SEM) for Control, E, P, P+E samples were: 0.64, 0.66,

52 | P a g e

1.51 and 0.67 respectively. Difference between each group sample was tested and P< 0.05 was obtained.

The data presented demonstrated that with the human endometrial cell, ECC-1, infectivity was

regulated by female sex hormones when cells were depleted of hormones for 1 week. Both

hormones estradiol and/or progesterone resulted in higher infection levels in ECC-1 cells than

control (no hormone-added). Addition of estradiol alone had the highest impact on the level of

infectivity by 1.7-fold increase (48 to 83.2 %). The percentages of inclusion-containing cells in

samples supplemented with progesterone alone were approximately 1.4-fold less than any other

hormonal conditions. The combination of both hormones (E2 and P) had an intermediate affect

on susceptibility between estadiol and progesterone (74.8 %) (Figure 2.3).

Figure 2.4: Confocal micrographs of C.trachomatis (1 week passaged in stripped FCS)

A B.

C D .

53 | P a g e

Figure 2.4: The ECC-1 cell line was grown to 100% confluence on 10mm coverslips in a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 1 week) and pre-treated with hormones 24 hrs before infection. Scale bars represent 20 µm. A represents the no hormone [negative (-ve)] control, no hormone suppliment. B represents estradiol-supplimented, C represents progesterone-treated and D represents combination of both hormones.

The levels of chlamydial infectivity of human endometrial epithelial cells was greater in

estrogen-treated than in progesterone-treated cells. In fact, the inclusion count in progesterone-

treated ECC-1 seeded with 5 x 105 cells and infected at an M.O.I of 15 was lower than in ECC-1

treated with estradiol. When cells were grown and maintained in the normal human physiological

concentration of estrogen (200 pg/ml), chlamydial infectivity was increased up to 83.2%. In

other words, addition of estradiol restored infectivity almost to a level seen when cells were

grown in normal complete FCS; whereas addition of progesterone did not restore infectivity. The

average size of inclusions observed in this experiment was 10 to 15 µm which was similar to

what was seen in normal conditions (complete FCS).

54 | P a g e

2.3.3: Effect of hormone addition on infection of C.trachomatis ECC-1 cells cultured for 26 weeks in charcoal-stripped FCS In this part of the experiment, ECC-1 cells were cultured in hormone-reduced medium for 26

weeks to be sure all endogenous hormones were removed. Both hormones estradiol and/or

progesterone resulted in significantly higher infection levels in ECC-1 cells than control (no

hormone-added). Susceptibility of human endothelial, ECC-1, increased by approximately 2-

fold in response to E2 and/or P compared to cells grown in charcoal-stripped media. Endothelial

cells, when exposed to estradiol, were significantly more susceptible to chlamydial infection than

endothelial cells that had been grown in stripped FCS medium alone (39.9 % to 84.3 %) (Figure

2.5).

Figure 2.5: Percentage of ECC-1 cells infected (26 weeks passaged in strriped FCS)

Contr

ol E PP+E

0

20

40

60

80

100

Treatment Groups

% o

f cells

in

fecte

d

Figure 2.5: Influence of hormone supplementation on C.trachomatis serovar D infectivity in the human endothelial cell line, ECC-1 with 24 hrs hormonal pre-supplement. Control represents no hormone suppliment, E represents 17β-estradiol, P represents Progesterone and E+P represents combination of both hormones. Standard error of the mean (SEM) for Control, E, P, P+E samples were: 0.66, 0.65, 0.61 and 0.54 respectively. Difference between each group sample was tested and P< 0.05 was obtained.

55 | P a g e

Interestingly, there were approximately an identical number of inclusions in the samples grown

in charcoal-stripped media for 1 week and 26 weeks as both showed less than 50% infectivity.

Figure 2.6: Confocal micrographs of C.trachomatis (26 weeks passaged in stripped FCS)

A B .

C D . Fig. 2.6: Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 26 weeks) and pre-treated with hormones 24 hrs before infection. The ECC-1 cell line was grown to 100% confluence on 10mm coverslips in a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I. of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Scale bars represent 20 µm. F1, F2 represents the negative (-ve) control, no hormone suppliment. G1, G2 represents estradiol-added, H1, H2 represents progesterone-treated and I1, I2 represents combination of both hormones.

56 | P a g e

Twenty four hours pre-supplement of ECC-1 with estradiol and/or progesterone made no

significant difference to the inclusion morphology (with average size of 10 to 15 µm), but the

inclusions count was higher than in cells grown in charcoal-stripped media. Our data clearly

showed that the ECC-1 cell line grown in estrogen-supplemented media were slightly more

susceptible (~ 85%) to C.trachomatis serovar D infectivity than were progesterone-supplemented

epithelial cells, where chlamydial infectivity increased by 77 %.

57 | P a g e

2.3.4: Effect of extended hormone pre- supplement (48 and 72 hrs) on C.trachomatis infection of ECC-1 cells cultured for 26 weeks in charcoal-stripped FCS

The length of time cells were pre-supplemented with hormones was increased and the effect of steroid

hormones on chlamydial growth and inclusion morphology was examined. Interestingly, the results

indicated that there were identical numbers of inclusions after both 48 and 72 hrs pre-hormone-

suppliment. For example, estradiol addition resulted in 89.1 and 90 % infectivity in the 48 and 72 hrs

hormone pre-treated samples respectively. Progesterone supplementation also increased infection

levels to 82.2 % and 84.9 % in the 48 and 72 hrs progesterone pre-supplemented samples respectively

(Figure 2.7). Therefore, neither 48 hrs nor 72 hrs pre-supplement with progesterone and/or estrogen

affected the amount of chlamydial infectivity in ECC-1 cells.

Figure 2.7: Percentage of ECC-1 cells infected (48 hrs and 72 hrs pre-supplemented with hormones)

Control

E-48

E-72

P-48

P-72

P+E-48

P+E-72

0

20

40

60

80

100

Treatment Groups

% o

f cel

ls in

fect

ed

Figure 2.7: Influence of hormone supplementation on C.trachomatis serovar D infectivity in the human epithelial cell line, ECC-1 with 48 hrs and 72 hrs hormonal pre-supplement. E represents 17β-estradiol, P represents Progesterone and E+P represents combination of both hormones. Standard error of the mean (SEM) for 48hrs E, P, P+E samples were: 0.61, 0.69 and 0.50 respectively and SEM for 72 hrs E, P, P+E samples were: 0.49, 0.69 and 0.66 respectively. Difference between each group sample was tested and P< 0.05 was obtained.

58 | P a g e

In addition to growth rate and infection level it was also decided to examine the morphology of C.trachomatis inclusions following pre- suppliment with steroid hormones.

Figure 2.8: Confocal micrographs of C.trachomatis (48 hrs hormone pre-supplementation)

A B .

C.

Figure 2.8: The ECC-1 cell line was grown to 100% confluence on 10mm coverslips, within a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I. of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 26 weeks) and pre-treated with hormones 48 hrs before infection. Scale bars represent 20 µm. A represents estradiol-supplemented, B represents progesterone-treated and C represents combination of both hormones.

59 | P a g e

ECC-1 cells infected with C.trachomatis after 48 and 72 hrs of hormone conditioning contained

larger inclusions than cells conditioned by 24 hrs pre-treated with hormones. In both cases

infection was stopped 48 hrs post infection. This confirms that C.trachomatis seeded on

epithelial cells under extended hormone supplemented culture conditions have the potential to

form larger inclusions.

The result from this study showed that the duration of hormone supplementation had a less

noticeable influence on the infectivity in this epithelial cell as it was shown that the same percent

of cells were infected; however chlamydial inclusion formation was obviously different from

control cells. The average size of inclusions in normal condition (complete FCS) and after 24 hrs

of hormone supplementation were approximately 10 to 15 µm, but after 48 hrs of hormone

supplementation it was observed that the majority of the inclusions were larger than 20 µm,

Figure 2.8.

60 | P a g e

Once again, extended time supplementation with steroid hormones (72 hrs pre-supplement) increased the size of inclusions to 25 µm on average (Figure 2.9).

Figure 2.9: Confocal micrographs of C.trachomatis (72 hrs hormone-supplemented)

A B.

C .

Figure 2.9: The ECC-1 cell line was grown to 100% confluence on 10mm coverslips, within a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I. of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 26 weeks) and pre-treated with hormones for 72 hrs before infection. Scale bars represent 20 µm. A represents estradiol-supplemented, B represents progesterone-treated and C represents combination of both hormones. 72 hrs hormonal pre-supplement, chlamydial inclusions increased further in size.

61 | P a g e

Table 2.1: Summary of influence of hormone supplementation on C.trachomatis serovar D infectivity and growth

Type of FCS Pre- suppliment with hormones

Hormonal Conditions

Average size of inclusions (µm)

Level of Infectivity (%)

ECC-1 cells grown in normal FCS N/A Normal 10 to 15 98.3

ECC-1 cells grown in stripped FCS for 1 week

24 hrs

Control 10 to 15 48

E 10 to 15 83.2

P 10 to 15 61.4

P+E 10 to 15 74.8

ECC-1 cells grown in stripped FCS for 26 weeks

24 hrs

Control 10 to 15 39.9

E 10 to 15 84.2

P 10 to 15 77

P+E 10 to 15 80

ECC-1 cells grown in stripped FCS for 26 weeks

48 hrs

E > 20 89.1

P > 20 82.2

P+E > 20 86.5

ECC-1 cells grown in stripped FCS for 26 weeks

72 hrs

E > 25 90

P > 25 84.9

P+E > 25 87.5 Control: sample grown in charcoal-stripped media E: Estradiol, P: Progesterone, P+E: combination of both hormones

62 | P a g e

2.3.6 Microscopic evidence of chlamydial persistence in hormone supplimented cultures Immunocytochemistry and confocal microscopy of C.trachomatis grown in the presence of

estradiol revealed abnormal large RBs contained within inclusions compared to the acute

cultures, which is one of the well known characteristics of chlamydial persistence (Figure 2.10).

This characteristic was consistent with previous reports of the C. trachomatis morphology during

antibiotics and IFN-γ induced persistence (Beatty et al., 1993; Kramer and Gordon 1971). In

marked contrast, in the presence of a combination of hormones and also progesterone alone there

were no signs of chlamydial persistence. This data are not complete and further investigation by

using Transmission Electron Microscopy (TEM) is required to confirm this result.

Figure 2.10: Abnormal morphology of chlamydial inclusions (enlarged RBs) under estradiol suppliment.

Figure 2.10: The estradiol supplemented sample showed microscopic evidence of persistence.

63 | P a g e

2.4 Discussion Using a rat model Kaushic et al. (2000) found that in rats infected with C.muridarum at either

estrus or diestrus, without progesterone pre- suppliment, no chlamydial inclusions were observed

in either the uterus or vagina, although an enhanced local immune response was noted. In

addition, following progesterone-supplement, rats were more susceptible to C. muridarum

infection. Chlamydial inclusions were observed in the uteri and vaginas of infected animals and

at the same time immune responses could be identified both locally and systemically.

Interestingly, they have found that rats were more susceptible to genital chlamydial infection

when exposed to progesterone pre-supplement (Kaushic et al., 2000). These results contrast with

data obtained from the guinea pig model, where a higher number of animals were sensitive to

chlamydial infection in the estradiol-treated animals than in animals without hormone

suppliment and the animals receiving progesterone (Pasley et al., 1985a, 1985b). Interestingly,

studies of chlamydial infection in humans revealed an association between chlamydial infection

and stage of the menstrual cycle (Ghanem et al., 2005; Sweet et al., 1986). For example, a higher

rate of chlamydial susceptibility was observed in the proliferative part of the menstrual cycle

when estradiol levels were high. In addition, hormonal contraceptives have also been shown to

enhance susceptibility to chlamydial infections and other STDs (Washington et al., 1985).

These previous studies provided direct evidence that the hormonal environment at the time of

pathogen exposure can have a distinct effect on the outcome of a microbial infection in the

genital tract. In the current experiment, we examined the effect of the hormonal environment in

(a) regulating ECC-1 susceptibility, (b) inclusions morphology and (c) the type of inclusions that

develop.

In many in vitro studies, cell culture experimental work with human chlamydial isolates has been

performed with McCoy cells. It should be considered that McCoy cells are not of reproductive

tract origin, therefore not a natural target for C.trachomatis infection. Instead, for many

experimental analyses HeLa cells were used, which are very sensitive to C.trachomatis infection,

but they are less representative of primary, differentiated target epithelial cells. As an alternative

a few studies have been performed with primary, hormone-responsive human endometrial

epithelial cells. In this study we used a well known hormone responsive cell line, the human

uterine cell line ECC-1.

64 | P a g e

In vitro studies showed that both estradiol and progesterone regulate the other‟s receptors and

antagonize the biological effects of each other (Gillgrass et al., 2005; Katzenellenbogen, 2000).

As a result it is essential to examine the outcome of each hormone separately before combining

their effects. In the current experiment, we examined the effect of estradiol and progesterone

separately and in combination by using the average physiological concentration of the hormones

across the reproductive cycle. Our observations support previous in vitro and in vivo results

which suggested that chlamydial infection might be modulated by steroid hormones.

The influence of exogenously supplied hormones on ECC-1 cells at various time points were

compared, and the results showed that only in cells cultured 1 week in stripped FCS,

progesterone-supplemented cells had a lower susceptibility to infection compared to when they

were supplemented with exogenous estrogen. The results showed that in cells passaged in

charcoal stripped FCS for 1 week, when it was administered alone, estradiol made the ECC-1

cell more susceptible to infection with C.trachomatis. In this part of study, the estradiol effect

was dominant on susceptibility when the combination of both hormones (E + P) was used. It was

demonstrated that progesterone by itself did not appear to have a significant role in regulating

susceptibility in cells grown for 1 week in stripped FCS.

The mechanism by which estradiol made ECC-1 cells more susceptible is not clear. One of the

probable mechanisms which may play a role in the differences in host susceptibility seen under

different hormonal conditions may be differential expression of receptors on epithelial cells,

which mediate chlamydial entry. The other well-accepted mechanism is that during estrus and

under the influence of estradiol, the vaginal and endocervical epithelium is several layers thick,

making it easier for viral and/or bacterial entry (Gallichan and Rosenthal, 1996). While this is a

possible explanation that may be true when cells are only under the influence of estradiol, there

may be other factors involved in host susceptibility.

Chlamydial infection is initiated by contact, attachment and entry of infectious elementary

bodies (EBs) into the host epithelial cell. The exact system of attachment and entry is still not

clear, even though numerous likely possibilities have been suggested. Zhang and Stephens

(1992) data suggested that a heparan sulfate-like glycosaminglycan on the surface of EBs binds

to a heparan sulfate receptor on the epithelial cells. Other studies by Su and Caldwell (1998)

have provided more information about the probability that chlamydial MOMP is the adhesion

65 | P a g e

molecule that attaches to heparan sulfate proteoglycans on the epithelial surface. Of these above

mentioned, the glycosaminglycan- mediated mechanism is the most commonly involved (Zhang

and Stephens 1992) and it may be under the influence of steroid hormones. Hence, from the

above data and the present study results, it seems that steroid hormones, particularly estradiol,

increase the probability that a potentially infective EB enters into a cell and gives rise to a

productive infection.

Although the number of inclusions is known to increase in the presence of estrogen-supplement

in our experiment, it should be highlighted, that the estrogen-enhanced chlamydial infectivity

reported may not involve bacteria at all but be the result of physiological effects of estrogen on

the target epithelial cell, i.e. epithelial hyperplasia. Therefore, we should consider the possible

mechanisms by which estradiol might affect the metabolism of mammalian cells in such a way

as to change their susceptibility to infection with intracellular parasites, such as Chlamydia spp.

The physiological effect of estrogen may also involve both the surface plasma membrane as well

as intracellular alterations/modifications (Guseva et al., 2005).

Our result indicated, addition of steroid hormones at 24 , 48 and 72 hrs before infection of the

cells cultured for 26 weeks in stripped FCS, restored infectivity almost to a level seen when cell

were grown in normal complete FCS. Therefore, steroid hormones may influence factors present

in the epithelium or the surrounding tissue to alter susceptibility that could increase the number

of infected cells. Another possibility is that the entry of C.trachomatis into the genital epithelium

could be modified by the expression of bacterial receptors that may be hormonally regulated.

The clinical observations also emphasized that steroid hormones directly or indirectly affect the

growth of C. trachomatis either by altering the metabolism of the cell in which C. trachomatis

was growing (Bushell and Hobson 1978). The effects of steroid hormones such as estradiol vary

considerably from one cell line to another. However, the specific action of these hormones has

been attributed to a common pathway in mammalian cells in which the hormone molecule enters

the cell and combines with a specific cytoplasmic receptor molecule (Bushell and Hobson 1978).

These above mentioned possibilities, need to be examined to fully understand the mechanism by

which female sex hormones regulate susceptibility.

66 | P a g e

The effect of sex hormones described in the present study was obtained with a single exposure of

infected cells to extracellular concentrations of the hormone which were similar to average levels

in human serum across the reproductive cycle. It is likely that these hormone concentrations will

be exceeded during pregnancy, and that the local concentration of hormones in inflamed tissues

may also be higher than those found in general circulation.

The results from this study also showed that, the duration of hormone supplement had a less

noticeable influence on the infectivity in this epithelial cell; however, chlamydial inclusion

morphology was noticeably different from control cells. ECC-1 cells infected with C.trachomatis

after 48 and 72 hrs of hormone conditioning contained larger inclusions than cells conditioned by

24 hrs pre-supplementation with hormones. This confirms that C.trachomatis seeded on

epithelial cells under extended hormone supplemented culture conditions favors the formation of

large inclusions. More infectious particles may enter the cells due to an enhancement of

adsorption to cells or of cellular endocytotic mechanisms. This finding is possibly a consequence

of EB attachment in estrogen- and progesterone-dominant phases (Guseva et al., 2003). Guseva

et al. (2003) suggested that EBs were able to bind to the surfaces of epithelial cells when

progesterone was at its highest concentration but did not enter the cells or form inclusions. In

2002, Davis et al.’s study on a component of the estrogen receptor complex (protein disulfide

isomerase) was associated with C. trachomatis serovar E suggested that EBs bind to this protein

on the apical membrane surface of the human endometrial epithelial cell line, HEC-1B (Davis et

al., 2002). In our present study, estradiol might up-regulate the estrogen receptor on the surface

of ECC-1 cells and therefore increase the EB attachment and host susceptibility.

A study by Sweet et al. (1987) revealed a significant prediction for development of salpingitis, as

a complication of chlamydial infection, was if infection occurred in the early, estrogen-dominant

phases of the cycle. Results of the clinical tests of the enhancing role of estrogen on chlamydial

infection in the upper genital tract have been confirmed by animal models (Guseva et al., 2005).

Rank et al. (1993) also found that at the time of chlamydial infection in the upper genital tract

where high estradiol levels occurred, a considerably higher percentage of guinea pigs developed

chronic inflammation, fibrosis and tubal dilation of the oviducts. Kaushic et al. (2003) suggested,

depending on the hormone treatment, susceptibility of mice to genital herpes infection can differ

significantly. In comparison with normal conditions, untreated mice, progesterone-treatment

67 | P a g e

increased susceptibility to HSV-2 significantly both at diestrus and estrus. On the other hand,

estradiol-treated animal protected from viral infection and did not show any vaginal pathology

(Gillgrass et al., 2005).

Lastly, and by no mean least, more verification of our findings was obtained by Guseva et al. in

a swine model (Guseva et al., 2003). As the organ physiology of swine is very similar to

humans, thus results from swine are more reliable than mice, rats and guinea pigs. The chance of

C. suis S45 infection in both luminal and glandular epithelial cells from female swine were

greater when the epithelial cells were obtained in the estrogen-dominant phase versus the

progesterone-dominant phase. For instance, cervical luminal epithelial cells, isolated in the early

diestrous and pro-estrous stages, were ten-fold more susceptible to infection than cervical cells

obtained from swine at the peak of progesterone activity (days 12 to 15). They showed the

luminal epithelial cells isolated from the uterus can be easily infected with Chlamydia on day 1

of the cycle, which was the estrogen-dominant phase, and the subsequent rate of infectivity of

these cells was correlated with fluctuations in the hormonal levels. Minimal susceptibility to C.

suis infection was reported throughout the progesterone-dominant phase in the Guseva et al.

study (Guseva et al., 2003). The above data suggests a possible role for greater estrogen activity

through these pre- and post-progesterone high concentration stages.

In our experiments, preliminary evidence of long-term chlamydial infections, termed persistent

infection in cell culture systems was observed, although our data are not complete and further

investigation by using Transmission Electron Microscopy (TEM) is required to confirm this

result. Persistent infections are characterized by the capacity of Chlamydia to enter a

metabolically inactive and non-infectious state and later on re-start productive growth with the

eventual release of infectious particles, EBs (Hogan et al., 2004). Persistent chlamydial

infections can develop in in vitro cell culture in response to nutrient starvation (lack of some

amino acids or iron), antibiotic treatment, and a low dose of IFN-γ-treatment. Typical chlamydial

persistence inclusions contain aberrant enlarged RBs which have not differentiated further into

infectious EBs. In our project, we observed evidence to suggest that chlamydial persistence

occurs during hormonal supplementation, estradiol in particular, in the in vitro model of ECC-1

infection. This evidence is based on various types of observations, including confocal

microscopy (abnormal large RBs), microarray data and real time PCR (Reviewed in chapter 3).

68 | P a g e

To summarize, our results illustrated that, except in cells cultured for 1 week in stripped FCS in

which progesterone has less effect on susceptibility, both hormones estradiol and/or progesterone

increase susceptibility to genital chlamydial infection. The effects of progesterone on the

infectivity of C.trachomatis in the ECC-1 cells varied between the first and second group, 1

week charcoal striped FCS and 26 weeks charcoal striped FCS supplemented media, although

the mechanism by which this occurred is not known. The results from this study showed that

progesterone and/or estradiol supplementation not only alter host susceptibility, allowing them to

be more easily infected with C.trachomatis, but estradiol also changes the morphology of

inclusion in the treated ECC-1 cells. The differences seen under different hormone conditions in

the infectivity make this a very useful system to identify the mechanism of susceptibility and

inflammation. The data from this study raise questions regards to the effect of hormones on

change in susceptibility of women to STDs. These findings have implications for future vaccine

strategies against genital infections. Using knowledge about the hormonal environment might

directly or indirectly help us to induce protective immune responses which may lead to more

effective vaccines.

Our data indicated that the most noticeable effect of hormone supplementation on epithelial cells

chlamydial infectivity was in the presence of estradiol. Therefore, we can conclude that at the

peak of estrogen concentration (proliferative phase) the chance of chlamydial infection is higher

than other phases. We hope that these results lead to further study on the influence of estradiol

and/or progesterone on chlamydial interaction with host genital epithelial cells. Results from this

study demonstrated that sex hormones modulate the hormone-responsive human genital

epithelial cell, ECC-1 susceptibility to C. trachomatis infection. Besides the levels of infectivity

of epithelial cells with C.trachomatis serovar D being affected by steroid hormones, the

morphology and size of chlamydial inclusions were also affected by hormone supplementation.

Since C.trachomatis infections of female genital tracts are often asymptomatic, and subsequent

re-infections lead to inflammatory responses with pathological sequelae such as pelvic

inflammatory disease, scarring of fallopian tubes and ectopic pregnancy, these findings have

important implications to reduce the health burden of such diseases. Further characterization of

this model could provide unique information to improve our understanding about asymptomatic

chlamydial infections, which have been difficult to study because of the lack of an appropriate

69 | P a g e

animal model. Further investigations are required to characterize the chlamydial infection under

different hormonal conditions to observe if inflammation persists or inclusions are regulated by

in vivo environment.

In conclusion, it is possible that the enhancement of chlamydial infection in ECC-1 cells

demonstrated here may not only be of practical application to the laboratory diagnosis of these

common infections, but may form a useful experimental model for the further study of hormonal

influences on natural infection. This knowledge is crucial for developing better prophylactic and

therapeutic strategies against these infections in women. An effective vaccine against chlamydial

infection would be an ideal choice for preventing transmission.

70 | P a g e

Chapter 3

Effect of the female sex hormones on C.trachomatis gene expression

71 | P a g e

72 | P a g e

3.1 Introduction Studies using animal models of genital tract Chlamydia infection suggested that the hormonal

status of the genital tract epithelium at the time of exposure may influence the outcome of

infection. For example, in the commonly used mouse model involving C. muridarum infection,

pre-treatment of animals with progesterone was required to achieve infection of all animals

(Rank 1994; Berry et al., 2004b). Conversely, guinea pigs were more susceptible to infection

following pre-treatment with estradiol (Rank et al., 1982). Using a rat model Kaushic and

colleagues found that in rats infected at either estrus or diestrus, without progesterone pre-

treatment, no chlamydial inclusions were observed in either the uterus or vagina (Kaushic et al.,

1998a). In an in vitro model of infection of HeLa cells with C. trachomatis, estradiol pre-

suppliment of cells enhanced both the adherence of chlamydial elementary bodies (EBs) to the

host cells as well as the development of chlamydial inclusions (Bose and Goswami 1986). Oral

contraceptive use also increased the risk of contracting chlamydial infections compared to

women not using contraception (Baeten et al., 2001a). Collectively, these data showed that the

outcome of chlamydial infection is partly determined by the hormonal status of the epithelium at

the time of exposure.

Recently it has become evident that Chlamydia can enter a chronic or persistent infectious form

that may be reactivated at a later stage. This form can be induced in vitro by treatment of

infected cells with some antibiotics or with low doses of IFNγ (Hogan et al., 2004). The patterns

of chlamydial gene expression differ between the normal acute infectious form and the persistent

infectious form (Hogan et al., 2003) and it has been suggested that incomplete antibiotic

eradication of infections or an inappropriate immune response to a primary infection may set the

stage for a cycle of persistent/chronic infections that might reactivated periodically and as a

result drive an ongoing inflammatory immune response over months or years that ultimately

causes salpingitis and PID.

In addition to acute chlamydial infections, Chlamydia is linked with a series of chronic diseases

which were characterized by inflammation and/or scarring, causing significant damage to the

host. Recurrent chlamydial disease can be caused by repeated infections or persistence of the

bacteria following unresolved infections. In fact, the increasing number of chlamydial infections

and transient immunity monitored post infection makes it hard to differentiate between persistent

73 | P a g e

infection and re-infection (Brunham 1999). Nonetheless, characterization of the in vitro

persistent phase of Chlamydiae and multiple lines of in vitro evidence suggested that Chlamydia

persist in an altered form during chronic disease (Hogan et al., 2004).

3.1.1 In vitro chlamydial persistence Chlamydial persistence has been described as a viable but non-cultivatable growth stage

resulting in a long-term relationship with the infected host cell (Beatty et al., 1994). Such

characteristics can be established in vitro, by inducing host cells with external stress. The

different in vitro persistence systems usually share altered chlamydial growth characteristics, for

instance a loss of infectivity and the development of relatively small inclusions containing less

chlamydial particles (Hogan et al., 2004).

Previous studies demonstrated abnormal chlamydial development following antibiotic treatment.

It is well known that agents that target bacterial protein or RNA synthesis are able to inhibit

chlamydial differentiation either from EB to RB or from RB to EB, depending on the time they

were added to an in vitro infection (Moulder 1991). In contrast to persistence induced by

antibiotics, the reduction of crucial nutrients in cell culture medium temporarily or permanently

arrested both Chlamydia and their host cells growth until the missing nutrients were replaced

(Moulder 1991). For instance, C.trachomatis grown in McCoy cells became persistent in

response to the removal of glucose from the cell culture medium, also losing infectivity and

showing abnormal morphology (Harper et al., 2000). Treatment of in vitro chlamydial infections

with cytokines, especially IFN-γ, indirectly provided a system of deficiency-induced persistence

that could possibly reflect in vivo events.

The recent finding that Chlamydia can enter a chronic/persistent infectious form that can be

reactivated, perhaps many times, over a period of months or years following infection is cause

for alarm. The fact that this form of infection can be induced, in vitro at least, by the antibiotics

commonly used to treat acute infections and by cytokines produced in response to infection itself

emphasizes the need for a greater understanding of how infection is linked to the development of

inflammatory upper tract disease in many infected individuals.

74 | P a g e

Previous data have demonstrated that the metabolic characteristics of persistent chlamydiae were

not the same as those of actively growing organisms (Beatty et al., 1994; Jones et al., 2001). The

data from Hogan et al. (2004) combined with Gérard et al. (2002), suggested that two major

hallmarks of persistence were inhibited RB-to-EB differentiation associated with shut down

(down-regulation) of late genes and impaired RB development caused by blockages in key

pathways. The omcB and trpB genes are currently the most reliable general markers of

chlamydial persistence. In addition, few other genes involved in chlamydial persistence revealed

by Gérard et al. (2002), (a) two genes encode glycolysis pathway (pyk, yggV) (b), two genes

(cydA, cydB) function in electron transport system, and (c) two genes encode production of

tryptophan syntheses subunits.

A previous study by Jane Finnie (Honors thesis, 2006, University of Newcastle) showed that the

host innate immune response to infection is regulated by changes in sex hormones during the

reproductive cycle. If the hormonal status of the epithelium at the time of infection can influence

the immune response then this may directly or indirectly affect the type of chlamydial infection

that develops following exposure. Therefore, for the first time ever we tested the hypothesis that

changes in sex hormones directly influence the type of chlamydial infection (resolving versus

chronic) that develops in the target epithelium, which may ultimately determine the pathological

outcomes of infection. This study determined how the sex hormones, estradiol and progesterone,

affect the type of chlamydial infection that develops.

75 | P a g e

Figure 3.2: Experimental plan for Chapter 3: preliminary transcriptional analysis of the C.trachomatis infection model under different hormonal conditions

Culture C.trachomatis

serovar D in 2 cell lines

Hormones preparation and

supplements

ECC-1 Cells HEp-2 Cells

1 week culture in hormone-

reduced conditions

C.tachomatis

growth and propagation

26 weeks culture in hormone-

reduced conditions

Infecting ECC-1 cells at an MOI

15

Total RNA extraction using

Trizol

76 | P a g e

The hormone responsive human endometrial cell line, ECC-1, was grown in charcoal-stripped FCS to remove endogenous steroid hormones. Since essential growth factors and hormones were removed from culture media the cells growth rate reduced considerably. Cell cultures were split into two distinctive groups. The fist group represents cells grown in normal conditions with FCS to 100% confluence on T75 flasks. These cells were then passaged in stripped-FCS for 1 week. The second group involved culturing in stripped-FCS for 26 weeks. C.trachomatis serovar D was grown and propagated on the HEp-2 cells and titrated on the ECC-1 cell line. ECC-1 cells were cultured with average physiological concentrations of estradiol and/or progesterone for 24 hours pre-infection and then infected with C.trachomatis at an M.O.I of 15. 48 hrs post-infection, RNA was harvested from ECC-1 following standard procedures. Dynabeads® (poly A+ purification kit) were used to remove eukaryotic RNA. The bacterial RNA was then subjected to microarray analysis. The microarrays were performed in duplicate and validated with qRT-PCR.

Eukaryotic RNA was removed

using Dynabead technique

Microarray experiment performed in duplicate

RNA labelled with ENZO RNA transcript labelling kit and hybridized to chlamydial whole

genome using Affymetrix array

Validate microarray data using q RT-PCR

Analysis of genes differentially regulated by

hormones

77 | P a g e

3.2 Methods

3.2.1 Cell lines

ECC-1: The ECC-1 is a well-differentiated, steroid responsive human endometrial cell line and

was a kind gift from Dr John Fahey (Department of Physiology, Dartmouth Medical School,

New Hampshire, U.S.A.). ECC-1 cells were maintained in phenol red-free 1x Dulbecco‟s

Modified Eagle Medium/Ham‟s F12 nutrient mix (DMEM/F12 – 1:1) (Invitrogen, Carlsbad, CA,

USA) containing 15mM HEPES and 2.5mM L-glutamine, and supplemented with 15% heat-

inactivated charcoal/dextran-treated foetal bovine serum (FBS) (Hyclone, Logan, Utah, USA),

1M HEPES buffer, 500U/ml penicillin G sodium/5,000µg/ml streptomycin sulphate, 100x

200mM L-glutamine (Invitrogen) and 10mM 100x MEM non-essential amino acids (Thermo

Electron Corporation, Melbourne, Vic, Australia).

HEp-2: The HEp-2 cell line is a human epithelial cell line. The HEp-2 cell line was maintained

in 1x DMEM containing phenol red, 4.5g/L D-glucose, 110mg/L sodium pyruvate, and 584mg/L

L-glutamine, and supplemented with 500U/ml penicillin G sodium/5,000µg/ml streptomycin

sulphate (Invitrogen), 1x non-essential amino acids, and 10% heat-inactivated FBS (JRH

Biosciences, Lenexa, Kansas, USA).

3.2.2 C. trachomatis serovar D growth and propagation C. trachomatis serovar D seed was grown, maintained and further propagated to create C.

trachomatis Serovar D stock. Stock was grown, maintained and propagated in 75cm2 flasks

(Griener Bio-One, Frickenhausen, Germany) containing the HEp-2 cell line, and using antibiotic-

free 1x DMEM medium, containing 4.5g/L D-glucose, 110mg/L sodium pyruvate and 584mg/L

L-glutamine, and supplemented with 1x non-essential amino acids and 10% heat-inactivated

FBS. Stock was stored with the addition of sucrose-phosphate-glutamic acid (SPG) (74.6g

sucrose [Chem Supply, Gillman, SA, Australia] 0.512g potassium dihydrogen orthophosphate

1.237g di-potassium hydrogen orthophosphate [BDH Chemicals, Port Fairy, Vic, Australia] 5µl

100x 200mM L-glutamine [Invitrogen], made up to 1L with Milli-Q H2O and pH 7.2), in 75cm2

flasks at -80°C.

78 | P a g e

Stocks of infected cells were thawed until “slushy”, lysed via sonication for 5 min and vortexing

for 2 min, and then centrifuged at 200xg ( Beckman Coulter, GS-6R ) for 5 min at 4°C to pellet

cell debris. The supernatant was then utilised to inoculate a 75cm2 flask of 70% confluent HEp-2

cells. Flasks containing inoculated HEp-2 cells were centrifuged at 600xg for 45 min at room

temperature (RT) then incubated at 37°C/5% CO2 for 4 hrs. Host cell proliferation was halted

with the addition of 1µl cyclohexamide (1 mg/µl)/1ml DMEM medium. Infections were

monitored for a further 44 hrs at 37°C/5% CO2, before the addition of 15mls ice-cold SPG.

Flasks were immediately stored at -80°C until chlamydial EB purification.

3.2.3 C. trachomatis serovar D semi-purification C. trachomatis was semi-purified from the infected HEp-2 cells via sonication and vortexing, as

previously stated. The sonicate was centrifuged at 11,200xg for 30 min at 4°C (SORVALL® RC

26 PLUS ultra-centrifuge, SORVALL® SLA-1500 rotor, Thermo Electron Corporation,

Melbourne, Vic, Australia) to pellet chlamydial bodies. The pellet was re-suspended in 10 mls

SPG, snap-frozen in liquid N2, and stored at -80°C until further purification.

3.2.4 Titration of C. trachomatis serovar D ECC-1 cells were plated, in duplicate, with 1x DMEM supplemented with 10% heat-inactivated

FBS, at 1 x 105 cells/ml, in a 24-well plate containing 10mm diameter coverslips. At

approximately 70% confluence, DMEM medium was replaced with 200µl fresh DMEM

containing 20µl of purified chlamydial EBs. Serial dilutions (1:2) were performed and plates

centrifuged at 400xg for 45 min at RT, then incubated at 37°C/5% CO2 for 4 hrs. Host cell

proliferation was suppressed by the addition of 1 ml DMEM medium containing 1 µl

cyclohexamide (1 mg/µl). Plates were incubated for 24 hrs at 37°C/5% CO2. Infected cells were

then fixed and permeabilised with methanol and stored in PBS at 4°C until staining.

Infected cells were stained utilising the CelLabs Chlamydia Cel LPS staining kit, containing the

fluorescein isothiocyanate (FITC)-labelled mouse monoclonal antibody specific for chlamydial

lipopolysaccahride (LPS) (CelLabs, Brookvale, Australia), according to manufacturer‟s

instructions. Coverslips containing infected cells were placed cell-side-up on microscope slides

79 | P a g e

(Livingstone International Pty. Ltd., Rosebery, Australia), and Chlamydia Cel LPS Reagent was

added to coat each coverslip. Slides were incubated in a humidifier for 30 min at 37°C/5% CO2.

Following incubation, coverslips were removed, washed 3x with PBS, and placed back on the

microscope slide cell-side-up. Rhodamine-stained cells and FITC-stained chlamydial inclusions

were then visualised and counted using a ZEISS MC 63A microscope (Zeiss, Oberkochen,

Germany) and ifu/ml calculated. Rhodamine-stained cells and FITC-stained chlamydial

inclusions were then visualised and counted using a ZEISS MC 63A microscope (Zeiss,

Oberkochen, Germany) and ifu/ml calculated. Rhodamine is a fluorone dye which is commonly

used as a tracer dye to stain eukaryotic cells, which bind to eukaryotic cells and appear as a red

light under fluorescent microscopy.

To calculate ifu/ml, the area of one 24-well plate well (cm2) at 40x magnification, was divided

by the area of the field examined (cm2) at 40x magnification, giving fields/well. A minimum of

40x fields were counted, with the average multiplied by fields/well to calculate the number of

chlamydial inclusions/well (ifu/well). Innoculum/well (µl) was calculated from the 1:2 dilutions

performed and the innoculum/ml calculated. The inclusions/well (ifu) was multiplied by the

innoculum/ml to calculate ifu/ml.

3.2.5 Hormone preparation Lyophilised progesterone and 17β-estradiol (Sigma-Aldrich, St. Louis, MO, USA) were

solubilised in absolute ethanol to 1mg/ml stocks. Serum levels of female sex hormones, estradiol

and progesterone, fluctuate throughout the menstrual cycle. In this study mean physiological

concentrations of 17β-estradiol (200pg/ml) and progesterone (20ng/ml), adapted from Williams

et al. (2001) were further diluted using phenol red-free 1x DMEM/F12 medium (1:1)

(Invitrogen), supplemented with 10% charcoal/dextran-treated FBS (Hyclone).

3.2.6 Hormonal supplement of FRT cell lines Once the ECC-1 cells had reached 100% confluence, physiological concentrations of 17β-

estradiol, progesterone, and combination of 17β-estradiol and progesterone (1:1) were added to

respective wells. Although the physiological concentration of progesterone is higher than

80 | P a g e

estradiol, in this study combination of 1:1, estradiol and progesterone, was chosen as starting

point to merely determine the effect of both hormones togheter. Cells were then incubated for 24

hrs before continuance of experiments.

3.2.7 Extraction of total RNA Total RNA was extracted from infected ECC-1 cells using Trizol® reagent protocol (Invitrogen)

and DNase treated. RNA was precipitated and purified by treatment with 7.5 M ammonium

acetate and washed with 70% ethanol. At 48 hrs post-infection, medium was removed and cells

lysed by the addition of 1ml Trizol® reagent (Invitrogen). Lysed cells were incubated at RT for

5mins and 200µl of chloroform (Merk, Kilsyth, Victoria, Australia) added. Samples were

incubated at RT for 3 min, then centrifuged (Eppendorf centrifuge 5417R, Eppendorf South

Pacific Pty. Ltd., North Ryde, Australia) at 12,000xg for 15 min at 4°C, to separate the samples

into 3 phases ( Figure 3.1). Approximately 600µl of the upper phase, containing the RNA, was

transferred to a sterile 1.5ml eppendorf tube and 600µl of ribonuclease (RNAse)-free 70%

ethanol (35mls absolute ethanol + 15mls Milli-Q H2O) added. Samples were then transferred to a

spin cartridge inserted in a collection tube, and centrifuged at 12,000xg for 15 sec at RT.

A DNAse mix was prepared, containing 70µl DNAse Buffer/sample, and 9.5µl 1U/µl DNAse I

/sample (Invitrogen). 80µl DNAse mix was added and samples incubated for 15 min at RT.

Samples were centrifuged as above, for 1min, to dry the membrane, and 50µl of RNAse-free

H2O added to the tube. Samples were stored at -80 freezer.

3.2.8 Bacterial RNA Isolation Eukaryotic RNA was removed from total RNA using the Dynabead (poly A+ purification kit)

technique (Dynal Biotech ASA, Oslo, Norway) according to manufacturer‟s instructions and the

bacterial mRNA re-suspended in DEPC water. Approximately 2µl elution fluid, containing

purified RNA, was removed determining the quality and quantity of RNA. Purified RNA was

examined, using a NanoDrop® Spectrophotometer (NanoDrop Technologies®, Wilmington, DE,

USA) and associated NanoDrop ND-1000 3.2.1 software (Coleman Technologies Inc., Glen

Mills, PA, USA), to ensure RNA purity and to determine whether amplification was required,

81 | P a g e

prior to microarray analysis. Extracted RNA was determined to be of high purity, as indicated by

the absorbance ratio (A260:A280) being very close to 2.00 (Table 3.1). The quantity of RNA

extracted indicated amplification was not required prior to microarray analysis as the

concentration of RNA was reasonably high and sufficient for our experiment (Table 3.1).

Table 3.1: Quality and Quantity of Extracted ECC-1 RNA

supplemented A260:A280 ng/µl

26 weeks passage - Estradiol 1.97 2649.01

26 weeks passage- Progesterone 1.96 3074.65

26 weeks passage- E2 + P 2.02 2404.53

26 weeks passage- no Hormone supplement 2.03 2487.64

1 week passage - Estradiol 1.98 2537.84

1 week passage- Progesterone 2.01 1935.28

1 week passage- E2 + P 2.05 3222.49

1 week passage – No Hormone supplement 1.94 2258.70

3.2.9 Microarray Eukaryotic RNA was removed using the Dynabead technique (Dynal Biotech ASA, Oslo,

Norway) and the bacterial mRNA re-suspended in DEPC water and sent to the AGRF

(Australian Genome Research Facility, Melbourne, Australia) for microarray analysis. In vitro

RNA transcription is performed to incorporate biotin-labeled ribonucleotide into the cRNA

transcripts using the ENZO RNA transcript labeling kit. Labeled cRNAs were purified using the

Qiagen kit, fragmented to approximately 50 to 200 bases by heating at 94 ºC for 35 min, and 15

µg hybridized to a Chlamydia whole genome Affymetrix Custom array. The array is an

Affymetrix oligonucleotide array format of 1800 features, covering the full C. trachomatis

genome (1175 genes) and containing 8-11 oligonucleotides per target gene, each designed for

optimal hybridization to C. trachomatis and/or C. pneumoniae and screened against non-specific

hybridization with the full human and mouse genomes. After hybridization and subsequent

washing using the Affymetrix Fluidics station 400, the bound cRNAs were stained with

streptavidin phycoerythrin, and the signal amplified with a fluorescent-tagged antibody to

82 | P a g e

streptavidin (Performed by AGRF). Fluorescence was measured using the Affymetrix scanner

and the results analyzed using GeneChip 1.4 analysis software, resulting in the detection of 1175

genes. A total of 8 chlamydial arrays were analyzed with the 4 culture conditions (no hormone,

E, P, E+P) x two different time points (26 weeks passage in charcoal/dextran-treated FCS

compared to 1 week passage).

3.2.9 q RT-PCR Quantitative Real-Time PCR was used to validate the microarray data for 8 selected target genes.

Optimized primer pairs were designed using primer construction software „Primer Express‟

(Applied Biosystems). Each primer pair was used to generate amplicon standards by amplifying

previously generated C.trachomatis cDNA. cDNA generation commenced with denaturation of 5

µg of total bacterial RNA and 1 µl of random hexamers (Invitrogen, Carlsbad, CA, USA) and 1

µl of 10 mM dNTPs at 65 ºC for 5 min. Reverse transcriptase reactions were prepared containing

2 µl 10x RT buffer, 4 µl 24 mM MgCl2, 2 µl 0.1 M DTT and 1 µl superscript III RT (200 U/ µl)

and incubated for 10 min at 25 ºC and then 50 ºC for 50 min. The reaction was terminated by

leaving the mixture at 85 ºC for 5 min. Eventually, cDNA was purified by treating with RNase

and stored at - 85 ºC.

One µg of template was added to the PCR mixture containing 0.15 µM of gene specific forward

and reverse primers, 1 x SYBR Green reaction mastermix before being made up to a final

volume of 25 µL with distilled water. The mix is optimized for SYBR Green reactions and

contains SYBR Green I dye, AmpliTaq DNA Polymerase, dNTPs and optimized buffer

components. Cycling parameters for all reactions were as follows: denaturation at 95 ºC for 10

min ; 40 cycles of denaturation at 95 ºC for 15 sec and 1 min of annealing and extension at 60

ºC; and melting curve analysis from 60 ºC to 95 ºC.

83 | P a g e

Table 3.2: Real-Time PCR primers used in the ABI Prism 7300 quantitative RT-PCR system Gene Product Primer Sequence

FER Forward TCGGCAGATGACGAGAATCA

Reverse CAATCACGCAAGTCCCACAA

LPLA-2 Forward GTTTTTGTTCATTGCGAAGGG

Reverse CCAATACCACAGCTTCCGGA

RecA_2 Forward AAAAGCAATTTGGCGCAGG

Reverse GGCTAAATCCAACGACAATGC

SdhB Forward GCCTGCCCACAAGTAAATGAA

Reverse CCCATCAATGCTCGTAACCG

YciA Forward TGGATCGATTGGCATTAGTGG

Reverse CGCCCATATAAGCAGGAGCA

YjbC Forward GGCCCCTTTGTGACTGTTGAT

Reverse ACCCAAGAGGTTTATGCACCA

YtgC Forward GATTTGCATGACGACTGCCTT

Reverse GGCACCTATTAAAAGCCCTGG

CT181 Forward TGCTATCGAAAAGGTTTCGGAT

Reverse AGGAAATTGGATAGCAAAACCG The ABI 7300 fast real-time PCR system (Applied Biosystems) was used for relative

quantification of cDNA copies for the 8 selected genes and an internal reference gene 16S rRNA

for the hormonal-supplemnted C.trachomatis experiment. Quantitation was carried out by using

a standard curve based on serial dilutions of the amplicon standards covering 6 logs. Real-time

PCR templates for each gene of interest included fresh dilutions of the amplicon standards, 8

cDNA samples (2 x 4 samples per experiment) and distilled water as a negative control. All

reactions were performed in triplicate. Reaction tube mastermixes were prepared as per the

preparation of amplicon standards described above.

84 | P a g e

ABI Prism 7300 SDS Software (Version 1.0) was used to analyze product integrity and to

quantitate relative cDNA concentrations in the samples. Melting curves observed for each gene

were confirmed to correspond to correct amplicon size by agarose gel electrophoresis of PCR

products. The mean cDNA copy number obtained for each gene (triplicate) was divided by the

corresponding mean 16S rRNA value for standardization.

Each gene array profile indicated the expression level of each gene under the differing

experimental conditions. To identify genes with similar expression profiles mathematical

clustering methods were used, with the resulting hierarchy displayed as dendrograms. 16s rRNA

was used as an internal control. The use of an internal control was necessary as the number of

genes expressed under different hormonal conditions varied substantially and no single gene was

constitutively expressed. This method of normalization was particularly important in comparing

samples grown in charcoal-stripped media to hormonal supplemented cultures.

85 | P a g e

3.3 Results The study by Hogan et al. (2004) demonstrated differential gene expression patterns between the

acute versus persistent forms of Chlamydia (Hogan et al., 2004). Whole genome Chlamydia

microarrays are now available and were used in this study to determine the effect of sex hormone

changes on chlamydial gene expression. The development of a chlamydial gene array chip

provided a unique opportunity to investigate the effect of sex hormones on the patterns of

chlamydial gene expression during infection of a hormone responsive endometrial cell line and

to correlate this with the type of infection that develops.

During the microarray analysis, up-regulation was defined as a 2-fold or greater change in the

normalized gene of interest expression levels and down regulation was defined as a 0.5 or lesser

change in the normalized gene of interest expression levels. These values were chosen in this

study since it is commonly considered as an appropriate cut-off for reproducible differential

expression (Walker, 2002). In fact, the 2-fold cut-off seems to be a valid standard for differential

expression, since it represents a compromise between the 1.5- and 3-fold thresholds that have

been used in other recent chlamydial gene expression studies ( Belland et al., 2003 , Nicholson et

al., 2003; Hogan et al., 2004). Using Affymetrix GeneChip software, 1175 chlamydial genes

were analyzed under different hormonal conditions. Finally, each gene of interest was compared

against the corresponding 16S rRNA, internal reference gene data for normalization of the

individual selected gene.

Using Affymetrix GeneChip software, our primary data showed that expression of 112 out of

1175 genes were significantly altered due to addition of female sex hormones to the culture

environment compared to infection in the absence of added hormone(s). Eventually, out of these

112 genes, a subset of 60 genes which showed constant gene expression patterns in ECC-1 cells

passaged for both 1 week and 26 weeks in charcoal-stripped media were selected for future

investigation. Chlamydial genes exhibiting two fold or greater difference (up-regulation) and 0.5

or less (down-regulation) in mRNA expression in the presence of estrogen or progesterone at 48

hrs PI are shown in Tables 3.3 and 3.4.

86 | P a g e

Table 3.3: Chlamydial genes exhibiting reproducible differences in mRNA expression in the presence of estradiol compared to no hormone addition Gene CT Number

Predicted Gene Function Gene Name Expression

817 tyrosine-specific transport protein, putative tyrP U

056 hypothetical protein U

689 ABC superfamily ATPase dppF U

021 hypothetical protein U

031 hypothetical protein U

317 50s ribosomal protein rs10 U

170 tryptophan synthase subunit beta trpB U 606 putative deoxyribonucleotide triphosphate yggV D

332 pyruvate kinase pyK D

591 succinate dehydrogenase subunit A sdhB D

316 50s ribosomal protein l2 rplL D

305 V-type ATPase, subunit I, putative, putative atpI D

013 cytochrome d ubiquinol oxidase subunit I cydA D

014 cytochrome d ubiquinol oxidase subunit II cydB D

249 hypothetical protein D

128 adenylate kinase adk D

296 conserved hypothetical protein D

236 acyl carrier protein acpP D

274 hypothetical protein D

060 type III secretion system protein flhA D

396 molecular chaperone DnaK dnaK D

443 60kD cysteine-rich outer membrane protein omcB D

507 DNA-directed RNA polymerase subunit rpoA D

515 chloroplast ribosomal protein S8 rpsH D

549 sigma regulatory factor-histidine kinase rsbW D

574 X-pro aminopeptidase pepP D

719 flagellar M-ring protein fliF D

723 phosphoglycerate mutase yjbC D

In the in vitro estradiol-supplemented cultures, our data identified 21 genes that were down-

regulated at 48 hrs PI, while 7 genes were significantly up-regulated at 48 hrs PI (Table 3.3).

87 | P a g e

Table 3.4: Chlamydial genes exhibiting difference in mRNA expression in the presence of progesterone compared to no hormone addition Gene CT Number

Gene Function Gene Name Expression

208 3-deoxy-D-manno-octulosonic-acid transferase gseA U

347 site-specific recombinase xerC U

499 lipoate-protein ligase A lplA_2 U

181 hypothetical protein U

535 acyl-CoA hydrolase yciA U

650 recombination protein RecA recA U

633 5-aminolevulinic acid dehydratase hemB U

099 thioredoxin reductase trxB D

047 hypothetical protein D

591 succinate dehydrogenase subunit A sdhB D

749 alanyl-tRNA synthetase alaS D

512 general secretion pathway protein D gspD D

186 devb protein, putative devB D

312 ferredoxin iv fer4 D

079 conserved hypothetical protein D

010 lipid a biosynthesis lauroyl acyltransferase htrB D

344 ATP-dependent protease lon D

129 glutamine ABC transporter, permease protein argR D

345 conserved hypothetical protein D

069 integral membrane protein MtsC, putative ytgC D

060 type III secretion system protein flhA D

389 conserved hypothetical protein D

402 etraacyldisaccharide lpxK D

733 hypothetical protein D

612 dihydropterin pyrophosphokinase or dihydropteroate

folA D

884 hypothetical protein D

723 ribosomal large subunit pseudouridine yjbC D

r06 5S ribosomal RNA D

In the in vitro progesterone-supplemented cultures, our data identified 21 genes whose

expression was down-regulated at 48 hrs PI, whereas 7 genes were markedly up-regulated at 48

hrs PI (Table 3.4). As an additional strategy to confirm the microarray results, 8 genes that were

up/down regulated under progesterone supplementation were selected for further investigation

using quantitative RT-PCR.

88 | P a g e

Table 3.5: Relative fold changes (up-regulated) for differentially expressed C.trachomatis Serovar D genes under progesterone supplementation for both RT-PCR and microarray analysis.

Gene Name

Function

Up-regulated in response to Progesterone

Microarray fold change (Duplicates)

q RT-PCR Fold change

1 lplA-2 lipoate-protein ligase A 3.89 3.11 4.41

2 recA recombination protein RecA 5.69 3.69 7.92

3 yciA acyl-CoA hydrolase 19.43 18.50 7.6

4 CT181 hypothetical protein 5.66 6.86 125

All 4 of the progesterone genes that showed up-regulation by microarray analysis, also

demonstrated up-regulation when analyzed by q RT-PCR (Table 3.5 and Figure 3.2)

Figure 3.2: Fold-change chart for up-regulated normalized gene data under progesterone supplementation using quantitative RT-PCR

89 | P a g e

Table 3.6: Relative fold changes (down-regulated) for differentially expressed C.trachomatis serovar D gene under progesterone supplementation for both RT-PCR and Microarray experiment

Gene Name

Function

Down-regulated in response to Progesterone

Microarray fold change (Duplicates)

q RT-PCR Fold change

1 ytgC integral membrane protein MtsC, 0.08 0.05 0.841

2 yjbC ribosomal large subunit 0.26 0.44 0.512

3 sdhB succinate dehydrogenase subunit 0.06 0.05 2.87

4 Fer-4 ferredoxin iv 0.4 0.05 1.46

During the analysis of the q RT-PCR data set generated in this project, slight differential

expression was defined for 2 down-regulated selected genes (sdhB, Fer-4) compared to the

microarray result (Table 3.6 and Figure 3.3). This might have happened because the microarray

data for these 2 genes came with a high probability of false signal. The other 2 genes (ytgC,

yjbC) revealed a constant pattern between q RT-PCR and microarray analysis. Our real time

PCR data validated our microarray system as 6 out of 8 randomly selected genes revealed similar

patterns in both experiments (RT-PCR and microarray).

Figure 3.3: Fold-change chart for down-regulated normalized gene data under progesterone supplementation using quantitative RT-PCR

90 | P a g e

With regard to the data discussed above, the majority of chlamydial genes which showed

consistent gene expression for both 1 week and 26 weeks cultured in stripped FCS were

observed to be down-regulated in the presence of progesterone or estradiol. Transcript levels for

these genes decreased between 0.5 to 0.0019- fold under hormonal supplementation at 48 hrs PI

(Table 3.3 and 3.4).

In addition to the 7 genes of interest which were up-regulated in the presence of estradiol, 21

genes were observed to be down-regulated under estradiol supplementation. Genes that showed

down-regulation in their mRNA expression profile include cytochrome d, ubiquinol oxidase

subunit I and II (cydA, cydB), uracil-DNA glycosylase (yggV), heat shock protein GrpE (dnaK)

and succinate dehydrogenase subunit A (sdhB). An additional group of hypothetical chlamydial

genes with no currently known function in Chlamydia were also down-regulated in the presence

of estradiol such as CT249 and CT274. These chlamydial genes observed to be down-regulated

in the presence of estradiol could not be assigned to clear functional groups based on similarity

to homologs in other prokaryotes. Seven chlamydial genes were observed to have two fold or greater up-regulated gene expression

levels in the presence of estradiol (Table 3.3). Genes that we observed with this mRNA

expression profile included tyrosine-specific transport protein and genes that encoded the ABC

superfamily ATPase. An additional group of genes were also up-regulated in the presence of

estradiol such as trpB and rs10.

Seven chlamydial genes were observed to have two fold or greater up-regulated gene expression

levels in the presence of progesterone (Table 3.4). Genes that we observed with this mRNA

expression profile included glucose inhibited division protein (lplA_2) and genes that encoded

the thiamin ABC transporter and several genes encoding 5-aminolevulinic acid dehydratase,

leucyl-tRNA synthetase and coenzyme pqq synthesis protein.

In addition to the 7 genes of interest whose expression level increased under progesterone

supplementation, 21 chlamydial genes were observed to have a reduced expression profile in

response to the presence of progesterone (Table 3.4). Down regulated genes include glutamine

ABC transporter (argR), ferredoxin IV (fer4) and phosphoglycerate mutase (yjbC). An additional

91 | P a g e

group of genes were also down-regulated in the presence of progesterone such as kgsA, gspD and

trxB.

As an additional strategy, we attempted to identify all chlamydial genes that were involved in

ADP/ATP exchange and energy source pathway reactions in the C.trachomatis genome. This

analysis revealed six targets which may be involved in chlamydial persistence (a) two genes

encode the glycolysis pathway (pyk, yggV) (b), two genes (cydA, cydB) function in the electron

transport system and (c) two genes encode production of tryptophan syntheses subunits. These

four chlamydial genes involved in ADP/ATP exchange and energy sources indicated the same

pattern as literature suggests for persistent chlamydial forms (cydA, cydB, pyk, yggV).

It has previously been shown that trpA and trpB are two well known genes involved in

chlamydial persistence (Hogan et al., 2004). Hogan et al. (2004) showed that the expression

patterns of these two selected genes were mostly up-regulated in chlamydial persistence. While

the gene expression of trpB in our experiment indicated a similar pattern with what the literature

suggests for chlamydial persistence, the gene expression of trpA appeared with slight difference

(no change). Moreover, our data showed regulation in genes predicted to be involved in

regulation of RB-to-EB differentiation (recA and dnaK).

92 | P a g e

3.4 Discussion C. trachomatis is an obligate Gram-negative intracellular bacterium which has a relatively small

genome of 1.04 megabases (Mb) consisting of 894 open reading frames (ORFs) between 135 and

5,358 nucleotides long, with an average length of 867 nucleotides (Abdelrahman and Belland

2005). Because of its unique lifestyle, the acquisition of exogenous DNA is believed to have had

a restricted role in the subsequent evolution of the species after the organisms started their

intracellular life cycle and evolved into both environmentally and genetically separated species

many years ago (Greub and Raoult 2002; Stephens et al., 1998). The observed diversity in

chlamydial genomes is therefore thought to be mainly due to nucleotide substitutions and gene

loss (Kalman et al., 1999). Chlamydia also has an unusual developmental cycle characterized by

two morphologic forms. Chlamydial infection is mediated by the extracellular metabolically

inactive elementary body (EB), which binds to host cells. Following internalization, the EBs are

transformed into the metabolically active RBs which are the replicating form. The reticulate

body (RB) begins to divide by binary fission and 24 to 48 hrs post infection, RBs transform back

into EBs. We isolated RNA from cells at 48 hrs post-infection, when the RB to EB

transformation occurs. Evidence suggests that inability in the secondary differentiation from RB

to EB leads to chlamydial persistence.

In this section two subjects will be discussed (a) the effect of the hormones on chlamydial gene

expression in general, (b) the effect of the hormones, estradiol in particular, on the chlamydial

persistence characterization. Three-quarters of the chlamydial genes in our experiments were

observed to be down-regulated in the presence of both estradiol and progesterone. The majority

of the chlamydial genes that were down-regulated in the presence of progesterone belong to

common biochemical enzymes or metabolic pathways such as thioredoxin reductase (trxB),

general secretion pathway protein D (gspD), ATP-dependent protease (lon), glutamine ABC

transporter permease protein (argR), and alanyl-tRNA synthetise (alaS) rather than structural

proteins. Interestingly, similar results were observed for genes down-regulated in the presence of

estradiol as most of them belong to common biochemical enzymes or metabolic pathways like

putative deoxyribonucleotide triphosphate (yggV), pyruvate kinase (pyK), V-type ATPase,

subunit I putative (atpI), cytochrome d ubiquinol oxidase subunit I and II (cydA, cydB) , acyl

carrier protein (acpP) and type III secretion system protein (flhA). This suggested that both

hormone-supplemented samples affect metabolism more than structural pathways. There was

93 | P a g e

only one gene (sdhB) which showed a similar pattern in the presence of both progesterone and

estradiol. sdhB encodes the succinate dehydrogenase and iron–sulphur protein subunits and is

anchored to the cytoplasmic membrane.

In vitro models of chlamydial persistence have been described in the literature during the last

two decades. For example, HeLa or other cell types infected with C. trachomatis displayed the

aberrant morphology characteristic of both synovial samples from patients and the Chlamydia-

infected monocytes in the presence of IFN-γ (Gerard et al., 2002). In addition, previous in vitro

studies showed abnormal chlamydial development following antibiotic treatment (Hogan et al.,

2004). Since no other research group has previously analyzed chlamydial gene expression under

hormonal supplement, to improve our knowledge of the molecular basis of chlamydial

persistence we investigated the chlamydial gene transcription under estradiol and/or progesterone

supplement. The outcome of this study should be of considerable value to compare the results of

such analyses with the other in vitro models of chlamydial persistence.

Chlamydial persistence is thought to be due in part to a failure to undergo secondary

differentiation from RB to EB. Molecular consequences include a „blockage‟ in development

involving down-regulation of late gene products in persistent infections (Belland et al., 2003;

Slepenkin et al., 2003) either as an indirect result of blockage or specific suppression by proteins

encoded by other genes which were reported to be strongly down-regulated in IFN-γ-treated

cultures of C.trachomatis ( Belland et al., 2003). Thejls et al. (1991) showed that the sequelae of

genital chlamydial infection usually involves a persistent form of the organism, and these

persistent forms may exist at anatomic locations far from that of the primary infection. That is,

under some particular conditions, C. trachomatis cells disseminate from the urogenital tract to

develop an infection in which RB-like forms persist over long periods in both metabolically and

morphologically aberrant form inside the host cytoplasmic inclusion.

A number of studies have begun to demonstrate the molecular basis of chlamydial persistence.

Diverse functional subsets of chlamydial genes have been reported as being differentially

regulated in response to the presence of a persistence-inducing agent, culminating in the

suggestion that a distinct chlamydial persistence phenotype was observed in the products specific

chlamydial response „stimulon‟ (Belland et al., 2003). As part of this response stimulon, special

94 | P a g e

attention has been placed on the expression of chlamydial genes encoding products associated

with DNA replication (recA, dnaK) (Gérard et al., 2002; Stephens et al., 1990). These studies

described constant expression of genes predicted to encode products with functions in DNA

replication.

Bacterial HSPs have captured the interest of microbiologists for many years, since they represent

major targets of the host‟s immune response. The best-characterized HSPs belong to the (DnaK)

families and are among the most conserved proteins known. The major targets of the humoral

immune response to a C. trachomatis infection are the two chlamydial outer membrane proteins

MOMP (major outer membrane protein) and Omp2, LPS, and the two cytoplasmic heat shock

proteins (HSPs) DnaK and GroEL. During the transformation of EBs to reticulate bodies, the

genes dnaK and groEL, encoding the HSPs DnaK and GroEL and which were involved in

protein folding and also known as chaperones, were highly transcribed (Larsen et al., 1994).

Expression of the dnaK, is involved in protein folding, and was found to be attenuated in the

persistence model (Birkelund et al., 1994; Larsen et al., 1994). Among chlamydial genes, dnaK

gene is one of the heat shock genes which are highly transcribed during the EBs to RBs

transformation process. This suggested a possible explanation for the common observation of

inhibited RB to EB transformation in persistent chlamydiae (Beatty et al., 1995; Zhong and

Brunham 1992). We have supplied evidence that estradiol suppliment has impact on dnaK gene

expression. Our data indicated a 4-fold decrease in dnaK gene expression, suggesting that this

gene is highly down-regulated in presence of eastradiol. Therefore down-regulation of this gene

might directly or indirectly lead to chlamydial persistence. RecA protein also has multiple roles

in controlling SOS mutagenesis: first, the regulation of UmuDC mutagenesis proteins; second,

RecA promotes cleavage of UmuD to its mutagenically active form; and finally, a recently

defined third role involving a direct interaction with DNA polymerase III. Since RecA plays

important roles in recombination and repair of DNA, it is necessary to know of the existence and

function of this activity in Chlamydia under different hormonal conditions. Our data indicated

approximately 5-fold increase in presence of progesterone and no change in presence of estradiol

for this gene, suggesting that progesterone suppliment protects against persistence infection.

Knowledge about RecA and its role in the infection process may also prove useful in vaccine

production. Characterization of the chlamydial recA gene under different hormonal conditions

could be a first step to make a weakened strain for immunization.

95 | P a g e

In addition, the infectious EBs have a disulfide cross-linked outer membrane (OM) that enables

the EBs to attach to and enter host cells. A critical phase of the secondary differentiation process

(metabolically active RB to infectious EB) is the expression of genes that encode proteins which

form the highly disulfide cross-linked bacterial OM complex. The omcB encode cysteine-rich

OM proteins which link with the main OM protein (OmpA) to create this complex. Generally the

OM complex formation involves intra- and inter-protein connecting through the formation of

cysteine bonds. The expression of omcB, cysteine-rich OMP (60 kDa) is associated with

secondary differentiation RBs to EBs (Belland et al., 2003a).

A study on C. trachomatis conducted by Belland et al. (2003) reported down-regulated

expression of the omcB gene in IFN-γ-treatment. Similar to ompA/MOMP other studies have

also confirmed omcB down-regulation as a reliable marker of chlamydial persistence (Hogan et

al., 2003; Mathews et al., 2001; Slepenkin et al., 2003). Hogan and colleagues (2004) reported

down-regulation in omcB in C. trachomatis persistence.

Our results showed down-regulation of omcB at 48 hrs PI in the estradiol-added sample. omcB,

has been reported to be expressed late in infection with considerably higher levels of RNA

presented at 48 hrs PI compared to early infection (Belland et al., 2003b; Nicholson et al., 2003;

Slepenkin et al., 2003). Down-regulated expression of genes and proteins that are specifically

expressed late in the productive developmental cycle is a common observation most likely

reflecting the inhibited RB-to-EB differentiation that characterises persistence. Our data suggest

that estradiol down-regulation of omcB may attribute to persistence in vivo.

In general, persistent C. trachomatis infection expresses low levels of omp1 mRNA (Nanagara et

al., 1995; Beatty et al., 1994). This gene encodes the major outer membrane protein of the

organism, and actively growing C. trachomatis transcribe the gene at a high level. Jones and

colleagues (2001) also provided data demonstrating that persistent chlamydiae express hsp60, a

strongly immunogenic protein, at greater levels compared to those observed throughout normal

active growth. Moreover, evidence showed that throughout persistent synovial infection of

patients with Chlamydia-associated inflammation, C. trachomatis reveal unusual transcriptional

characteristics for some genes in addition to omp1 and hsp60 (Gerard et al., 2001). This unusual

96 | P a g e

pattern of gene expression was also noticed through persistent fallopian tube infection in patients

suffering from ectopic pregnancy (Gerard et al., 1998), and in an in vitro model of chlamydial

persistence (Koehler et al., 1997). Our data clearly demonstrated similar gene expression

patterns for both of the above mentioned genes under estardiol supplement. Both omp1 and

hsp60 were expressed at higher levels (1.4 and 1.6 respectively) in the presence of estradiol

compared to control samples.

Until 5 years ago, C. trachomatis was considered an obligate energy parasite within its host, with

uptake of ATP mediated by bacterially encoded ATP/ADP exchange proteins. Data have

demonstrated that the metabolic characteristics of persistent chlamydiae were not the same as

those of actively growing organisms (Beatty et al., 1994; Jones et al., 2001). The results reported

from the Gerard et al. (2002) indicate that during the primary phase of active infection, C.

trachomatis obtain the energy essential for EB to RB transformation, and also for metabolism,

from host cells via ATP/ADP exchange. Through active growth of the RB, the organisms

acquired ATP not only from the host, but also via their own glycolytic and pentose phosphate

pathways. Gerard et al. (2002) reported that throughout the initial phase of monocyte infection,

prior to the complete establishment of persistence, C.trachomatis cells utilized both ATP/ADP

exchange and their own pathways to support metabolic needs, even though the overall metabolic

rate in the organisms was relatively low. However, when persistence has been established the

only source of ATP seems to be the host (Gerard et al., 2002). That is, mRNA for glycolytic and

pentose phosphate pathway enzymes were absent or severely reduced, which suggested that

these systems were partially, if not completely, shut down during persistence. Therefore, C.

trachomatis cells seemed to be partial energy parasites on their hosts during active growth,

however during persistent infection the organisms appeared to be completely dependent on the

host for ATP.

Evidence suggested that the C.trachomatis genome encodes the glycolysis pathway enzyme,

ATP/ADP exchange protein, and other energy transduction-related components. Although

Chlamydia inside the joint is metabolically active, they showed an unusual transcriptional pattern

that makes it easy to differentiate them from RB during active infections (Gerard et al., 2002).

Because this organism showed differential expression of some genes during persistence, we

asked whether transcription of C. trachomatis genes encoding components of the glycolytic and

97 | P a g e

electron transport system, differs between active and persistent infection under different

hormonal conditions.

The genome of C. trachomatis includes genes involved in the glycolysis pathway (pyk and yggv),

as well as genes for an electron transport system (cydA, cydB). Work from the Gerard group

(2002) suggested that throughout active growth, transcripts from genes involved in encoding

glycolytic pathway enzymes in C.trachomatis were expressed. This study also demonstrated that

the chlamydial glycolytic pathway enzymes were functional. This showed that the bacteria can

produce ATP during active infection, in addition to obtaining this resource from its host.

Within HEp-2 and ECC-1 cells, C. trachomatis cells undergo normal EB to RB reorganization,

growth of RB, and normal RB to EB dedifferentiation at the end of the developmental cycle; the

cycle requires ≈50 hrs for completion in these host cell types. C. trachomatis genes encoding

enzymes involved in glycolysis were expressed at 1 and 2 days post-infection, so expression had

stopped after 48 hrs PI, when the characteristics of chlamydial persistence were well established.

Thus, during the early developmental cycle of chlamydial infection, C. trachomatis cells

appeared to undergo the initial portion of the developmental cycle normally, expressing energy

transduction-related genes and primary rRNA transcripts, as in human epithelial cell line

infection. Subsequent to chlamydial persistence formation, gene expression of genes involved in

encoding glycolysis pathway enzymes was down-regulated; however adt1 and primary rRNA

transcripts were produced. This clearly showed that persistent C. trachomatis cells took ATP

from their hosts during persistent infection, as they did not produce enzymes required for ATP

synthesis (Iliffe-Lee and McClarty, 1999, Gerard et al., 2002).

Our results identified hormonal regulation of chlamydial genes encoding pyruvate kinase, pyk

and yggv, which function in glycolysis. The microarray analyses targeting relative primary

chlamydial RNA transcript levels supported this contention, since those transcript levels were

several-fold lower in infected ECC-1 cells in the presence of estradiol than in infected cells with

no hormone supplement (sample grown in charcoal-stripped media). Our data showed significant

down-regulation in gene expression of both genes under supplement with 17β estradiol (3-fold

and 10-fold respectively). This suggested that since the availability of energy resources required

98 | P a g e

to support metabolism may be limited therefore Chlamydia may forced to change to a persistent

form in presence of E2.

C. trachomatis has no glyoxylate cycle, but the genome encodes components for an abridged

TCA cycle and an electron transport system (Kalman et al., 1999). C. trachomatis possess an

electron transport system (McCarty 1999) whose components were produced during active

growth. Both proteins were required for a functional electron transport component, and it was

suggested that this system is necessary during persistence to generate reducing equivalents in the

bacterial cell (Gerard et al., 2002). Chlamydial genes encoding two cytochrome oxidase subunits

which play important role in electron transport, cydA, cydB, are highly expressed during active

infection and absent throughout persistent infection. Our data indicated a minimum of 5 fold

decrease in genes, cydA, cydB, in presence of 17 β estradiol-supplemented. In addition, the trpB

(tryptophan synthase subunit β) gene is currently known as one of most reliable chlamydial

persistence markers. The down-regulation trends reported in this project for this gene under

estradiol supplement were consistent with previous data in the microarray study of IFN-γ-

mediated C. trachomatis serovar D persistence (Belland et al., 2003). Therefore we provided

evidence that mRNA for glycolysis and electron transport pathway-related genes were greatly

decreased during estrogen supplement. This suggested that whilst the primary phase of

chlamydial infection was relatively normal in terms of bacterial transcripts produced and

relatively normal in terms of EB to RB development, some host-parasite interaction initiated

during the developmental cycle infection led to a decrease in bacterial metabolism, possibly

influencing the elicitation of persistence in the presence of estradiol.

99 | P a g e

Table 3.7: Summary table for genes presented in our microarray experiment and involved in chlamydial persistence

Gene Name Function Literature P E2 1 cydA cytochrome d ubiquinol

oxidase I Down-regulation 1

Down-regulation

Down-regulation

2 cydB cytochrome ubiquinol oxidase II

Down-regulation 1

Unchanged Down-regulation

3 pyk pyruvate kinase Down-regulation 1

Unchanged Down-regulation

4 yggV putative deoxyribonucleotide Down-regulation 1

Unchanged Down-regulation

5 dnaK molecular chaperone DnaK Down-regulation 2

Down-regulation

Down-regulation

6 recA recombination protein RecA Down-regulation 3

Up-regulation Down-regulation

7 omcB cysteine-rich outer membrane Down-regulation 4

Unchanged Down-regulation

8 groES Hsp60 Unchanged 5 Unchanged Unchanged 9 trpA tryptophan synthase subunit α Up-regulation 5,6 Unchanged Unchanged 10 trpB tryptophan synthase subunit β Up-regulation 5,6 Unchanged Up-regulation

1: (Gerard et al. 2002), 2: (Jones et al. 2001), 3: (Hintz 1995), 4: (Belland et al. 2003b), 5:

(Hogan et al. 2004) 6: (Morrison 2003).

Collectively these data suggested that hormonal supplementation, estradiol in particular, may

directly or indirectly play an important role in development of chlamydial persistence as eight

well known genes involved in chlamydial persistence showed the same pattern in our microarray

experiment. Finally, it should be mentioned that there were a few more genes that were shown to

be up/down regulated in their gene expression pattern under estradiol supplement but their

function is not yet clear (CT56, CT21, CT31, CT296 and CT274). Similar results were achieved

for progesterone added samples as seven (conserved) hypothetical protein genes were up/down

regulated, such as CT47, CT79, CT181, CT345 and CT733. Our data clearly indicated that the

majority of the altered genes belong to common biochemical or metabolic pathways suggesting

that hormone supplementation affects metabolism more than the structural pathway. Further

investigations are required to study the pathways of these genes and examine their functions

under steroid hormone supplementation.

100 | P a g e

Chapter 4 General Discussion and Conclusions

101 | P a g e

102 | P a g e

4.1 General Discussion and Conclusions The work presented in this thesis investigated chlamydial growth and gene expression under

different hormonal conditions, and has made significant new contributions to the field of

chlamydial persistence. The studies in this project focused on 2 new areas of in vitro chlamydial

infection: firstly, the effect of steroid hormones on host susceptibility and inclusions

morphology; secondly, the effect of hormones on chlamydial gene expression.

The first aim of this project was to determine host susceptibility to chlamydial infection using

confocal microscopy. The focus of this part of the project was to examine the effect of estrogen

and/or progesterone on host susceptibility (by calculating the percentage of cells infected) and

analyse inclusion morphology. The second aim of the project investigated chlamydial gene

expression in the in vitro chlamydial infection model under different hormonal conditions for the

first time. Initial microarray data indicated that there was differential gene expression in C.

trachomatis infections in the presence of female sex hormones. After the establishment of the

second microarray experiment, our data was confirmed for selected genes of interest by using q

RT-PCR, some of which play an important role in chlamydial persistence. These data formed the

basis of the third chapter of this thesis.

Previous in vitro and in vivo studies reported that chlamydial infection may be modulated by

steroid hormones (Pasley et al., 1985a; Rank 1994; Kaushic et al., 1998b). The influence of

exogenously supplied hormones on ECC-1 cells at various time points were compared, and the

results clearly showed that only in cells grown for 1 week in stripped FCS, the levels of

chlamydial infectivity of ECC-1 cells was greater in estrogen-added than in progesterone-added

cells. Our data demonstrated that in cells passaged for 1 week in stripped FCS, the presence of

estradiol increases infectivity (1.7-fold compared to the sample grown in charcoal-stripped

media), while progesterone does not have as great as impact on infectivity (1.2-fold increase

compare to control). However, in cells grown for 26 weeks in stripped FCS both E2 and P

enhanced infectivity (2.1-fold and 1.9-fold increase compared to the control).

103 | P a g e

The results from this study showed that, the duration of hormone supplement had a less

noticeable influence on the infectivity of the epithelial cell line, however chlamydial inclusion

morphology was noticeably different from control cells. ECC-1 cells infected with C.trachomatis

after 48 hrs and 72 hrs of hormone supplement contained larger inclusions than cells conditioned

by 24 hrs pre-treatment with hormones. In all cases, infection was stopped 48 hrs post infection.

This confirmed that C.trachomatis seeded on epithelial cells under extended hormone

supplemented culture conditions have the potential to form large inclusions. In addition,

immunocytochemistry and confocal microscopy of C.trachomatis grown in the presence of

estradiol revealed abnormaly large RBs contained within inclusions compared to the control

acute cultures, which is one of the well known characteristics of chlamydial persistence. This

characteristic was consistent with previous reports of the C. trachomatis morphology during

antibiotics and IFN- γ induced persistence (Beatty et al. 1993; Kramer and Gordon 1971). In

marked contrast, in the presence of a combination of hormones and also progesterone alone,

there were no signs of chlamydial persistence.

Collectively our data indicated the most noticeable effect of hormone supplementation on

epithelial cells chlamydial infectivity was in the presence of estradiol. Therefore, we can

conclude that at the peak of estrogen concentration (proliferative phase) the chance of

chlamydial infection is higher than in other phases. In addition to differences in the levels of

infectivity of epithelial cells with C.trachomatis serovar D, the morphology of chlamydial

inclusions was also affected by hormone supplementation.

The third chapter of this thesis discussed the effect of steroid hormones on bacterial gene

expression. While previous studies have examined the host response, this is the first study to

examine C.trachomatis gene expression under different hormonal conditions. We have

highlighted a basic model of Chlamydia trachomatis gene regulation in the presence of steroid

hormones by identifying 60 genes that were regulated by adding estradiol and/or progesterone.

Generally, our results indicated that three-quarters of the chlamydial genes in our experiments

were observed to be down-regulated in the presence of both estradiol and progesterone. The

majority of the chlamydial genes down-regulated in the presence of steroid hormones belong to

common biochemical enzymes or metabolic pathways suggesting that hormone supplement is

affecting metabolism more than structural pathways. In addition, the third chapter of this thesis

104 | P a g e

discussed and compared the significance of the current findings in the context of data from other

research groups to improve our understanding of the molecular basis of chlamydial persistence

under hormonal conditions. Recently, the availability of chlamydial genome sequences and

chlamydial microarrays enabled us to examine the bacterial gene expression and identify

persistence markers under different hormonal conditions. By combining the data presented in

this thesis with those from other recent investigations in this area, it is now possible to construct

a hypothesis on the effect of steroid hormones on chlamydial persistence.

The hormone-supplemented model of C. trachomatis persistence in the work presented in this

thesis was determined using reliable genetic markers of persistence in this model (omcB, trpB),

and also more general markers of chlamydial persistence (cydA, cydB, pyk, yggV, dnaK and

recA). Gene expression analysis of estradiol-induced persistent C. trachomatis infections using

microarray and q RT-PCR methods revealed selective up- and down-regulation trends for genes

encoding products that were located at specific enzymatic points in glycolysis biosynthesis,

electron transport system, and also RB to EB differentiation pathways.

The microarray study conducted by Belland and colleagues (2003) of IFN-γ-mediated C.

trachomatis serovar D persistence revealed novel persistence gene candidates that have been

used in the current study. The Belland et al. (2003) panel of chlamydial persistence marker genes

was used to validate our in vitro persistence study. This panel can be an important tool for the

validation of persistence, more than morphological analyses (confocal and TEM microscopy),

since the altered morphological and genetic hallmarks of persistent infections are not necessarily

co-temporal.

The omcB and trpB genes are currently the most reliable general markers of chlamydial

persistence. The down-regulation trends reported in this project for these genes under estradiol

supplement were consistent with previous data in the microarray study of IFN-γ-mediated C.

trachomatis serovar D persistence (Belland et al., 2003). As an additional strategy, we attempted

to identify all chlamydial genes involved in ADP/ATP exchange and energy source pathway

reactions in the C.trachomatis genome. This analysis revealed six targets which may be involved

in chlamydial persistence (a) two genes encode glycolysis pathway (pyk, yggV) (b), two genes

105 | P a g e

(cydA, cydB) function in electron transport system, and (c) two genes encode production of

tryptophan syntheses subunits.

Previous data have demonstrated that the metabolic characteristics of persistent chlamydiae were

not the same as those of actively growing organisms (Beatty et al., 1994; Jones et al., 2001). The

results reported from Gerard et al. (2002) indicated that during the primary phase of active

infection, C. trachomatis obtain the energy essential for EB to RB transformation, and also for

metabolism, from host cells via ATP/ADP exchange. Through active growth of the RB, the

organisms acquire ATP not only from the host, but also via their own glycolytic and pentose

phosphate pathways. Gerard et al. (2002) determined that throughout the initial phase of

monocyte infection, prior to the complete establishment of persistence, C.trachomatis cells

utilized both ATP/ADP exchange and their own pathways to support metabolic needs, even

though the overall metabolic rate in the organisms was relatively low. However, when

persistence has been established the only source of ATP seemed to be the host (Gerard et al.,

2002). That is, mRNA for glycolytic and pentose phosphate pathway enzymes were absent or

severely reduced, showing that these systems were partially, if not completely, shut down

through persistence. Therefore, C. trachomatis cells seemed to be merely partial energy parasites

on their hosts during active growth, however during persistent infection the organisms appeared

to be completely dependent on the host for ATP.

Most notably in this project, pyk and yggV were strongly down-regulated (3-fold and 10-fold

respectively) following pre- suppliment with estradiol, which may contribute to a reduction in

the rate of glycolysis biosynthesis during persistence. Two other well known chlamydial

persistence genes (cydA, cydB) which play a part in the electron transport system were also

down-regulated (8-fold and 4-fold respectively) in the presence of estradiol.

It has previously been shown that trpA and trpB are two well known genes involved in

chlamydial persistence (Hogan et al., 2004). Hogan et al. (2004) showed that the expression

patterns of these two selected genes were mostly up-regulated in chlamydial persistence. While

the gene expression of trpB in our experiment indicated a similar pattern with what the literature

suggested for chlamydial persistence, the gene expression of trpA had no change. Moreover, our

data showed regulation of genes predicted to be involved in the regulation of RB-to-EB

differentiation (recA and dnaK).

106 | P a g e

The data from Hogan et al. (2004) combined with Gérard et al. (2002), suggested that two major

hallmarks of persistence were inhibited RB-to-EB differentiation associated with shut down

(down-regulation) of late genes and impaired RB development caused by blockages in key

pathways. In this respect, the gene expression of dnaK and recA from our microarray study were

consistent with the down-regulation seen for these genes in persistence infections in Jones et al.

(2001) and Hintz (1995) studies respectively.

Gérard et al. (2002) provided data for in vitro monocyte-induced C. trachomatis persistence

indicating that some metabolic pathways (such as the EMP and the PPP) were transcriptionally

down-regulated during persistence, whereas others (such as the TCA cycle) remain unchanged.

This was clearly validated by our microarray study of estradiol-added C. trachomatis persistence.

Belland et al. (2003) provided more evidence to support these differential pathway expression

patterns in persistence.

Collectively, in our experiments cydA, cydB, pyk, yggV, dnaK, recA and omcB were down-

regulated in estradiol-added samples at 48 hrs PI, whereas trpB and omp1 were up-regulated

which were consistent with C. trachomatis persistence literature. In addition to the present

project, Hogan et al. (2004) and Gerard et al. (2001) also identified the above mentioned down-

regulated genes as being selectively absent in IFN-γ-mediated C. pneumoniae persistence.

Furthermore, our microarray data revealed down-regulated expression of CT47, CT79, CT181,

CT345 and CT733 in progesterone-added C. trachomatis, of which their function is not clearly

known to us yet. These data may help to explain why infections are more common in the

estrogen-dominant phase of the menstrual cycle and suggest that estradiol favours the

development of persistent infections that may allow Chlamydia to (a) resist common antibiotic

therapy and (b) survive the innate immune response to infection, thereby facilitating repeated

reactivation of infection that drives damaging immunopathology.

The current in vitro persistence study will need to be evaluated in studies of animal infection

models and clinical samples from human disease, to determine the relevance of the panel to in

vivo disease.

107 | P a g e

The important results from this investigation can be applied to future research into gene

regulation in Chlamydia. This will lead to a better understanding of chlamydial development and

pathogenic mechanisms of this unique disease causing bacteria. An enhanced understanding of

the bacterial and host genetic factors that specifically influence the initiation, duration, and

reactivation of persistent chlamydial infections under hormonal conditions is likely to lead to the

development of novel strategies for the prevention and control of chlamydial disease.

The final outcome and application of this study could be in the development of an RNA-based

disease-specific diagnostic test to differentiate acute from persistent infections. Gérard and

colleagues (2001) have already shown the feasibility of PCR methods for such applications by

demonstrating in vitro differential expression profiles for the fts genes and certain metabolic

genes ( cydA, cydB ) (Gérard et al., 2002) as reliable persistence markers. In addition to

developing a group of genes for diagnostic purposes, a better understanding of the mechanisms

underlying differential persistence gene expression profiles under hormonal conditions will be

required for further applications such as the development of vaccines or novel drugs that

exclusively target persistent chlamydiae.

108 | P a g e

Chapter 5 References Cited

109 | P a g e

110 | P a g e

5.1 References Cited Abdelrahman, Y. M. and R. J. Belland. 2005. The chlamydial developmental cycle. FEMS Microbiology Reviews 29 (5):949-59.

Acron, D. C., J.W. Findling, J.B Tyrrell. 2001. Hypothalamus and Pituitary. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G., 100-162. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.

Australian Bureau of Statistics (ABS). 2005. 1301.0 - Year Book Australia - Health: Communicable Diseases. http://www.abs.gov.au/Ausstats/abs@.nsf/0/096BF52E2838BDFFCA256F7200832FC9?Open (accessed 29th March).

Australian Bureau of Statistics (ABS). 2006. 1301.0 - Year Book Australia, Chapter 9 - Health: Communicable Diseases. http://www.abs.gov.au/Ausstats/abs@.nsf/Latestproducts/9155D0B9F4203474CA2570DE000D975D?opendocument (accessed 29th March).

Baeten, J. M., P. M. Nyange, B. A. Richardson, L. Lavreys, B. Chohan, H. L. Martin, Jr., K. Mandaliya, J. O. Ndinya-Achola, J. J. Bwayo and J. K. Kreiss. 2001b. Hormonal contraception and risk of sexually transmitted disease acquisition: results from a prospective study. American Journal of Obstetrics and Gynecology 185 (2):380-5.

Bates, G. W. and W. R. Boone. 1991. The female reproductive cycle: new variations on an old theme. Current Opinion in Obstetrics and Gynecology 3 (6):838-43.

Bavoil, P. M., R. Hsia, D. M. Ojcius. 2000. Closing in on Chlamydia and its intracellular bag of tricks. Microbiology 146 (Pt 11):2723-31.

Baxter, J. D. and R.C.J. Ribeiro. 2001. Introduction to Endocrinology. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G., 1-37. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.

Beagley, K. W. and P. Timms. 2000. Chlamydia trachomatis infection: incidence, health costs and prospects for vaccine development. Journal of Reproductive Immunology 48 (1):47-68.

Beatty, W. L., G. I. Byrne and R. P. Morrison. 1993. Morphologic and antigenic characterization of interferon gamma-mediated persistent Chlamydia trachomatis infection in vitro. Proceedings of the National Academy of Sciences of the United States of America 90 (9):3998-4002.

Beatty, W. L., R. P. Morrison and G. I. Byrne. 1994. Persistent chlamydiae: from cell culture to a paradigm for chlamydial pathogenesis. Microbiological Reviews 58 (4):686-99.

Belland, R. J., G. Zhong, D. D. Crane, D. Hogan, D. Sturdevant, J. Sharma, W. L. Beatty and H. D. Caldwell. 2003. Genomic transcriptional profiling of the developmental cycle of Chlamydia

111 | P a g e

trachomatis. Proceedings of the National Academy of Sciences of the United States of America 100 (14):8478-83.

Bengtsson, A. K., E. J. Ryan, D. Giordano, D. M. Magaletti and E. A. Clark. 2004. 17beta-estradiol (E2) modulates cytokine and chemokine expression in human monocyte-derived dendritic cells. Blood 104 (5):1404-10.

Bentley, P. J. 2001. Sex Hormones in Vertebrates. In Encyclopaedia of Life Sciences. London: Nature Publishing Group.

Berry, L. J., D. K. Hickey, K. A. Skelding, S. Bao, A. M. Rendina, P. M. Hansbro, C. M. Gockel and K. W. Beagley. 2004. Transcutaneous Immunization with Combined Cholera Toxin and CpG Adjuvant Protects against Chlamydia muridarum Genital Tract Infection. Infect Immun 72 (2):1019-1028.

Bessho, H., S. Arita, K. Yamane and Y. Hori. 2001. A simple titration method for determining Chlamydia infectivity using an image analyzing system. Journal of Microbiological Methods 45 (1):21-9.

Birkelund, S., B. Larsen, A. Holm, A. G. Lundemose and G. Christiansen. 1994. Characterization of a linear epitope on Chlamydia trachomatis serovar L2 DnaK-like protein. Infection and Immunity 62 (5):2051-7.

Birkelund, S., P. Mygind, A. Holm, B. Larsen, F. Beck and G. Christiansen. 1996. Characterization of two conformational epitopes of the Chlamydia trachomatis serovar L2 DnaK immunogen. Infection and Immunity 64 (3):810-7.

Bose, S. K. and P. C. Goswami. 1986. Host modification of the adherence properties of Chlamydia trachomatis. Journal of General Microbiology 132 (6):1631-9.

Bouman, A., M. J. Heineman and M. M. Faas. 2005. Sex hormones and the immune response in humans. Human Reproduction Update 11 (4):411-23.

Brunham, R. C. 1999. Human Immunity to Chlamydiae. In Chlamydia intracellular Biology, Parthenogenesis and Immunity ed. R. S. stephens, 211-238. US.

Brunham, R. C. 2005. Parran Award Lecture: insights into the epidemiology of sexually transmitted diseases from Ro betacD. Sexually Transmitted Diseases 32 (12):722-4.

Brunham, R. C. and J. Rey-Ladino. 2005. Immunology of Chlamydia infection: implications for a Chlamydia trachomatis vaccine. Nature Reviews. Immunology 5 (2):149-61.

Budai, I. 2007. Chlamydia trachomatis: milestones in clinical and microbiological diagnostics in the last hundred years: a review. Acta Microbiologica et Immunologica Hungarica 54 (1):5-22.

Bushell, A. C. and D. Hobson. 1978. Effect of cortisol on the growth of Chlamydia trachomatis in McCoy cells. Infection and Immunity 21 (3):946-53.

112 | P a g e

Carlson, J. H., S. F. Porcella, G. McClarty and H. D. Caldwell. 2005. Comparative genomic analysis of Chlamydia trachomatis oculotropic and genitotropic strains. Infection and Immunity 73 (10):6407-18.

Carr, B. R., J.E. Griffin. 1998. Reproduction: Fertility Control and Its Complications. In Willams Textbook of Endocrinology, ed. J. D. Wilson, Foster, D.W., Kronenberg, H.M., Larsen, P.R., 901-925. Philadelphia: W.B. Saunders.

Cevenini, R., M. Donati and V. Sambri. 2002. Chlamydia trachomatis - the agent. Best Practice and Research. Clinical Obstetrics and Gynaecology 16 (6):761-73.

Cohen, B. J. and J.J. Taylor. 2005. Perpetuation of Life: The Male and Female Reproductive Systems. In Memmler's The Human Body in Health and Disease, 455-476. Philadelphia: Lippincott Williams and Wilkins.

Cooke, P. S., F.D.A. Uchima, D.K. Fujii, H.A. Bern, G.R. Cuhna. 1986. Restoration of Normal Morphology and Estrogen Responsiveness in Cultured Vaginal and Uterine Epithelia Transplanted with Stroma. Cell Biology 83:2109-2113.

Dautry-Varsat, A., A. Subtil and T. Hackstadt. 2005. Recent insights into the mechanisms of Chlamydia entry. Cellular Microbiology 7 (12):1714-22.

Dautry-Varsat, A., M. E. Balana and B. Wyplosz. 2004. Chlamydia-host cell interactions: recent advances on bacterial entry and intracellular development. Traffic 5 (8):561-70.

Davis, C. H., J. E. Raulston and P. B. Wyrick. 2002. Protein disulfide isomerase, a component of the estrogen receptor complex, is associated with Chlamydia trachomatis serovar E attached to human endometrial epithelial cells. Infection and Immunity 70 (7):3413-8.

Debattista, J., P. Timms, J. Allan, 2003. Immunopathogenesis of Chlamydia trachomatis Infections in Women. Fertility & Sterility 79 (6):1273-1287.

Dötsch, J., H. G. Dörr and L. Wildt. 2001. Exposure to Endogenous Estrogens During Lifetime. In The Handbook of Environmental Chemistry, ed. Manfred Metzler, 82-99.

Ennis, D. G., R. Woodgate and M. Shi. 2000. Selective inhibition of RecA functions by the Hc1 nucleoid condensation protein from Chlamydia trachomatis. FEMS Microbiology Letters 182 (2):279-83.

Eriksson, M., S.K. Meadows, C.R. Wira, C.L. Sentman. 2004. Unique Phenotype of Human Uterine NK Cells and Their Regulation by Endogenous TGF-b. Journal of Leukocyte Biology 76:667-675.

Everett, K. D. E. 2002. Chlamydiae. In Encyclopaedia of Life Sciences, 296-305. London: Macmillan Publishers/Nature Publishing Group.

113 | P a g e

Everett, K. D., R. M. Bush and A. A. Andersen. 1999. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. International Journal of Systematic Bacteriology 49 Pt 2:415-40.

Fahey, J. V. and C. R. Wira. 2002. Effect of menstrual status on antibacterial activity and secretory leukocyte protease inhibitor production by human uterine epithelial cells in culture. Journal of Infectious Diseases 185 (11):1606-13.

Fahey, J. V., R.M. Rossoll, C.R. Wira. 2005. Sex Hormone Regulation of Anti-Bacterial Activity in Rat Uterine Secretions and Apical Release of Anti-Bacterial Factor(s) by Uterine Epithelial Cells in Culture. Steroid Biochemistry and Molecular Biology 93:59-66.

Filicori, M., G.E. Cognigni, P. Pocognoli, W. Ciampaglia, S. Bernardi. 2003. Current Concepts and Novel Applications of LH Activity in Ovarian Stimulation. Trends in Endocrinology and Metabolism 14 (6):267-273.

Fortenberry, J. D., E. J. Brizendine, B. P. Katz, K. K. Wools, M. J. Blythe and D. P. Orr. 1999. Subsequent sexually transmitted infections among adolescent women with genital infection due to Chlamydia trachomatis, Neisseria gonorrhoeae, or Trichomonas vaginalis. Sexually Transmitted Diseases 26 (1):26-32.

Gallichan, W. S. and Rosenthal, K. L. 1996. Effects of the estrous cycle on local humoral immune responses and protection of intranasally immunized female mice against herpes simplex virus type 2 infection in the genital tract. Virology 224 (2):487-97.

Gambhir, M., M. G. Basanez, F. Turner, J. Kumaresan and N. C. Grassly. 2007. Trachoma: transmission, infection, and control. Lancet Infectious Diseases 7 (6):420-7.

Gardner, D. G. 2001. Mechanisms of Hormone Action. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G.,, 59-79. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.

Gerard, H. C., B. Krausse-Opatz, Z. Wang, D. Rudy, J. P. Rao, H. Zeidler, H. R. Schumacher, J. A. Whittum-Hudson, L. Kohler and A. P. Hudson. 2001. Expression of Chlamydia trachomatis genes encoding products required for DNA synthesis and cell division during active versus persistent infection. Molecular Microbiology 41 (3):731-41.

Gerard, H. C., J. Freise, Z. Wang, G. Roberts, D. Rudy, B. Krauss-Opatz, L. Kohler, H. Zeidler, H. R. Schumacher, J. A. Whittum-Hudson. 2002. Chlamydia trachomatis genes whose products are related to energy metabolism are expressed differentially in active vs. persistent infection. Microbes and Infection 4 (1):13-22.

114 | P a g e

Gerard, H. C., P. J. Branigan, G. R. Balsara, C. Heath, S. S. Minassian and A. P. Hudson. 1998. Viability of Chlamydia trachomatis in fallopian tubes of patients with ectopic pregnancy. Fertility and Sterility 70 (5):945-8.

Ghanem, K. G., N. Shah, R. S. Klein, K. H. Mayer, J. D. Sobel, D. L. Warren, D. J. Jamieson, A. C. Duerr and A. M. Rompalo. 2005. Influence of sex hormones, HIV status, and concomitant sexually transmitted infection on cervicovaginal inflammation. Journal of Infectious Diseases 191 (3):358-66.

Gillgrass, A. E., S. A. Fernandez, K. L. Rosenthal and C. Kaushic. 2005. Estradiol regulates susceptibility following primary exposure to genital herpes simplex virus type 2, while progesterone induces inflammation. Journal of Virology 79 (5):3107-16.

Gillgrass, A. E., V. A. Tang, K. M. Towarnicki, K. L. Rosenthal and C. Kaushic. 2005. Protection against genital herpes infection in mice immunized under different hormonal conditions correlates with induction of vagina-associated lymphoid tissue. Journal of Virology 79 (5):3117-26.

Glasser, S. R., J. Julian, G.L. Decker, J.P. Tang, D.D. Carson. 1988. Development of Morphological and Functional Polarity in Primary Cultures of Immature Rat Uterine Epithelial Cells. The Journal of Cellular Biology 107:2409-2423.

Goldfien, A. 2001. Ovaries. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G., 453-508. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.

Grant, K. S. and C.R. Wira. 2003. Effect of Mouse Uterine Stromal Cells on Epithelial Cell Transepithelial Resistance (TER) and TNF and TGF Release in Culture. Biology of Reproduction 69:1091-1098.

Grant-Tschudy, K. S., C.R. Wira. 2004. Effect of Estradiol on Mouse Uterine Epithelial Cell Transepithelial Resistance (TER). American Journal of Reproductive Immunology (AJRI) 52:252-262.

Greco, T. L., T. M. Duello and J. Gorski. 1993. Estrogen receptors, estradiol, and diethylstilbestrol in early development: the mouse as a model for the study of estrogen receptors and estrogen sensitivity in embryonic development of male and female reproductive tracts. Endocrine Reviews 14 (1):59-71.

Greub, G. and D. Raoult. 2002. Parachlamydiaceae: potential emerging pathogens. Emerging Infectious Diseases 8 (6):625-30.

Guseva, N. V., S.C. Dessus-Babus, J.D. Whittimore, C.G. Moore, P.B. Wyrick. 2005. Characterisation of Estrogen-Responsive Epithelial Cell Lines and their Infectivity by Genital Chlamydia trachomatis. Microbes and Infection 7 (15):1469-1481.

115 | P a g e

Guseva, N. V., S. C. Dessus-Babus, J. D. Whittimore, C. G. Moore and P. B. Wyrick. 2005. Characterization of estrogen-responsive epithelial cell lines and their infectivity by genital Chlamydia trachomatis. Microbes and Infection 7 (15):1469-81.

Guseva, N. V., S. T. Knight, J. D. Whittimore and P. B. Wyrick. 2003. Primary cultures of female swine genital epithelial cells in vitro: a new approach for the study of hormonal modulation of Chlamydia infection. Infection and Immunity 71 (8):4700-10.

Han, G., T. Magee, O. Khorram, 2005. Regulation of Nitric Oxide Synthase Isoforms by Estrogen in the Human Endometrium. Fertility and Sterility 84 (S2):1220-1227.

Harper, A., C. I. Pogson, M. L. Jones and J. H. Pearce. 2000. Chlamydial development is adversely affected by minor changes in amino acid supply, blood plasma amino acid levels, and glucose deprivation. Infection and Immunity 68 (3):1457-64.

Hintz, N. J., D. G. Ennis, W. F. Liu and S. H. Larsen. 1995. The recA gene of Chlamydia trachomatis: cloning, sequence, and characterization in Escherichia coli. FEMS Microbiology Letters 127 (3):175-80.

Hogan, R. J., S. A. Mathews, A. Kutlin, M. R. Hammerschlag and P. Timms. 2003. Differential expression of genes encoding membrane proteins between acute and continuous Chlamydia pneumoniae infections. Microb Pathog 34 (1):11-6.

Hogan, R. J., S. A. Mathews, S. Mukhopadhyay, J. T. Summersgill and P. Timms. 2004. Chlamydial persistence: beyond the biphasic paradigm. Infection and Immunity 72 (4):1843-55.

Hooton, T. M., C. Winter, F. Tiu and W. E. Stamm. 1996. Association of acute cystitis with the stage of the menstrual cycle in young women. Clinical Infectious Diseases 23 (3):635-6.

Horn, M., A. Collingro, S. Schmitz-Esser, C. L. Beier, U. Purkhold, B. Fartmann, P. Brandt, G. J. Nyakatura, M. Droege, D. Frishman. 2004. Illuminating the evolutionary history of chlamydiae. Science 304 (5671):728-30.

Hybiske, K. and R. S. Stephens. 2007. Mechanisms of Chlamydia trachomatis Entry into Nonphagocytic Cells. Infection and Immunity 75 (8):3925-34.

Iliffe-Lee, E. R. and G. McClarty. 1999. Glucose metabolism in Chlamydia trachomatis: the 'energy parasite' hypothesis revisited. Molecular Microbiology 33 (1):177-87.

Inaba, T., W. Wiest, R.C. Strickler, J. Mori. 1988. Augmentation of the Response of Mouse Uterine Epithelial Cells to Estradiol by Uterine Stroma. Endocrinology 122:1253-1258.

Ito, I., T. Hayashi, K. Yamada, M. Kuzuya, M. Naito, A. Iguchi. 1995. Physiological Conbcentration of Estradiol Inhibits Polymorphonuclear Leukocyte Chemotaxis via a Receptor Mediated System. Life Sciences 56 (25):2247-2253.

116 | P a g e

Jones, M. L., J. S. Gaston and J. H. Pearce. 2001. Induction of abnormal Chlamydia trachomatis by exposure to interferon-gamma or amino acid deprivation and comparative antigenic analysis. Microbial Pathogenesis 30 (5):299-309.

Kalman, S., W. Mitchell, R. Marathe, C. Lammel, J. Fan, R. W. Hyman, L. Olinger, J. Grimwood, R. W. Davis and R. S. Stephens. 1999. Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nature Genetics 21 (4):385-9.

Kaushic, C., A.A. Ashkar, L.A. Reid, K.L. Rosenthal. 2003. Progesterone Increases Susceptibility and Decreases Immune Responses to Genital Herpes Infection. Journal of Virology 77 (8):4558-4565.

Kaushic, C., E. Frauendorf, C.R. Wira. 1997. Polymeric Immunolglobulin A Receptor in the Rodent Femal Reproductive Tract: Influence of Estradiol in the Vagina and Differential Expression of Messenger Ribonucleic Acid During Estrous Cycle. Biology of Reproduction 57:958-966.

Kaushic, C., K. Grant, M. Crane, C.R. Wira. 2000a. Infection of Polarized Primary Epithelial Cells from Rat Uterus with Chlamydia trachomatis: Cell–Cell Interaction and Cytokine Secretion. American Journal of Reproductive Immunology 44:73–79.

Kaushic, C., A.D. Murdin, B.J. Underdown, C.R. Wira. 1998. Chlamydia trachomatis Infection in the Female Reproductive Tract of the Rat: Influence of Progesterone on Infectivity and Immune Response. Infection and Immunity 66 (3):893–898.

Kaushic, C., F. Zhou, A.D. Murdin, C.R. Wira. 2000b. Effects of Estradiol and Progesterone on Susceptibility and Early Immune Responses to Chlamydia trachomatis Infection in the Female Reproductive Tract. Infection and Immunity 68 (7):4207-4216.

Katzenellenbogen, B. S. 2000. Mechanisms of action and cross-talk between estrogen receptor and progesterone receptor pathways. Journal of the Society for Gynecologic Investigation 7 (1 Suppl):S33-7.

Kearns, M. and P.K., Lala. 1983. Life History of Decidual Cells: a Review. American Journal of Reproductive Immunology 3:78-82.

Kelly, K. A. 2003. Cellular Immunity and Chlamydia Genital Infection: Induction, Recruitment, and Effector Mechanisms. International Reviews of Immunology 23:3-41.

Kita, E., H. Matsuura and S. Kashiba. 1981. A mouse model for the study of gonococcal genital infection. Journal of Infectious Diseases 143 (1):67-70.

Kliman, H. J. 2000. Uteroplacental Blood Flow: The Story of Decidualisation, Menstruation, and Trophoblast Invasion. American Journal of Pathology 157 (6):1759-1768.

117 | P a g e

Koehler, L., E. Nettelnbreker, A. P. Hudson, N. Ott, H. C. Gerard, P. J. Branigan, H. R. Schumacher, W. Drommer and H. Zeidler. 1997. Ultrastructural and molecular analyses of the persistence of Chlamydia trachomatis (serovar K) in human monocytes. Microbial Pathogenesis 22 (3):133-42.

Korenman, S. G. 1998. Reproduction: Sexual Function and Dysfunction. In Williams Textbook of Endocrinology, ed. J. D. Wilson, Foster, D.W., Kronenberg, H.M., Larsen, P.R., 927-938. Philadelphia: W.B. Saunders.

Kramer, M. J. and F. B. Gordon. 1971. Ultrastructural Analysis of the Effects of Penicillin and Chlortetracycline on the Development of a Genital Tract Chlamydia. Infection and Immunity 3 (2):333-341.

Larsen, B., S. Birkelund, C. H. Mordhorst, L. Ejstrup, L. S. Andersen and G. Christiansen. 1994. The humoral immune response to Chlamydia trachomatis in patients with acute reactive arthritis. British Journal of Rheumatology 33 (6):534-40.

Lavreys, L., V. Chohan, J. Overbaugh, W. Hassan, R. S. McClelland, J. Kreiss, K. Mandaliya, J. Ndinya-Achola and J. M. Baeten. 2004. Hormonal contraception and risk of cervical infections among HIV-1-seropositive Kenyan women. AIDS 18 (16):2179-84.

Lessey, B. A. 2003. Two Pathways of Progesterone Action in the Human Endometrium: Implications for Implantation and Contraception. Steroids 68:809-815.

Mahfoudi, A., M. Nicollier, L. Beck, A. Mularoni, B. Cypriani, S. Fauconet. 1994. Effect of Progesterone on Proteins Vectorially Secreted by Glandular Epithelail Cells of Guinea-Pig Endometrium: Modulation by Homologous Stroma. Journal of Reproduction and Fertility 100:637-644.

Martini, F. H. 2001a. The Endocrine System. In Fundamentals of Anatomy and Physiology 5th Edition, 576-622. New Jersey: Prentice Hall.

Martini, F. H. 2001b. The Reproductive System. In Fundamentals of Anatomy and Physiology 5th Edition, 1016-1063. New Jersey: Prentice Hall.

Martini, F. H. 2001c. The Tissue Level of Organisation. In Fundamentals of Anatomy and Physiology 5th Edition, 106-142. New Jersey: Prentice Hall.

Marx, P. A., A. I. Spira, A. Gettie, P. J. Dailey, R. S. Veazey, A. A. Lackner, C. J. Mahoney, C. J. Miller, L. E. Claypool, D. D. Ho. 1996. Progesterone implants enhance SIV vaginal transmission and early virus load. Nature Medicine 2 (10):1084-9.

Maslow, A. S., C. H. Davis, J. Choong and P. B. Wyrick. 1988. Estrogen enhances attachment of Chlamydia trachomatis to human endometrial epithelial cells in vitro. American Journal of Obstetrics and Gynecology 159 (4):1006-14.

118 | P a g e

Menon, S., M. D. Sammel, M. Vichnin and K. T. Barnhart. 2007. Risk factors for ectopic pregnancy: a comparison between adults and adolescent women. Journal of Pediatric and Adolescent Gynecology 20 (3):181-5.

Metzler, M. and E. Pfeiffer. 2001. Chemistry of Natural and Anthropogenic Endocrine Active Compounds. In The Handbook of Environmental Chemistry, ed. Manfred Metzler, 63-80: Springer Berlin / Heidelberg.

Montes, M. B., A. C. Ferreira, J. C. Fenolio, S. A. Franceschini and M. R. Toloi. 2000. Effects of oral contraceptives in vaginal cytology. Pathologica 92 (3):185-8.

Morrison, R. P. 2003. New insights into a persistent problem - chlamydial infections. Journal of Clinical Investigation 111 (11):1647-9.

Moulder, J. W. 1991. Interaction of chlamydiae and host cells in vitro. Microbiological Reviews 55 (1):143-90.

Mpiga, P. and M. Ravaoarinoro. 2006. Effects of sustained antibiotic bactericidal suppliment on Chlamydia trachomatis infected epithelial-like cells (HeLa) and monocyte-like cells (THP-1 and U-937). International Journal of Antimicrobial Agents 27 (4):316-24.

Nanagara, R., F. Li, A. Beutler, A. Hudson and H. R. Schumacher. 1995. Alteration of Chlamydia trachomatis biologic behavior in synovial membranes. Suppression of surface antigen production in reactive arthritis and Reiter's syndrome. Arthritis and Rheumatism 38 (10):1410-7.

Nelson, H. D. and M. Helfand. 2001. Screening for chlamydial infection. American Journal of Preventive Medicine 20 (3 Suppl):95-107.

O'Connor, K. A., D.J. Holman, J.W. Wood. 2001. Menstrual Cycle Variability and the Perimenopause. American Journal of Human Biology 13:465-478.

Paavonen, J. and W. Eggert-Kruse. 1999. Chlamydia trachomatis: impact on human reproduction. Human Reproduction Update 5 (5):433-47.

Parr, M. B., L. Kepple, M. R. McDermott, M. D. Drew, J. J. Bozzola and E. L. Parr. 1994. A mouse model for studies of mucosal immunity to vaginal infection by herpes simplex virus type 2. Laboratory Investigation 70 (3):369-80.

Pasley, J. N., R. G. Rank, A. J. Hough, Jr., C. Cohen and A. L. Barron. 1985a. Absence of progesterone effects on chlamydial genital infection in female guinea pigs. Sexually Transmitted Diseases 12 (3):155-8.

Pasley, J. N., R. G. Rank, A. J. Hough, Jr., C. Cohen and A. L. Barron. 1985b. Effects of various doses of estradiol on chlamydial genital infection in ovariectomized guinea pigs. Sexually Transmitted Diseases 12 (1):8-13.

119 | P a g e

Patton, D. L., S.S. Thwin, A. Meier, T.M. Hooton, A.E. Stapleton, D.A., Eschenbach. 2000. Epithelial Cell Layer Thickness and Immune Cell Populations in the Normal Human Vagina at Different Stages of the Menstrual Cycle. American Journal of Obstetrics and Gynecology 183:967-973.

Pierro, E., F. Minici, O. Alesiani, F. Miceli, C. Proto, I. Screpanti, S. Mancuso, A. Lanzone. 2001. Stromal-Epithelial Interactions Modulate Estrogen Responsiveness in Normal Human Endometrium. Biology of Reproduction 64:831-838.

Prabhala, R. H., C.R. Wira. 1995. Sex Hormone and IL-6 Regulation of Antigen Presentation in the Female Reproductive Tract Mucosal Tissues. The Journal of Immunology 155:5566-5573.

Quayle, A. J. 2002. The Innate and Early Immune Response to Pathogen Challenge in the Female Reproductive Tract and the Pivitol Role of Epithelial Cells. Journal of Reproductive Immunology 57:61-79.

Rank, R. G. 1994. Animal models for urogenital infections. Methods in Enzymology 235:83-93.

Rank, R. G. and A. L. Barron. 1987. Specific effect of estradiol on the genital mucosal antibody response in chlamydial ocular and genital infections. Infection and Immunity 55 (9):2317-9.

Rank, R. G., H. J. White, A. J. Hough, Jr., J. N. Pasley and A. L. Barron. 1982. Effect of estradiol on chlamydial genital infection of female guinea pigs. Infection & Immunity 38 (2):699-705.

Rank, R. G., M. M. Sanders and A. T. Kidd. 1993. Influence of the estrous cycle on the development of upper genital tract pathology as a result of chlamydial infection in the guinea pig model of pelvic inflammatory disease. American Journal of Pathology 142 (4):1291-6.

Richardson, J. M., C. Kaushic, C.R. Wira. 1995. Polymeric Immunoglobulin (Ig) Receptor Production and IgA Transcytosis in Polarised Primary Cultures of Mature Rat Uterine Epithelial Cells. Biology of Reproduction 53:488-498.

Robertson, S. A., V.J. Mau, S.N. Hudson, K.P. Tremellen. 1997. Cytokine-Leukocyte Networks and the Establishment of Pregnancy. American Journal of Reproductive Immunology 37:438-442.

Rolle, C. J., C. Y. Wai, R. Bawdon, R. Santos-Ramos and B. Hoffman. 2006. Unilateral twin ectopic pregnancy in a patient with a history of multiple sexually transmitted infections. Infectious Diseases in Obstetrics and Gynecology 14 (3):10306.

Rubin, G. L., H. W. Ory and P. M. Layde. 1982. Oral contraceptives and pelvic inflammatory disease. American Journal of Obstetrics and Gynecology 144 (6):630-5.

Schmidt, M., Renner, C. Löffler. 1998. Progesterone Inhibits Glucocorticoid-Dependent Aromatase Induction in Human Adipose Tissue. Journal of Endocrinology 158:401-407.

120 | P a g e

Seals, R. C., M.C. Wulster-Radcliffe, G.S. Lewis. 2003. Uterine Response to Infectious Bacteria in Estrous Cyclic Ewes. American Journal of Reproductive Immunology 49:269-278.

Sentman, C. L., S.K. Meadows, C.R. Wira, M. Eriksson. 2004. Recruitment of Uterine NK Cells: Induction of CXC Chemokine Ligands 10 and 11 in Human Endometrium by Estradiol and Progesterone. The Journal of Immunology 173:6760-6766.

Shahmanesh, M., M. Brunst, A. Sukthankar, J. H. Pearce and J. S. Gaston. 1999. Peripheral blood T cell proliferative response to chlamydial organisms in gonococcal and non-gonococcal urethritis and presumed pelvic inflammatory disease. Sexually Transmitted Infections 75 (5):327-31.

Shew, M. L., R. McGlennen, N.,Zaidi, M. Westerheim, M. Ireland, and , S. Anderson. 2002. Oestrogen receptor transcripts associated with cervical human papillomavirus infection. Sexually Transmitted Infections 78 (3):210-4. Shlomit, L. and H.Margalit. 1993. Compilation of E. coli mRNA promoter sequences. Nucleic Acids Res. 21, 1507-1516. Skelding, K. A., D.K. Hickey, J.C. Horvat, S. Bao, K.G. Roberts, J.M. Finnie, P.M. Hansbro, K.W. Beagley. 2006. Comparison of Intranasal and Transcutaneous Immunisation for the Induction of Protective Immunity Against Chlamydia muridarum Respiratory Tract Infection. Vaccine 24 (3):355-366.

Slepenkin, A., V. Motin, L. M. de la Maza and E. M. Peterson. 2003. Temporal expression of type III secretion genes of Chlamydia pneumoniae. Infection and Immunity 71 (5):2555-62.

Smith, S. M., G. B. Baskin and P. A. Marx. 2000. Estrogen protects against vaginal transmission of simian immunodeficiency virus. Journal of Infectious Diseases 182 (3):708-15.

Sonnex, C. 1998. Influence of ovarian hormones on urogenital infection. Sexually Transmitted Infections 74 (1):11-9.

Stephens, R. S., E. A. Wagar and U. Edman. 1988. Developmental regulation of tandem promoters for the major outer membrane protein gene of Chlamydia trachomatis. Journal of Bacteriology 170 (2):744-50.

Stephens, R. S., S. Kalman, C. Lammel, J. Fan, R. Marathe, L. Aravind, W. Mitchell, L. Olinger, R. L. Tatusov, Q. Zhao. 1998. Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis. Science 282 (5389):754-9.

Stern, J. E., S. Gardner, D. Quirk, C.R. Wira. 1992. Secretory Immune System of the Male Reproductive Tract: Effects of Dihydrotestosterone and Estradiol on IgA and Secretory Component Levels. Journal of Reproductive Immunology 22:73-85.

121 | P a g e

Stern, J. E., C.R. Wira. 1985. The Secretory Immune System in the Uterus of the Pregnant Rat: Production of Secretory Component by Uterine Tissues. Journal of Reproductive Immunology 7:77-87.

Stern, J. E., C.R. Wira. 1988. Progesterone Regulation of Secretory Component (SC): Uterine SC Response in Organ Culture Following In Vivo Hormone Treatmen. Journal of Steroid Biochemistry 30 (1-6):233-237.

Storz J. and L.A. Page. 1971. Taxonomy of the Chlamydiae: reasons for classifying organisms of the genus Chlamydia, family Chlamydiaceae, in a separate order, Chlamydiales ord. nov. International Journal of Systematic Bacteriology 21: 332-334.

Su, H. and H. D. Caldwell. 1998. Sulfated polysaccharides and a synthetic sulfated polymer are potent inhibitors of Chlamydia trachomatis infectivity in vitro but lack protective efficacy in an in vivo murine model of chlamydial genital tract infection. Infection and Immunity 66 (3):1258-60.

Sugarman, B. and P. Agbor. 1986. Estrogens and Chlamydia trachomatis. Proceedings of the Society for Experimental Biology and Medicine 183 (1):125-31.

Sullivan, D. A., G.S. Richardson, D.T. MacLaughlin, C.R. Wira. 1984a. Variations in the Levels of Secretory Component in Human Uterine Fluid During the Menstrual Cycle. Journal of Steroid Biochemistry 20 (1):509-513.

Sullivan, D. A., C.R. Wira. 1981. Estradiol Regulation of Secretory Component in the Female Reproductive Tract. Journal of Steroid Biochemistry 15:439-444.

Sullivan, D. A., C.R. Wira. 1984b. Hormonal Regulation of Immunoglobulins in the Rat Uterus: Uterine Response to Multiple Estradiol Treatments. Endocrinology 114:650-658.

Sweet, R. L., D. V. Landers, C. Walker and J. Schachter. 1987. Chlamydia trachomatis infection and pregnancy outcome. American Journal of Obstetrics and Gynecology 156 (4):824-33.

Sweet, R. L., M. Blankfort-Doyle, M. O. Robbie and J. Schacter. 1986. The occurrence of chlamydial and gonococcal salpingitis during the menstrual cycle. Journal of the American Medical Association 255 (15):2062-4.

Sydney IVF. 2006. Reproduction in Women: Conceptions and Misconceptions. In Sydney IVF's Guide to Assisted Conception, 4.

Tait, A. S., C. L. Butts, and E. M Sternberg. 2008. The role of glucocorticoids and progestins in inflammatory, autoimmune, and infectious disease. Journal of Leukocyte Biology 84 (4):924-31.

Thejls, H., J. Gnarpe, O. Lundkvist, G. Heimer, G. Larsson and A. Victor. 1991. Diagnosis and prevalence of persistent chlamydia infection in infertile women: tissue culture, direct antigen

122 | P a g e

detection, and serology. Fertility and Sterility 55 (2):304-10.

Tsai, M.-J., J.H. Clark, W.T. Schrader, B.W. O'Malley. 1998. Hormones and Hormone Action: Mechanisms of Action of Hormones that Act as Transcription-Regulatory Factors. In Williams Textbook of Endocrinology, ed. J. D. Wilson, Foster, D.W., Kronenberg, H.M., Larsen, P.R., 55-94. Philadelphia: W.B.Saunders.

Tsavachidou, D., M.N. Liebman. 2002. Modeling and Simulation of Pathways in Menopause. Journal of the American Medical Informatics Association 9 (5):461-471.

Wallace, P. K., G.R. Yeaman, K. Johnson, J.E. Collins, P.M. Guyre, C.R. Wira. 2001. MHC Class II Expression and Antigen Presentation by Human Endometrial Cells. Journal of Steroid Biochemistry and Molecular Biology 76:203-211.

Walker, N. J. 2002. A technique whose time has come. Science 296 (5567):557-9. Wang, S. P. and J. T. Grayston. 1991. Serotyping of Chlamydia trachomatis by indirect fluorescent-antibody staining of inclusions in cell culture with monoclonal antibodies. Journal of Clinical Microbiology 29 (7):1295-8.

Washington, A. E., S. Gove, J. Schachter and R. L. Sweet. 1985. Oral contraceptives, Chlamydia trachomatis infection, and pelvic inflammatory disease. A word of caution about protection. Journal of the American Medical Association 253 (15):2246-50.

White, H. D., K.M. Crassi, A.L. Givan, J.E. Stern, J.L. Gonzalez, V.A. Memoli, W. Green, C.R. Wira.1997. CD3+ CD8+ CTL Activity Within the Human Female Reproductive Tract. The Journal of Immunology 158:3017-3027.

Wira, C. R. and R. M. Rossoll. 1995. Antigen-presenting cells in the female reproductive tract: influence of sex hormones on antigen presentation in the vagina. Immunology 84 (4):505-8.

Wira, C. R., J.E. Bodwell, R.H. Prabhala 1991. In Vivo response to Secretory Component in the Rat Uterus to Antigen, IFN-γ, and Estradiol. The Journal of Immunology 146 (6):1893-1899.

Wira, C. R., J.V. Fahey, V.M. Abrahams, R.M. Rossoll. 2003. Influence of Stage of the Reproductive Cycle and Estradiol on Thymus Cell Antigen Presentation. Journal of Steroid Biochemistry and Molecular Biology 84:79-87.

Wira, C. R., J.V. Fahey, C.L. Sentman, P.A. Pioli, L., Shen. 2005a. Innate and Adaptive Immunity in Female Genital Tract: Cellular Responses and Interactions. Immunological Reviews 206:306-335.

Wira, C. R., K.S. Grant-Tschudy, M.A. Crane-Godreau. 2005b. Epithelial Cells in the Female Reproductive Tract: a Central Role as Sentinels of Immune Protection. American Journal of Reproductive Immunology (AJRI) 53:65-76.

123 | P a g e

Wira, C. R., E. Hydee, C.P. Sandoe, D. Sullivan, S. Spencer. 1980. Cellular Aspects of the Rat Uterine IgA Response to Estradiol and Progesterone. Journal of Steroid Biochemistry 12:451-459.

Wira, C. R., M.A. Roche, R.M. Rossoll. 2002. Antigen Presentation by Vaginal Cells: Role of TGFβ as a Mediator of Estradiol Inhibition of Antigen Presentation. Endocrinology 143:2872-2879.

Wira, C. R., R.M. Rossoll, C. Kaushic. 2000. Antigen-Presenting Cells in the Female Reproductive Tract: Influence of Estradiol on Antigen Presentation by Vaginal Cells. Endocrinology 141:2877-2885.

Wira, C. R., R.M. Rossoll, R.C. Young, 2005c. Polarised Uterine Epithelial Cells Preferentially Present Antigen at the Basolateral Surface: Role of Stromal Cells in Regulating Class II-Mediated Epithelial Cell Antigen Presentation. The Journal of Immunology 175:1795-1804.

Wira, C. R., R.M. Rossoll. 1995. Antigen-Presenting Cells in the Female Reproductive Tract: Influence of the Estrous Cycle on Antigen Presentation by Uterine Epithelial and Stromal Cells. Endocrinology 136 (10):4526-4534.

Wira, C. R., R.M. Rossoll. 2003b. Oestradiol Regulation of Antigen Presentation by Uterine Stromal Cells: Role of Transforming Growth Factor- Production by Epithelial Cells in Mediating Antigen-Presenting Cell Function. Immunology 109:398-406.

Wira, C. R., C.P. Sandoe. 1987. Specific IgA and IgG Antibodies in the Secretions of the Female Reproductive Tract: Effects of Immunisation and Estradiol on Expression of this Response in vivo. The Journal of Immunology 138 (12):4159-4164.

Wira, C. R., J.E. Stern, E. Colby. 1984. Estradiol Regulation of Secretory Component in the Uterus of the Rat: Evidence for Involvement of RNA Synthesis. The Journal of Immunology 133 (5):2624-2628.

Wira, C. R., D.A. Sullivan, C.P. Sandoe. 1983. Epithelial Cell Involvement in the Estradiol-Stimulated Accumulation of IgA in the Rat Uterus. Journal of Steroid Biochemistry 19 (1):469-474.

Wira, C. R., D.A. Sullivan. 1985. Estradiol and Progesterone Regulation of Immunoglobulin A and G and Secretory Component in Cervicovaginal Secretions of the Rat. Biology of Reproduction 32:90-95.

World Health Organisation (WHO). 2006. Chlamydia trachomatis. http://www.who.int/vaccine_research/documents/new_vaccines/en/index3.html#chlamydia (accessed 9th August).

124 | P a g e

Wyrick, P. B., C. H. Davis, J. E. Raulston, S. T. Knight and J. Choong. 1994. Effect of clinically relevant culture conditions on antimicrobial susceptibility of Chlamydia trachomatis. Clinical Infectious Diseases 19 (5):931-6.

Yamazaki, T., T. Hagiwara, T. Kishimoto, N. Sasaki, S. Takahashi, O. Ishihara, P. Wangroongsarb, M. Kusum and P. Sirivongrangsan. 2005. Distribution of Chlamydia trachomatis serovars among female prostitutes and non-prostitutes in Thailand, and non-prostitutes in Japan during the mid-90s. Japanese Journal of Infectious Diseases 58 (4):211-3.

Yang, L., Y. Hu, Y. Hou. 2006. Effects of 17β-Estradiol on the Maturation, Nuclear Factor Kappa B p65 and Functions of Murine Spleen CD11c-Positive Dendritic Cells. Molecular Immunology 43:357-366.

Yeaman, G. R., P.M. Guyre, M.W. Fanger, J.E. Collins, H.D. White, W. Rathburn, K.A. Orndorff, J. Gonzalez, J.E. Stern, C.R. Wira. 1997. Unique CD8+ T Cell-Rich Lymphoid Aggregates in Human Uterine Endometrium. Journal of Leukocyte Biology 61:427-435.

Zhang, D. J., H. Fan, G. McClarty and R. C. Brunham. 1995. Identification of the Chlamydia trachomatis RecA-encoding gene. Infection and Immunity 63 (2):676-80.

Zhang, J. P. and R. S. Stephens. 1992. Mechanism of C. trachomatis attachment to eukaryotic host cells. Cell 69 (5):861-9.

Zhong, G. and R. C. Brunham. 1992. Antigenic analysis of the chlamydial 75-kilodalton protein. Infection and Immunity 60 (3):1221-4.