clinical study haplotype analysis of interleukin-8 gene...

Hindawi Publishing CorporationMediators of InflammationVolume 2013 Article ID 342351 8 pageshttpdxdoiorg1011552013342351

Clinical StudyHaplotype Analysis of Interleukin-8 Gene Polymorphisms inChronic and Aggressive Periodontitis

Petra Borilova Linhartova1 Jan Vokurka2 Hana Poskerova2

Antonin Fassmann2 and Lydie Izakovicova Holla12

1 Department of Pathophysiology Faculty of Medicine Masaryk University 625 00 Brno Czech Republic2 Clinic of Stomatology Institutions Shared with St Annersquos Faculty Hospital Faculty of Medicine Masaryk University656 91 Brno Czech Republic

Correspondence should be addressed to Lydie Izakovicova Holla hollamedmunicz

Received 27 July 2013 Revised 9 October 2013 Accepted 4 November 2013

Academic Editor Dennis Daniel Taub

Copyright copy 2013 Petra Borilova Linhartova et al This is an open access article distributed under the Creative CommonsAttribution License which permits unrestricted use distribution and reproduction in any medium provided the original work isproperly cited

Objectives Periodontitis is an inflammatory disease characterized by connective tissue loss and alveolar bone destructionInterleukin-8 (IL8) is important in the regulation of the immune responseThe aim of this study was to analyze four polymorphismsin the IL8 gene in relation to chronic (CP) and aggressive (AgP) periodontitis Methods A total of 492 unrelated subjects wereincluded in this case-control association study Genomic DNA of 278 patients with CP 58 patients with AgP and 156 controlswere genotyped using the 51015840 nuclease TaqMan assay for IL8 (rs4073 rs2227307 rs2227306 and rs2227532) gene polymorphismsSubgingival bacterial colonization was investigated by the DNA-microarray detection kit in a subgroup of subjects (119873 = 247)Results Allele and genotype frequencies of all investigated IL8 polymorphisms were not significantly different between the subjectswithCP andorAgP and controls (119875 gt 005)Nevertheless theA(minus251)T(+396)T(+781) andT(minus251)G(+396)C(+781) haplotypeswere significantly less frequent in patients with CP (20 versus 51 119875 lt 002 OR= 034 95 CI 015ndash078 resp 20 versus45 119875 lt 005 OR= 041 95 CI 018ndash097) than in controls Conclusions Although none of the investigated SNPs in the IL8 genewas individually associated with periodontitis some haplotypes can be protective against CP in the Czech population

1 Introduction

Periodontitis is an inflammatory disease which is initiatedand maintained by the gram-negative bacteria of the sub-gingival biofilm [1] Specific pathogen associated molecularpatterns (PAMPs) and bacterial virulence factors stimulate aninflammatory host response that finally results in destructionof periodontal tissue and tooth loss [2] Chronic periodontitis(CP) and generalized aggressive forms of periodontitis (AgP)appear to be associated with certain pathogens includingPorphyromonas gingivalis Campylobacter rectus Tannerellaforsythia Peptostreptococcus micro and Treponema species[3 4] Treponema denticola P gingivalis and T forsythiacharacterized as the ldquored complexrdquo were strongly associatedwith the clinical progression of chronic periodontitis [1ndash5] In contrast AgP was more often diagnosed in patientspositive forAggregatibacter actinomycetemcomitans but there

were many individuals with AgP who did not harbor thismicroorganism [6]

In addition to the microbial challenge other factors suchas genetics environment and host factors play a role in thepathogenesis of these diseases [7ndash9] Various compoundssuch as cytokines representing an important pathway ofconnective tissue destruction in periodontitis have beendetected in gingival crevicular fluid (GCF) IL-8 a memberof the CXC chemokine family was originally described byMatsushima and Oppenheim [10] It is the most importantchemoattractant and activator of human neutrophils and animportant mediator for granulocyte accumulation [11] IL-8is involved in the initiation and amplification of acute inflam-matory reactions and chronic inflammatory processes Func-tions of IL-8 are mediated through two receptors (CXCR1and CXCR2) the expression was detected on numerouscell lineages including neutrophils and epithelial cells [12]

2 Mediators of Inflammation

Gingival epithelial cells (GEC) are capable of upregulating IL8expression rapidly in response to A actinomycetemcomitanschallenge facilitating thus the recruitment of neutrophils asa host defense mechanism [13 14] IL8 expression in GECis induced by P gingivalis [15] and T forsythia [16] IL-8production by gingival fibroblast cultures is also affected bylipopolysaccharides of P gingivalis and P intermedia [17]TheIL-8 levels in gingival crevicular fluid (GCF) are valuable indetecting the inflammation of periodontal tissue [18ndash20] andperiodontal therapy reduces the IL-8 levels in GCF [21]

IL-8 is encoded by the IL8 gene located on chromosome4q13-21 (GenBank accession number M281301) consistingof four exons three introns and the proximal promoterregion [22] Several polymorphisms have been reported inthe IL8 gene [23ndash26] and some of them can regulate theIL-8 production Some of SNPs in the IL8 gene such asminus845TC (rs2227532) minus738TC minus251AT (rs4073 previouslyreferred to as minus353AT) +396TG (rs2227307) and +781CT(rs2227306) have been studied in patients with AgP orCP in the Brazilian population [27ndash32] In addition IL8minus251T allele which was associated with higher productionof IL-8 increased the risk of developing acute suppurativeform of apical periodontitis (AP) whereas IL8 minus251A ldquolow-producingrdquo allele was associated with chronic nonsuppura-tive form of AP in the Colombian population [33] In theChinese population IL8 minus251A allele has been associatedwith decreased susceptibility to CP [34] The cross-sectionalstudy in Iran has also focused on the study of polymorphismsin the IL8 gene but did not specify whether it was for patientswith CP or AgP [35] To date no study analyzing allelegenotype or haplotype frequencies of IL8 gene polymor-phisms in patients with periodontitis has been performed inCaucasians

The aim of this study was to associate four SNPs in theIL8 gene (rs4073 rs2227307 rs2227306 and rs2227532) andtheir haplotypes to CP and AgP and subgingival bacterialcolonization in the Czech population

2 Material and Methods

The study was performed with the approval of the Commit-tees for Ethics of the Medical Faculty Masaryk UniversityBrno and St Annersquos Faculty Hospital Written informedconsent was obtained from all participants before inclusionin the study in line with the Helsinki Declaration

21 Study Population All patients were recruited from thepatient pool of the Periodontology Department Clinic ofStomatology St Annersquos Faculty Hospital Brno from 2005to 2011 They had at least 20 remaining teeth and were ingood general health Exclusion criteria included history ofcardiovascular disorders (such as coronary artery diseases orhypertension) diabetesmellitusmalignant diseases immun-odeficiency current pregnancy or lactation Controls wereselected from subjects referring to the Clinic of Stomatologyfor reasons other than periodontal disease (such as dentalcaries orthodontic consultations preventive dental check-ups etc) during the same period as patients and matched

for age gender and smoking status Similarly as patients allcontrols had at least 20 remaining teeth and were in goodgeneral health Exclusion criteria were the same as thoseapplied for patients with periodontitis

22 Case-Control Association Study A total of 492 unre-lated Caucasian subjects of exclusively Czech ethnicityfrom the region of South Moravia were included in thiscase-control association study Diagnosis of nonperiodonti-tisperiodontitis was based on the detailed clinical examina-tion medical and dental history tooth mobility and radio-graphic assessment Probing depth (PD) and attachment loss(CAL) were collected with a UNC-15 periodontal probe fromsix sites on every tooth present The loss of the alveolarbone was determined radiographically We used the index ofMuhlemann to evaluate decreases in alveolar bone levels

(1) Generalized CP group (119873 = 278) all patients withchronic periodontitis (CP) fulfilled the diagnosticcriteria defined according to CAL levels by the Inter-national Workshop for a Classification of PeriodontalDiseases and Conditions for Chronic Periodontitis[36] Inclusion criteria for patients suffering fromgeneralized chronic periodontitis were as followsge30 of the teeth were affected PD was ge4mm andthe amount of CAL was consistent with the presenceof dental plaque

(2) Generalized AgP group (119873 = 58) patients with ag-gressive periodontitis with age at disease onset lt35years attachment loss of 4mm or more in at least30 of the teeth (at least three of the affected teethwere not first molars and incisors) and the severity ofattachment loss being inconsistent with the amountof dental plaque were included in this study

(3) Control group (healthynonperiodontitis) (119873 = 156)controls were screened using a WHO probe and theCPITN (Community Periodontal Index of TreatmentNeeds) was assessed [37] values of the CPITN indexin controls were less than 3

In order to adjust for the effect of smoking historyon periodontal disease the subjects (patients and controls)were classified into the following groups subjects whonever smoked (referred to as nonsmokers) and subjects whowere former smokers for ge5 pack years or current smokers(referred to as smokers) The pack years were calculated bymultiplying the number of years of smoking by the averagenumber of cigarette packs smoked per day

23 Genetic Analysis

231 Isolation of Genomic DNA DNA for genetic analysiswas extracted from the peripheral blood leukocytes usingstandard phenolchloroform procedures with proteinase Kaccording to Sambrook et al [38] Isolation and storage ofDNA (working samples at concentrations of 50 ng120583Lminus1 at4∘C) as well as the genotyping of samples were conducted inthe laboratory of theDepartment of Pathophysiology Facultyof Medicine Masaryk University Brno Czech Republic

Mediators of Inflammation 3

232 SNPs Genotyping TaqMan Assay Four SNPs (minus845CTrs2227532 minus251AT rs4073 +396GT rs2227307 and +781CT rs2227306) in the IL8 gene were genotyped using the 51015840nuclease TaqMan assay for allelic discrimination Individualfluorogenic TaqMan probes consisting of an oligonucleotidelabelled with both a fluorescent reporter dye FAM anda quencher dye VIC were obtained from Life Technolo-gies (Grand Island NY USA) Each reaction mixture wasprepared using TaqMan Genotyping Master Mix (125120583L)TaqMan SNP Genotyping Assay (125120583L) and 50 ng ofgenomic DNA in 175 120583L of dH

2O to make a 250120583L reaction

volume Genotyping was carried out simultaneously with88 samples on 96-well plate (+8 negative controls) Detailson SNPs detection are summarized in Table 1 The PCRthermocycling protocol consisted of 10min at 95∘C followedby 40 cycles of 15 s at 92∘C and 1min at 60∘C Each geno-typing plate contained eight wells without any DNA template(negative controls) and randomly selected duplicate samples(10 of plate samples) Allele genotyping from fluorescencemeasurements was then obtained using the ABI PRISM 7000Sequence Detection System SDS version 123 software wasused to analyze real-time and endpoint fluorescence dataGenotyping was performed by one investigator (P B L)unaware of the phenotype

233 DNA Microarray Analysis of Oral Pathogens Subgin-gival bacterial colonization (Aggregatibacter actinomycetem-comitans Porphyromonas gingivalis Prevotella intermediaTannerella forsythia Treponema denticola Peptostreptococ-cus micros and Fusobacterium nucleatum) in subgingivalpockets was investigated by the DNA microarray based ona periodontal pathogen detection kit (Protean Ltd CeskeBudejovice CR) in a subgroup of randomly selected subjects(119873 = 151 for CP 119873 = 21 for AgP and 119873 = 75 forcontrols) before subgingival scaling Microbial samples werecollected from the deepest pocket in periodontitis patients(and from the deepest sulcus in healthy subjects) of eachquadrant by inserting a sterile paper point into a base of thepocket for 20 seconds Bacterial plaque samples from eachindividual were pooled in one tube This test determinedthe individual pathogens semiquantitatively as follows (minus)undetected which corresponds to the number of bacteria lessthan 103 (+) slightly positive corresponding to the numberof bacteria 103 to 104 (++) positive corresponding to thenumber of bacteria 104 to 105 and (+++) strongly positivewith the number of bacteria higher than 105

24 Statistical Analysis Comparisons were made betweenallelic and genotype frequencies in the patients with chronicor aggressive form of periodontitis and control populationThe allele frequencies were calculated from the observednumbers of genotypes The significance of differences in theallele frequencies among groups was determined by Fisherrsquosexact test 1205942 analysis was used to test for deviation ofgenotype distribution fromHardy-Weinberg equilibrium andcomparison of differences in genotype combinations amonggroups

To examine the linkage disequilibrium (LD) betweenall SNPs pairwise LD coefficients (D1015840) and haplotypefrequencies were calculated using the SNP Analyzer 2program (httpsnpistechinfoistechboardlogin formjsp)Variations in the quantity of subgingival bacteria correspond-ing to the particular genotypesalleles were tested by 1205942 andFisherrsquos exact tests Differences were considered significant at119875 lt 005

Power analysis was performed with respect to the case-control design of the study taking the incidence rate ofmarkers and estimate of the odds ratio (OR) as end-pointstatisticalmeasures ORswith corresponding 95 confidenceintervals (CI) were estimated using logistic regression mod-els adopting age sex and smoking as adjusting covariates Allcalculationswere performedusing Statistica ver 100 (StatSoftInc Tulsa OK USA) and SPSS software (SPSS 2001 IBMCorporation 2011)

3 Results

31 Case-Control Study The mean ages for AgP patients(370 plusmn 82 years plusmn SD) and healthy subjects (410 plusmn 123) didnot differ between the two groups However subjects with CPwere significantly older (479plusmn 87) than the patientswithAgP(119875 lt 005) Nearly 27 of the periodontitis patients (280of CP and 260 of AgP) and 280 of healthy subjects weresmokers There were no significant differences between thesubjects with periodontitis and controls regarding the meanpercentage of smokers and ratio of malesfemales (7779 incontrols 136142 in patients with CP and 2533 in patientswith AgP)

Sample size of the study was planned in standard powercalculation for case-control design of the study with thenull and alternative hypotheses expressed on the basis ofOR The design was prospectively optimized assuming theprevalence of examined attribute among controls to be 05The recruited sample (278 cases 156 controls) allowed astatistically significant detection of OR out of the range of055ndash180 (alpha = 005 power = 080) In case of the AgPgroup (58 cases 156 controls) the statistically significantlydetectable ORs estimates were out of the range of 039ndash259

32 Single Nucleotide Polymorphism Analysis All studiedpolymorphisms were in the Hardy-Weinberg equilibriumin the control group Allele and genotype frequencies ofall investigated IL8 polymorphisms were not significantlydifferent between the subjects with CP andor AgP andcontrols (119875 gt 005 Table 2) Considering that in the Czechpopulation SNP IL8 minus845TT genotype occurred in 984 ofCP patients and even 100 of controls and AgP patients weanalyzed this polymorphism only in the subgroup of subjects(119873 = 193)

33 Haplotype Analysis Based on the previous study [29]the haplotype analysis of these selected SNPs was performedin the IL8 gene (minus251TA rs4073 +396TG rs2227307 and+781CT rs2227306) All variants in the IL8 gene were in tight


Table 1 Details of SNPs in IL8 detection

SNPs TaqMan SNP genotyping assay ID Context sequence [VICFAM]IL8 minus845TC(rs2227532) C 1842904 10 GCTCTTATGCCTCCACTGGAATTAA[CT]

GTCTTAGTACCACTTGTCTATTCTGIL8 minus251AT(rs4073) C 11748116 10 TTATCTAGAAATAAAAAAGCATACA[AT]

TTGATAATTCACCAAATTGTGGAGCIL8 +396TG(rs222730732) C 11748168 10 TATTCTGCTTTTATAATTTATACCA[GT]

GTAGCATGCATATATTTAACGTAAAIL8 +781CT(rs2227306) C 11748169 10 AACTCTAACTCTTTATATAGGAAGT[CT]

GTTCAATGTTGTCAGTTATGACTGT

Table 2 Genotype and allele frequencies of IL8 polymorphisms in control and periodontitis subgroups

SNP Genotype Controls119873 = 156 ()

CP119873 = 278 () 119875 value

lowast OR(95 CI)

AgP119873 = 58 () 119875 value

lowast OR(95 CI)

IL8 minus251TA(rs4073)

TT 49 (314) 95 (342) mdash 100 18 (310) mdash 100TA 78 (500) 120 (432) 037 076 (047ndash123) 27 (466) 076 108 (049ndash237)AA 29 (186) 63 (227) 078 122 (067ndash221) 13 (224) 067 127 (047ndash338)AlleleT 176 (564) 310 (558) 060 100 62 (534) 033 100A 136 (436) 246 (442) 093 (069ndash125) 54 (466) 089 (055ndash144)

IL8 +396TG(rs2227307)

TT 54 (346) 100 (360) mdash 100 20 (345) mdash 100TG 74 (474) 118 (424) 058 086 (054ndash139) 27 (466) 074 115 (054ndash245)GG 28 (179) 60 (216) 067 128 (071ndash231) 11 (190) 092 100 (036ndash282)AlleleT 182 (583) 318 (572) 083 100 67 (578) 089 100G 130 (417) 238 (428) 091 (068ndash123) 49 (422) 099 (061ndash162)

IL8 +781CT(rs2227306)

CC 55 (353) 103 (371) mdash 100 20 (345) mdash 100CT 76 (487) 121 (435) 051 082 (052ndash131) 27 (466) 084 110 (052ndash234)TT 25 (160) 54 (194) 066 124 (067ndash231) 11 (190) 066 107 (038ndash302)AlleleT 186 (596) 327 (588) 044 100 67 (578) 068 100C 126 (404) 229 (412) 106 (078ndash143) 49 (422) 105 (064ndash170)

IL8 minus845TC(rs2227532)

TT 52 (1000) 120 (984) mdash 100 19 (1000) mdash 100TC 0 (00) 2 (16) 049 0 (00) 100 CC 0 (00) 0 (00) 100 0 (00) 100 AlleleT 104 (1000) 242 (992) 049 100 38 (1000) 100 100C 0 (00) 2 (08) 0 (00)

lowastDifferences between individual haplotypes (between controls and CP or controls and AgP) were analyzed using the Fisher exact testOR odds ratio adjusted for age sex and smoking in logistic regression reference categories designatedwith anORof 10 CI confidence interval nonapplicable(small numbers) OR not calculated because of the presence of zero values

linkage disequilibrium with each other to various degrees(D1015840 = 0793ndash1000 in controls D1015840 = 0889ndash0951 in patientswith CP and D1015840 = 0891ndash1000 in patients with AgP)The complex analysis revealed differences in IL8 haplotypefrequencies Specifically the A(minus251)T(+396)T(+781) andT(minus251)G(+396)C(+781) haplotypes were significantly lessfrequent in patients with CP (20 versus 51 resp 45119875 lt 005) (Table 3) The decreased frequency of theTGC haplotype alleles in patients with CP was confirmedby the observation that TGCTTC haplotype (arranged asgenotypes) was less frequent in patients with CP (04 versus

26 119875 lt 005 OR = 009 95 CI = 001ndash096) Moreoveran uncommon ATTATT haplotype (115 of the studiedpopulation) was found more but nonsignificantly in non-periodontitis controls (26 versus 04 119875 = 007) Therewas also a nonsignificant trend in the ATCTTC haplotypeassociation with CP (22 versus 00 119875 = 008 Table 4)

34 Microbiological Analysis F nucleatum occurred lessfrequently in nonperiodontitis subjects (119873 = 75) positivefor T allele of IL8 +396GT variant (492 versus 778119875 lt 002 OR = 028 95 CI = 009ndash089) or TT genotype


Table 3 Distribution of IL8 haplotypes in the studied groups

Haplotypes (alleles of IL8 SNPs)Controls119873 = 312 ()

CP119873 = 556 () 119875

a OR (95 CI) AgP119873 = 116 () 119875

a OR (95 CI)IL8 minus251TA(rs4073)

IL8+396TG(rs2227307)

IL8 +781CT(rs2227306)

T T C 162 (519) 293 (527) NS 099 (073ndash132) 62 (534) NS 102 (063ndash165)A G T 110 (353) 212 (381) NS 117 (086ndash159) 46 (397) NS 114 (070ndash187)A T T 16 (51) 11 (20) 0018 034 (015ndash078) 3 (26) NS 062 (018ndash220)T G C 14 (45) 11 (20) 0048 041 (018ndash097) 2 (17) NS 051 (011ndash230)A G C 6 (19) 12 (22) NS 140 (047ndash412) 2 (17) NS 122 (023ndash635)A T C 4 (13) 11 (20) NS 179 (054ndash590) 1 (09) NS 101 (011ndash929)T T T 0 (00) 3 (05) NS lowast 0 (00) NS lowast

T G T 0 (00) 3 (05) NS lowast 0 (00) NS lowast

119875 = NS 119875 = NSOR odds ratio adjusted for age sex and smoking in logistic regression CI confidence intervalsaDifferences between individual haplotypes (between controls and CP or controls and AgP) were analyzed using the Fisher exact testlowastOR not calculated because of the presence of zero valuesBold significant result

Table 4 Distribution of IL8 haplotypes (arranged as genotypes) in the studied groups

Haplotypes(genotypes of IL8 SNPs)minus251TA +396TG+781CT251TA+396TG and +781CT

Controls119873 = 156 ()

CP119873 = 278 () 119875

a OR (95 CI) AgP119873 = 58 () 119875

a OR (95 CI)

TTCTTC 42 (269) 86 (309) NS 118 (074ndash187) 17 (293) NS 098 (046ndash209)AGTTTC 63 (404) 101 (363) NS 080 (052ndash123) 24 (414) NS 113 (057ndash224)ATTTTC 6 (38) 3 (11) 008 022 (005ndash106) 2 (34) NS 103 (019ndash549)

TGCTTC 4 (26) 1 (04) 0046 009(001ndash096) 0 (00) NS lowast

AGCTTC 5 (32) 6 (22) NS 090 (024ndash336) 1 (17) NS 064 (007ndash600)ATCTTC 0 (00) 6 (22) 008 lowast 1 (17) lowast lowast

TTTTTC 0 (00) 3 (11) NS lowast 0 (00) lowast lowast

TGTTTC 0 (00) 1 (04) lowast lowast 0 (00) lowast lowast

AGTAGT 20 (128) 47 (169) NS 160 (087ndash293) 10 (172) NS 112 (042ndash304)

ATTAGT 1 (06) 5 (18) NS 212(020ndash2208) 1 (17) lowast

336(020ndash5597)

AGTTGC 4 (26) 3 (11) NS 031 (006ndash152) 0 (00) NS lowast

AGTAGC 1 (06) 5 (18) NS 328(035ndash3098) 1 (17) lowast

506(029ndash8700)

AGTATC 1 (06) 4 (14) NS 252 (027ndash2383) 0 (00) lowast lowast

ATTATT 4 (26) 1 (04) 007 017 (002ndash159) 0 (00) NS lowast

TGCTGC 3 (19) 3 (11) NS 071 (013ndash382) 1 (17) NS 121 (012ndash1226)ATTATC 1 (06) 0 (00) lowast lowast 0 (00) lowast lowast

ATCATC 1 (06) 0 (00) lowast lowast 0 (00) lowast lowast

TGTTGT 0 (00) 1 (04) lowast lowast 0 (00) lowast lowast

AGCTGC 0 (00) 1 (04) lowast lowast 0 (00) lowast lowast

119875b = 0067 119875b = NSOR odds ratio adjusted for age sex and smoking in logistic regression CI confidence intervalsaDifferences between individual haplotypes (between controls and CP or controls and AgP) were analyzed using the Fisher exact testbDifferences between individual haplotypes (between controls and CP or controls and AgP) were analyzed using the 1205942 testlowastOR not calculated because of the presence of zero valuesBold significant result


(212 versus 556 119875 lt 005 OR = 022 95 CI = 005ndash091) In contrast IL8 minus251T allele carriers had an increasedOR for individual presence of A actinomycetemcomitans inAgP (119873 = 21) patients (917 versus 400 119875 lt 001 OR =165 95 CI = 188ndash1450) and also TT genotype was moreoften found in A actinomycetemcomitans presence (830versus 133 119875 lt 001 OR = 325 95 CI = 238ndash4432)Patients with CP (119873 = 151) carrying CC genotype of IL8+781TC variant had less frequent presence of T forsythiain their subgingival microflora than subjects without thisgenotype (216 versus 351 119875 lt 005 OR = 051 95 CI =025ndash105) However the relationship between periodontalbacteria and IL8 gene polymorphisms must be assessedvery carefully regarding small numbers of subjects in therespective subgroups

4 Discussion

Cytokines involved in the inflammatory process such asIL8 and their genes are important potential modifiers ofindividual susceptibility to AgP or CP Although none ofthe investigated SNPs in the IL8 gene was individuallyassociated with aggressive or chronic periodontitis thepatients with CP showed lower A(minus251)T(+396)T(+781)and T(minus251)G(+396)C(+781) haplotype frequencies thanthe controls The association of TGC haplotype with CP wasconfirmed by the relationship between TGCTTC haplotype(arranged as genotypes) and CP These results confirm thehypothesis that haplotypes are more powerful for detectingsusceptibility alleles than individual polymorphisms Ourresults differ from those obtained by Scarel-Caminaga et al[29] who associated ATCTTC and AGTTGC haplotypeswith chronic periodontitis in the Brazilian population Thesecontradictory findings may be due to variability of the exam-ined populations For example the frequency of theATChap-lotype in the Czech population was less than 34 comparedto 237 in the Brazilians [29] In the Brazilian populationsome haplotypes of IL8 minus845(TC)minus738(TA)minus353(AT)variants showed significant association to or protectionagainst CP [28] Of the three IL8 SNPs only one poly-morphism was the same as in our study (ie SNP minus251(rs4073) referred to as minus353 in Brazilian study) Polymor-phism minus845TC (rs2227532) was also investigated in thisstudy but regarding a very low frequency of C allele it wasanalyzed only in several individuals and therefore it was notincluded for any further haplotype assessment

To date eight studies evaluating the association of IL8SNPs (minus251 +396 and +781) and CP or AgP in differentpopulations (mostly in Brazilian but none in the Caucasianpopulation) have been performed with contradictory results[27ndash32 34 35] Most of these studies analyzed only the indi-vidual SNP andwere focused on examining of CP onlyAndiaet al [32] studied the relationship between IL8 minus251 variantand AgP however no association was found Similarly Kimet al [27] failed to find any association between CP and alleleor genotype distribution of IL8minus251 SNP In contrast anotherstudy discovered a significant association between IL8 minus251SNP and CP in nonsmokers The IL8 minus251TA heterozygote

genotype was associated with increased levels of IL8 mRNAtranscripts and A allele had an increased risk for developingperiodontitis [30] This is consistent with the observationthat the A allele of SNP IL8 minus251 tended to be associatedwith higher IL-8 production in lipopolysaccharide- (LPS-)stimulated human whole blood [25] Very recently Li et al[34] found that A allele of IL8 minus251 variant was associatedwith decreased susceptibility to CP in Chinese populationHoushmand et al [35] found a significant difference in thegenotype frequencies of IL8 minus251AT and +396GT SNPsbetween subjects with periodontitis and a control group inHamedan Iran but did not specify whether it was for patientswith CP or AgP Conversely Corbi et al [31] showed that thegenetic susceptibility to CP in the IL8 gene was not associatedwith worse periodontal clinical parameters and increasedIL-8 concentration With the exception of Scarel-Caminagaet al [29] who associated the +396TT genotype with CP noassociation between SNP at position +396 or +781 and CP inthe Brazilian population was discovered

Several studies have examined polymorphisms in inter-leukins in connection with a subgingival bacterial coloniza-tion in patients with periodontitis In this study SNPs inthe gene encoding IL-8 were associated with the presence ofpathogenic bacteria in subgingival dental plaque The resultsshowed that IL8 minus251T allele carriers had an increased ORfor the individual presence of A actinomycetemcomitans inAgP patients (119875 lt 001) and an increased OR was alsofound for the presence of T forsythia for T allele of IL8 +781in CP patients (119875 lt 005) These data are in agreementwith the notion that individual genetic susceptibility mayinfluence the host response to infection [39] Nibali et al [40]found association between IL6 SNPs and A actinomycetem-comitans which they confirmed by the haplotype analysisSpecifically IL6 minus174GG genotype was associated with high(above median) counts of A actinomycetemcomitans (bothin all subjects and periodontally healthy subjects only) inIndians [41] But Nibali et al [42] also suggested that onlya detection of known periodontopathogenic bacteria couldnot discriminate different forms of periodontitis In contrastSchulz et al [43] found no evidence that SNPs in IL1 genecluster could be associatedwith subgingival colonizationwithA actinomycetemcomitans and could thus be an independentrisk indicator of AgP In addition Finoti et al [44] observedthat periodontal destruction may occur in patients whoare considered to be genetically susceptible to CP with alower microbial challenge because of the presence of the IL8ATCTTC haplotype than in patients without this haplotype

There are some limitations to this study that need to beconsidered First the major complicating factor in the studyof isolated locus (such as IL8) is the nature of periodontitisas a multifactorial disease in which interaction betweenmultiple genes plays a role and each genetic polymorphismhas generally only a small effect In addition the interactionof gene variants with environmental factors (such as bacterialpathogens) socioeconomic factors BMI and others notanalyzed in this study potentially affect the observed phe-notype Second the case-control approach used is generallyquite vulnerable to the population stratification for exampledue to different ethnic origin The present sample however


is exclusively of the Czech Caucasian origin restricted to thelimited geographical area populated by quite homogeneouspopulation with low admixture Finally we did not measureRNA expression or protein levels of IL-8 therefore we do notknow the functional consequences of these polymorphismsin our subjects

In conclusion although none of the investigated SNPs inthe IL8 gene were individually associated with periodontitissome haplotypes can be protective against CP in the Czechpopulation Clinical significance of these findings is lowdue to a very low frequency of the ldquoprotectiverdquo haplotypesThe individual IL8 variants were associated with subgingivalcolonization withA actinomycetemcomitans in AgP and withT forsythia in CP in the Czech population However theserelationships must be assessed very carefully regarding smallnumbers of subjects in the respective subgroups Furtherstudies are needed to clarify the association of these polymor-phisms with periodontal diseases in other populations

Conflict of Interests

The authors declare that they have no conflict of interestsassociated with this work

Acknowledgments

This study was supported by the Internal Grant Agency (IGANT11405-6) of the Czech Republic Ministry of Health and byproject MUNIA08882012

References

[1] S S Socransky A D Haffajee M A Cugini C Smith and R LKent Jr ldquoMicrobial complexes in subgingival plaquerdquo Journal ofClinical Periodontology vol 25 no 2 pp 134ndash144 1998

[2] G C Armitage ldquoClinical evaluation of periodontal diseasesrdquoPeriodontology 2000 vol 7 pp 39ndash53 1995

[3] R Genco K S Kornman R Williams et al ldquoConsensus reportperiodontal diseases pathogenesis and microbial factorsrdquoAnnals of Periodontology vol 1 pp 926ndash932 1996

[4] G C Armitage ldquoComparison of the microbiological features ofchronic and aggressive periodontitisrdquo Periodontology 2000 vol53 no 1 pp 70ndash88 2010

[5] B Riep L Edesi-Neuszlig F Claessen et al ldquoAre putative peri-odontal pathogens reliable diagnostic markersrdquo Journal ofClinical Microbiology vol 47 no 6 pp 1705ndash1711 2009

[6] A Mombelli F Casagni and P N Madianos ldquoCan presence orabsence of periodontal pathogens distinguish between subjectswith chronic and aggressive periodontitis A systematic reviewrdquoJournal of Clinical Periodontology vol 29 no 3 pp 10ndash21 2002

[7] B S Michalowicz D Aeppli J G Virag et al ldquoPeriodontalfindings in adult twinsrdquo Journal of Periodontology vol 62 no5 pp 293ndash299 1991

[8] B S Michalowicz ldquoGenetic and heritable risk factors in peri-odontal diseaserdquo Journal of Periodontology vol 65 no 5 pp479ndash488 1994

[9] R C Page and K S Kornman ldquoThe pathogenesis of humanperiodontitis an introductionrdquo Periodontology 2000 vol 14 pp9ndash11 1997

[10] K Matsushima and J J Oppenheim ldquoInterleukin 8 andMCAFnovel inflammatory cytokines inducible by IL 1 and TNFrdquoCytokine vol 1 no 1 pp 2ndash13 1989

[11] CGronhoj LarsenAOAnderson E Appella J J Oppenheimand K Matsushima ldquoThe neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytesrdquo Science vol 243 no4897 pp 1464ndash1466 1989

[12] G Godaly L Hang B Frendeus and C Svanborg ldquoTransep-ithelial neutrophil migration is CXCR1 dependent in vitroand is defective in IL-8 receptor knockout micerdquo Journal ofImmunology vol 165 no 9 pp 5287ndash5294 2000

[13] G T-J Huang S K Haake and N-H Park ldquoGingivalepithelial cells increase interleukin-8 secretion in responseto Actinobacillus actinomycetemcomitans challengerdquo Journal ofPeriodontology vol 69 no 10 pp 1105ndash1110 1998

[14] A Sfakianakis C E Barr and D Kreutzer ldquoMechanisms ofActinobacillus actinomycetemcomitans-induced expression ofinterleukin-8 in gingival epithelial cellsrdquo Journal of Periodontol-ogy vol 72 no 10 pp 1413ndash1419 2001

[15] Y Kusumoto H Hirano K Saitoh et al ldquoHuman gingivalepithelial cells produce chemotactic factors interleukin-8 andmonocyte chemoattractant protein-1 after stimulation withPorphyromonas gingivalis via Toll-like receptor 2rdquo Journal ofPeriodontology vol 75 no 3 pp 370ndash379 2004

[16] K H Shinsuke Onishi S Liang P Stathopoulou D Kinane GHajishengallis and A Sharma ldquoToll-like receptor 2-mediatedinterleukin-8 expression in gingival epithelial cells by theTannerella forsythia leucine-rich repeat protein BspArdquo Infectionand Immunity vol 76 no 1 pp 198ndash205 2008

[17] M Tamura M Tokuda S Nagaoka and H Takada ldquoLipo-polysaccharides of Bacteroides intermedius (Prevotella inter-media) and Bacteroides (Porphyromonas) gingivalis induceinterleukin-8 gene expression in human gingival fibroblastculturesrdquo Infection and Immunity vol 60 no 11 pp 4932ndash49371992

[18] C C Tsai Y P Ho and C C Chen ldquoLevels of interleukin-1beta and interleukin-8 in gingival crevicular fluids in adultperiodontitisrdquo Journal of periodontology vol 66 no 10 pp 852ndash859 1995

[19] A I Dongari-Bagtzoglou and J L Ebersole ldquoIncreased pres-ence of interleukin-6 (IL-6) and IL-8 secreting fibroblast sub-populations in adult periodontitisrdquo Journal of Periodontologyvol 69 no 8 pp 899ndash910 1998

[20] C Giannopoulou J J Kamma and A Mombelli ldquoEffect ofinflammation smoking and stress on gingival crevicular fluidcytokine levelrdquo Journal of Clinical Periodontology vol 30 no 2pp 145ndash153 2003

[21] P Goutoudi E Diza andMArvanitidou ldquoEffect of periodontaltherapy on crevicular fluid interleukin-6 and interleukin-8 lev-els in chronic periodontitisrdquo International Journal of Dentistryvol 2012 Article ID 362905 8 pages 2012

[22] N Mukaida M Shiroo and K Matsushima ldquoGenomic struc-ture of the human monocyte-derived neutrophil chemotacticfactor IL-8rdquo Journal of Immunology vol 143 no 4 pp 1366ndash1371 1989

[23] M F Fey and A Tobler ldquoAn interleukin-8 (IL-8) cDNA cloneidentifies a frequent HindIII polymorphismrdquo Human Geneticsvol 91 no 3 p 298 1993

[24] E Renzoni P Lympany P Sestini et al ldquoDistribution of novelpolymorphisms of the interleukin-8 and CXC receptor 1 and 2genes in systemic sclerosis and cryptogenic fibrosing alveolitisrdquoArthritis and Rheumatism vol 43 no 7 pp 1633ndash1640 2000


[25] J Hull A Thomson and D Kwiatkowski ldquoAssociation ofrespiratory syncytial virus bronchiolitis with the interleukin 8gene region in UK familiesrdquo Thorax vol 55 no 12 pp 1023ndash1027 2000

[26] B H Rovin L Lu and X Zhang ldquoA novel interleukin-8polymorphism is associated with severe systemic lupus erythe-matosus nephritisrdquo Kidney International vol 62 no 1 pp 261ndash265 2002

[27] Y J KimACViana KMCCurtis S R POrrico J A Cirelliand RM Scarel-Caminaga ldquoLack of association of a functionalpolymorphism in the interleukin 8 gene with susceptibility toperiodontitisrdquoDNA and Cell Biology vol 28 no 4 pp 185ndash1902009

[28] Y J Kim A C Viana K M C Curtis et al ldquoAssociation ofhaplotypes in the IL8 gene with susceptibility to chronic peri-odontitis in a Brazilian populationrdquo Clinica Chimica Acta vol411 no 17-18 pp 1264ndash1268 2010

[29] RM Scarel-Caminaga Y J KimA C Viana et al ldquoHaplotypesin the Interleukin 8 gene and their association with chronicperiodontitis susceptibilityrdquo Biochemical Genetics vol 49 no 5-6 pp 292ndash302 2011

[30] D C Andia N F P De Oliveira A M Letra F H NocitiJr S R P Line and A P De Souza ldquoInterleukin-8 genepromoter polymorphism (rs4073) may contribute to chronicperiodontitisrdquo Journal of Periodontology vol 82 no 6 pp 893ndash899 2011

[31] S C T Corbi G Anovazzi L S Finoti et al ldquoHaplotypes ofsusceptibility to chronic periodontitis in the Interleukin 8 genedo not influence protein level in the gingival crevicular fluidrdquoArchives of Oral Biology vol 57 no 10 pp 1355ndash1361 2012

[32] D C Andia A Letra R C CasarinM Z Casati S R Line andA P de Souza ldquoGenetic analysis of the IL8 gene polymorphism(rs4073) in generalized aggressive periodontitisrdquo Archives ofOral Biology vol 58 no 2 pp 211ndash217 2013

[33] M P Amaya L Criado B Blanco et al ldquoPolymorphisms of pro-inflammatory cytokine genes and the risk for acute suppurativeor chronic nonsuppurative apical periodontitis in a Colombianpopulationrdquo International Endodontic Journal vol 46 no 1 pp71ndash78 2013

[34] G Li Y Yue Y Tian et al ldquoAssociation of matrix metallopro-teinase (MMP)-1 3 9 interleukin (IL)-2 8 and cyclooxygenase(COX)-2 gene polymorphisms with chronic periodontitis in aChinese populationrdquo Cytokine vol 60 no 2 pp 552ndash560 2012

[35] B Houshmand M Hajilooi A Rafiei M Bidgoli and SSoheilifar ldquoEvaluation of IL-8 gene polymorphisms in patientswith periodontitis in Hamedan Iranrdquo Dental Research Journalvol 9 no 4 pp 427ndash432 2012

[36] G C Armitage ldquoDevelopment of a classification system forperiodontal diseases and conditionsrdquo Annals of Periodontologyvol 4 no 1 pp 1ndash6 1999

[37] World Health Organisation Oral Health Surveys Basic Meth-ods WHO Geneva Switzerland 4th ed edition 1997

[38] J J Sambrook E F Fritsch and T ManiatisMolecular Cloninga Laboratory Manual Cold Spring Harbor Laboratory PressCold Spring Harbor NY USA 1989

[39] G S Cooke and A V S Hill ldquoGenetics of susceptibility tohuman infectious diseaserdquo Nature Reviews Genetics vol 2 no12 pp 967ndash977 2001

[40] L Nibali M S Tonetti D Ready et al ldquoInterleukin-6 polymor-phisms are associated with pathogenic bacteria in subjects withperiodontitisrdquo Journal of Periodontology vol 79 no 4 pp 677ndash683 2008

[41] L Nibali I Madden F Franch Chillida L J A Heitz-MayfieldP M Brett and N Donos ldquoIL6 -174 Genotype Associatedwith Aggregatibacter actinomycetemcomitans in Indiansrdquo OralDiseases vol 17 no 2 pp 232ndash237 2011

[42] L Nibali F DrsquoAiuto D Ready M Parkar R Yahaya and DDonos ldquoNo association between A actinomycetemcomitans orP gingivalis and chronic or aggressive periodontitis diagnosisrdquoQuintessence International vol 43 no 3 pp 247ndash254 2012

[43] S Schulz J M Stein W Altermann et al ldquoSingle nucleotidepolymorphisms in interleukin-1gene cluster and subgingivalcolonization with Aggregatibacter actinomycetemcomitans inpatients with aggressive periodontitisrdquo Human Immunologyvol 72 no 10 pp 940ndash946 2011

[44] L S Finoti S C Corbi G Anovazzi et al ldquoAssociation betweenIL8 haplotypes and pathogen levels in chronic periodontitisrdquoEuropean Journal of Clinical Microbiology and Infectious Dis-eases vol 32 no 10 pp 1333ndash1340 2013

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom


Gingival epithelial cells (GEC) are capable of upregulating IL8expression rapidly in response to A actinomycetemcomitanschallenge facilitating thus the recruitment of neutrophils asa host defense mechanism [13 14] IL8 expression in GECis induced by P gingivalis [15] and T forsythia [16] IL-8production by gingival fibroblast cultures is also affected bylipopolysaccharides of P gingivalis and P intermedia [17]TheIL-8 levels in gingival crevicular fluid (GCF) are valuable indetecting the inflammation of periodontal tissue [18ndash20] andperiodontal therapy reduces the IL-8 levels in GCF [21]

IL-8 is encoded by the IL8 gene located on chromosome4q13-21 (GenBank accession number M281301) consistingof four exons three introns and the proximal promoterregion [22] Several polymorphisms have been reported inthe IL8 gene [23ndash26] and some of them can regulate theIL-8 production Some of SNPs in the IL8 gene such asminus845TC (rs2227532) minus738TC minus251AT (rs4073 previouslyreferred to as minus353AT) +396TG (rs2227307) and +781CT(rs2227306) have been studied in patients with AgP orCP in the Brazilian population [27ndash32] In addition IL8minus251T allele which was associated with higher productionof IL-8 increased the risk of developing acute suppurativeform of apical periodontitis (AP) whereas IL8 minus251A ldquolow-producingrdquo allele was associated with chronic nonsuppura-tive form of AP in the Colombian population [33] In theChinese population IL8 minus251A allele has been associatedwith decreased susceptibility to CP [34] The cross-sectionalstudy in Iran has also focused on the study of polymorphismsin the IL8 gene but did not specify whether it was for patientswith CP or AgP [35] To date no study analyzing allelegenotype or haplotype frequencies of IL8 gene polymor-phisms in patients with periodontitis has been performed inCaucasians

The aim of this study was to associate four SNPs in theIL8 gene (rs4073 rs2227307 rs2227306 and rs2227532) andtheir haplotypes to CP and AgP and subgingival bacterialcolonization in the Czech population

2 Material and Methods

The study was performed with the approval of the Commit-tees for Ethics of the Medical Faculty Masaryk UniversityBrno and St Annersquos Faculty Hospital Written informedconsent was obtained from all participants before inclusionin the study in line with the Helsinki Declaration

21 Study Population All patients were recruited from thepatient pool of the Periodontology Department Clinic ofStomatology St Annersquos Faculty Hospital Brno from 2005to 2011 They had at least 20 remaining teeth and were ingood general health Exclusion criteria included history ofcardiovascular disorders (such as coronary artery diseases orhypertension) diabetesmellitusmalignant diseases immun-odeficiency current pregnancy or lactation Controls wereselected from subjects referring to the Clinic of Stomatologyfor reasons other than periodontal disease (such as dentalcaries orthodontic consultations preventive dental check-ups etc) during the same period as patients and matched

for age gender and smoking status Similarly as patients allcontrols had at least 20 remaining teeth and were in goodgeneral health Exclusion criteria were the same as thoseapplied for patients with periodontitis

22 Case-Control Association Study A total of 492 unre-lated Caucasian subjects of exclusively Czech ethnicityfrom the region of South Moravia were included in thiscase-control association study Diagnosis of nonperiodonti-tisperiodontitis was based on the detailed clinical examina-tion medical and dental history tooth mobility and radio-graphic assessment Probing depth (PD) and attachment loss(CAL) were collected with a UNC-15 periodontal probe fromsix sites on every tooth present The loss of the alveolarbone was determined radiographically We used the index ofMuhlemann to evaluate decreases in alveolar bone levels

(1) Generalized CP group (119873 = 278) all patients withchronic periodontitis (CP) fulfilled the diagnosticcriteria defined according to CAL levels by the Inter-national Workshop for a Classification of PeriodontalDiseases and Conditions for Chronic Periodontitis[36] Inclusion criteria for patients suffering fromgeneralized chronic periodontitis were as followsge30 of the teeth were affected PD was ge4mm andthe amount of CAL was consistent with the presenceof dental plaque

(2) Generalized AgP group (119873 = 58) patients with ag-gressive periodontitis with age at disease onset lt35years attachment loss of 4mm or more in at least30 of the teeth (at least three of the affected teethwere not first molars and incisors) and the severity ofattachment loss being inconsistent with the amountof dental plaque were included in this study

(3) Control group (healthynonperiodontitis) (119873 = 156)controls were screened using a WHO probe and theCPITN (Community Periodontal Index of TreatmentNeeds) was assessed [37] values of the CPITN indexin controls were less than 3

In order to adjust for the effect of smoking historyon periodontal disease the subjects (patients and controls)were classified into the following groups subjects whonever smoked (referred to as nonsmokers) and subjects whowere former smokers for ge5 pack years or current smokers(referred to as smokers) The pack years were calculated bymultiplying the number of years of smoking by the averagenumber of cigarette packs smoked per day

23 Genetic Analysis

231 Isolation of Genomic DNA DNA for genetic analysiswas extracted from the peripheral blood leukocytes usingstandard phenolchloroform procedures with proteinase Kaccording to Sambrook et al [38] Isolation and storage ofDNA (working samples at concentrations of 50 ng120583Lminus1 at4∘C) as well as the genotyping of samples were conducted inthe laboratory of theDepartment of Pathophysiology Facultyof Medicine Masaryk University Brno Czech Republic









3 Results














CP119873 = 278 () 119875 value

lowast OR(95 CI)

AgP119873 = 58 () 119875 value

lowast OR(95 CI)



IL8 +396TG(rs2227307)


IL8 +781CT(rs2227306)











CP119873 = 556 () 119875

a OR (95 CI) AgP119873 = 116 () 119875


IL8+396TG(rs2227307)

IL8 +781CT(rs2227306)






Controls119873 = 156 ()

CP119873 = 278 () 119875

a OR (95 CI) AgP119873 = 58 () 119875

a OR (95 CI)








336(020ndash5597)



506(029ndash8700)










4 Discussion











Acknowledgments


References



















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
























3 Results














CP119873 = 278 () 119875 value

lowast OR(95 CI)

AgP119873 = 58 () 119875 value

lowast OR(95 CI)



IL8 +396TG(rs2227307)


IL8 +781CT(rs2227306)











CP119873 = 556 () 119875

a OR (95 CI) AgP119873 = 116 () 119875


IL8+396TG(rs2227307)

IL8 +781CT(rs2227306)






Controls119873 = 156 ()

CP119873 = 278 () 119875

a OR (95 CI) AgP119873 = 58 () 119875

a OR (95 CI)








336(020ndash5597)



506(029ndash8700)










4 Discussion











Acknowledgments


References



















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of

























CP119873 = 278 () 119875 value

lowast OR(95 CI)

AgP119873 = 58 () 119875 value

lowast OR(95 CI)



IL8 +396TG(rs2227307)


IL8 +781CT(rs2227306)











CP119873 = 556 () 119875

a OR (95 CI) AgP119873 = 116 () 119875


IL8+396TG(rs2227307)

IL8 +781CT(rs2227306)






Controls119873 = 156 ()

CP119873 = 278 () 119875

a OR (95 CI) AgP119873 = 58 () 119875

a OR (95 CI)








336(020ndash5597)



506(029ndash8700)










4 Discussion











Acknowledgments


References



















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of



















CP119873 = 556 () 119875

a OR (95 CI) AgP119873 = 116 () 119875


IL8+396TG(rs2227307)

IL8 +781CT(rs2227306)






Controls119873 = 156 ()

CP119873 = 278 () 119875

a OR (95 CI) AgP119873 = 58 () 119875

a OR (95 CI)








336(020ndash5597)



506(029ndash8700)










4 Discussion











Acknowledgments


References



















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of


















4 Discussion











Acknowledgments


References



















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















Acknowledgments


References



















































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of










































of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















clinical study haplotype analysis of interleukin-8 gene...

Documents