cj david et al. nature 000 , 1-5 (2009) doi:10.1038/nature08697

CJ David et al. Nature 000, 1-5 (2009) doi:10.1038/nature08697 c-Myc upregulates PTB, hnRNPA1 and hnRNPA2 and alters PKM splicing.

Upload: arsenio-marquez

Post on 31-Dec-2015

24 views

Category:

Documents

2 download

Report

Download

Embed Size (px):

DESCRIPTION

c-Myc upregulates PTB, hnRNPA1 and hnRNPA2 and alters PKM splicing. CJ David et al. Nature 000 , 1-5 (2009) doi:10.1038/nature08697. - PowerPoint PPT Presentation

TRANSCRIPT

CJ David et al. Nature 000, 1-5 (2009) doi:10.1038/nature08697

c-Myc upregulates PTB, hnRNPA1 and hnRNPA2 and alters PKM splicing.

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor

Modulationofthermalandthermoelectric ... · PDF fileLETTERS PUBLISHEDONLINE:31JULY2017|DOI:10.1038/NMAT4946 Modulationofthermalandthermoelectric transportinindividualcarbonnanotubesby

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

GI Motility online (May 2006) | doi:10.1038/gimo6

DOI: 10.1038/NGEO2405 Moist convection in hydrogen

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

Nature Genetics: doi:10.1038/ng - Seth Field's Lab at UCSDsethfield.ucsd.edu/Papers/Bielas..Gleeson NatureGenetics 2009 suppl... · Nature Genetics: doi:10.1038/ng.423. Supplemental

doi:10.1038/nature06481 LETTERS

GI Motility online (May 2006) | doi:10.1038/gimo12

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

SUPPLEMENTARY INFORMATION - media.nature.com · doi: 10.1038/nmat4795 1 1 s 1)

DOI: 10.1038/NMAT4228 - imechanicaimechanica.org/files/nmat4228-s1_0.pdf · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4228. NATURE MATERIALS | . 1. 1. In Situ Atomic-Scale Observation

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/cermak_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3666. Supplementary Figure 13 Comparison of precision

Published in Nature Materials (2016) doi:10.1038/nmat4569

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

doi:10.1038/nature05202 LETTERS

17 September 2009 doi:10.1038/nature08355 LETTERS

DOI: 10.1038/NPHOTON.2015 - media.nature.com PHOTONICS | . 3. DOI: 10.1038/NPHOTON.2015. 181. SUPPEENTAR INORATION 1 polarized laser beams to …

GI Motility online (May 2006) | doi:10.1038/gimo31

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Biotechnology: doi:10.1038/nbt

Nature Genetics doi:10.1038/ng · Aortic stenosis Aortic regurgitation Nature Genetics: doi:10.1038/ng.3618. Cardiomyopathy Hypertrophic card Pericardial Problem Pericarditis Pericardial

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Nature Biotechnology: doi:10.1038/nbt › ... › n2 › extref › nbt.3754-S1.pdf · Nature Biotechnology: doi:10.1038/nbt.3754. Supplementary Figure 2 SuRE genome coverage, reproducibility

Ecosystem turnover in palaeoecological records: …€¦ · Web viewNature Publishing Group: 53–59. DOI: 10.1038/nature08227. DOI: 10.1038/nature08227. Seddon AW, Macias-Fauria

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

DOI: 10.1038/ncomms1280 molecular dynamics of single

SCIENTIFIC REPORTS | 2 : 592 | DOI: 10.1038/srep00592

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

1 November 2007 doi:10.1038/nature06221 LETTERS