Cloning and Expression of a cholera toxin Beta subunit in Escherichia coli

Habib Zeighami1, Morteza Sattari

1*

1*Department of Bacteriology,

Tarbiat Modares University,

Tehran, Iran 1zeighami@modares.ac.ir

1* Sattarim@modares.ac.ir

Abstract Cholera is an acute infection of the intestine caused by the bacterium Vibrio cholerae. This bacterium, a member of the

family Vibrionaceae, is a facultatively anaerobic, Gram-negative, non-spore-forming curved rod, about 1.4–2.6 mm long,

capable of respiratory and fermentative metabolism. Cholera characterized by numerous, voluminous watery stools, often

accompanied by vomiting (bicarbonate loss). One of the most important virulence factors of cholera is enterotoxins

(ctxAB). Beta subunit (CTB) is a pentameric non-toxic portion of cholera toxin, responsible for the holotoxin binding to

the GM1-ganglioside receptor present on most nucleated cells. When conjugated to autoantigens, the CTB dramatically

increases their tolerogenic potential after oral administration. In this study Hypertoxigenic Vibrio cholera strain was used

for amplification of CTB gene. At first PCR with specific primer were done for CTB gene and amplified this gene by Pfu

enzyme. Then we did double digestion and insersion of CTB gene in pET-28 vector and DH5α for cloning. After cloning

pET plasmids which contain CTB gene plasmids extracted from bacteria and transformed to expression host and then

select the positive colony. After that we culture the positive bacteria and induct with IPTG then done SDS-PAGE and

Western blotting for protein determination. Our results show that use of expression host such as Escherichia coli witch

easily growth can be used for production of CTB protein. Although optimal conditions for expression included choice of

host strain, temperature used for culturing, and concentration of antibiotic and inducer. Beta subunit has many important

scientific applications. There is a great deal of interest in the use of CTB as an adjuvant for vaccines targeted for delivery

to the mucousa-associated lymphatic tissues. Because of Beta subunit of Vibrio cholera entrotoxin has multi function

such as in oral vaccine preparation it seems that we can use prokaryotic system (such as Escherichia coli) for production

of this protein.

Key words: Cloning, CTB, Escherichia coli Expression, pET-28, Vibrio cholera

Introduction

Cholera toxin B subunit (CTB) is the pentameric

non-toxic portion of cholera toxin (CT),

responsible for the holotoxin binding to the GM1

ganglioside receptor present on most nucleated

cells [1, 2, 3, and 4]. When conjugated to

autoantigens, the CTB dramatically increases

their tolerogenic potential after oral

administration [1-11].

In many developing countries, cholera is an

important cause of disease and mortality in

children, and therefore, represents an important

public health problem in the world today[1]. The

symptoms of cholera are mainly induced by

cholera toxin (CT), an 85 kDa protein composed

of A (CTA) and B (CTB) subunits combined in

an AB5 holotoxin. CTA, composed of 2

polypeptides (22 and 5 kDa), is responsible for

the toxic activity, through the activation of

cellular adenylate cyclase by Gs-ADP

ribosylation. As a result, cAMP accumulates in

the intestinal mucosal cells, leading to the

characteristic severe diarrhea of cholera [2, 3].

CTB (11.6 kDa) binds to the GM1 ganglioside at

cellular surface and promotes the endocytosis of

CT. CTB has been described as a potent

immunogen in the intestinal and nasal mucosal

sites [4–7], a mucosal adjuvant for oral and nasal

vaccines [8,9] and a transmucosal carrier

PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE

ISBN: 978-960-474-148-9 19 ISSN: 1790-5095

delivery system for induction of oral tolerance

when conjugated to autoantigens and allergens

[7,8, 9 and 12].

CTB is a pentameric non-toxic portion of cholera

toxin, responsible for the holotoxin binding to

the GM1-ganglioside receptor present on most

nucleated cells. When conjugated to

autoantigens,

the CTB dramatically increases their tolerogenic

potential after oral administration [8–14]. This

effect is probably mediated by the ability of CTB

to act as a mucosal carrier system [9], although

CTB might also have direct effects on the

immune system [15, 16]. Recent studies have

showed that CTB is an effective mucosal

adjuvant in potentiating immune responses or

increasing immunological tolerance to

corresponding antigens [13, 15–19]. These

investigations indicate that CTB is a powerful

edible vaccine if expressed in large-scale

production in an edible tissues or organism [20].

CTB is not only a candidate vaccine antigens but

also can function as an effective carrier to

facilitate induction of mucosal immune response

and has been used as a mucosal carrier molecule

for chemically or genetically conjugated

autoantigens for the induction of oral

tolerance[5].

We synthesized the CTB gene (ctxB) using of

Escherichia coli. Recombinant 6XHis-tagged

CTB (rCTB) was expressed in E.coli (BL21) and

characterized by SDS-PAGE and Western blot

analyses. In the present study, we report high

yield expression of recombinant CTB fused to a

C-terminal and N- terminal His-tag in E.coli.

Materials and methods

1. Bacterial strains, vector and media

Bacterial strains was kindly provided from

Institute Pasture, Tehran, Iran. Vector, media and

E. coli strains DH5α and BL-21(DE3) pLysS

were obtained from Invitrogen and Novagen

(USA). Plasmid pET-28a as expression vector

was purchased from Novagen. Bacteria were

cultured in LB broth or on agar (Merck,

Germany) with or without 30 µg kanamycin/ml

(Sigma, USA).

2. Isolation of CTB

The genomic DNA from Vibrio cholera 62013

was extracted using a genomic DNA extraction

kit (Fermentas, Lithonia). The specific primers

were designed according to CTB sequences of

Vibrio cholera 62013 from NCBI. The full

coding sequence of CTB was amplified by

polymerase chain reaction (PCR) using specific

primers containing Hind III and XhoI sites. The

sequence of the forward primer was: 5'-

ATTAAGCTTCCATGATTAAATTAAAATTT

GG -3' and reverse was: 5'-

ATCCTCGAGATTTGCCATACTAATTGCG-

3'. Amplifications were carried out in 25 µl

volumes containing 0.6 l M of each primer, 2.5

µl PCR buffer, 1.5 mM MgSO4, 0.2 mM

nucleotide (dATP, dCTP, dGTP, and dTTP), 2.5

U of Pfu DNA polymerase (Fermentas) and 300

ng genomic DNA. PCR was carried out in a

master gradient thermocycler (Eppendorf,

Germany).The gene amplification conditions

were as follows: 94°C (6 min), 30 cycles

consisting of 94°C (60 s), 55°C (60 s), and 72°C

(60 s) and an additional extension time at 72°C

(5 min). PCR product was separated by

electrophoresis on 1% (w/v) agarose gel

(Fermentas) and the desired fragment was

recovered from the gel using high pure PCR

purification kit (Roche, Germany) [23].

3. Cloning and construction of expression

plasmid

The purified fragment and the vector were

digested by respective restriction enzymes. The

fragment was ligated to the pET-28a vector. The

ligation product was transformed into competent

E. coli DH5α and transformants were selected on

LB agar plates containing 30 µg kanamycin/ml.

The selected clones were further analyzed by

restriction enzymes and PCR and finally

sequenced by a commercial facility using

universal forward and reverse T7-promoter and

PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE

ISBN: 978-960-474-148-9 20 ISSN: 1790-5095

T7-terminator primers (TAG Copenhage A/S

Symbion, Denmark).

4. Expression

For expression, the recombinant plasmid, pET-

28a/CTB, was transformed into competent E.

coli BL-21 (DE3) pLysS. E.coli cells harboring

expression vector pET-28a/CTB were grown in

LB medium supplemented with kanamycin (30

µg/ml) at 37°C to an OD600 = 0.7. For

induction, IPTG (Sigma, USA) was added to a

final concentration of 1 mM and the culture was

grown at 37°C for 4 h. The cells were

subsequently harvested and suspended and

product was verified using 12% (w/v) SDS-

PAGE.

5. Western blot analysis

The proteins separated by SDS-PAGE were

blotted onto polyvinylidene difluoride (PVDF)

membrane (Hi-bond Amersham Biosciences,

USA) by using a semidry blotter unit (Labconco,

Kansas City, Mo.). The membrane was blocked

by 1% (w/v) skim milk according to standard

procedures. The native immune serum was

diluted to 1:1,000 in phosphate-buffered saline

(PBS)-0.1% (v/v) Tween 20 and incubated 3 h at

4°C with shaking. Block membranes were

washed with PBS-Tween 20 and then incubated

with affinity purified goat anti-rabbit

immunoglobulin G (heavy and light chain)

horseradish peroxidase (HRP) conjugate

antibody (Bio-Rad), at a 1:2,500 dilution in PBS-

Tween 20. Membranes were then washed three

times with PBS-Tween 20 and development

using DAB solution (Sigma, USA) [23].

Results

Construction of the pET-28a/CTB Specific

primers were designed to amplify CTB gene

from the Vibrio cholera strain 62013. The

expected size of the PCR product, approximately

375 bp, was obtained (Fig. 1). Existence of insert

(CTB) in recombinant vector, pET-28a/CTB,

was also detected by digestion using XhoI and

Hind III restriction enzymes and finally the

identity and orientation of CTB in the construct

were confirmed by DNA sequencing (Data not

shown).

Fig1. Electrophoresis of PCR product on agarose gel (1% w/v).

Lane 1, 1 kb DNA size marker, lane 2, 3 and 4, Single expected band

of CTB (approximately 375 bp)

The E. coli BL21 (DE3) pLysS was transformed

with the recombinant expression vector, pET-

28a/CTB, and induced with IPTG and

accumulated large amounts of a protein

migrating in SDS-PAGE with an apparent

molecular weight of approximately 20 kDa (Fig.

3,lane 5 and 6).

To detect antigenicity of expressed protein

Western blot analysis was performed. The major

band observed in SDS-PAGE (20 kDa) was

confirmed as CTB protein by western blot

analysis with rabbit serum antinative CTB which

indicates apparent molecular mass of 20 kDa and

its immune-reactivity.

Discussion

375

PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE

ISBN: 978-960-474-148-9 21 ISSN: 1790-5095

The expression of recombinant proteins is a

promising and relatively inexpensive method by

which vaccines could be produced directly ‘‘on

site’’ [22-24]. On the other hand, mucosally

administered conjugates of CTB and various

antigens have been shown to suppress the

development of progress of a number of

autoimmune diseases in animal models. The oral

administration of CTB-based autoantigens has

been shown to have a protective effect against

autoimmune diabetes in animal models [1-10

and 24].

It has been assumed that among nonliving

immunogens, only those with mucosa-binding

and possibly also immunostimulatory properties

can induce local and systemic immune responses

without inducing systemic immunological

tolerance, when administered by a mucosal

route. A notable example is CT, one of the most

potent mucosal immunogens, which, when

administered orally with an unrelated antigen,

can also prevent induction of systemic tolerance

to that antigen. These unusual features can be

partly explained by the ability of CTB to bind

avidly to GM1 on cell surfaces, and to the ADP-

ribosylating action of the toxic A subunit of CT.

Based on these observations, mucosal

administration of antigen coupled to mucosa-

binding molecules such as CT or CTB has been

proposed as a strategy to induce local and

systemic immune responses rather than systemic

tolerance [25].

In these study we able to cloned and expressed

CTB in Escherichia coli. Our study showed that

Escherichia coli is a suitable host to cloned and

expressed the CTB. Because the growing rate

and expression yield of Escherichia coli is high,

this bacterium is useful for this reason. Although

we can use of Escherichia coli for large scale

production of CTB.

Fig2. SDS-PAGE(12% w/v) electrophoresis of expression product.

1, 2 and 3 non induct samples. 4: Pr marker, 5 and 6: induction

samples with IPTG.

References

1. Zhao-Hui Gong, Hui-Qing Jin, Yong-Feng Jin,

and Yao-Zhou Zhang. Expression of Cholera

Toxin B Subunit and Assembly as Functional

Oligomers in Silkworm. Journal of Biochemistry

and Molecular Biology, Vol. 38, No. 6 November

2005, pp. 717-724,

2. Cuatrecasas, P. Gangliosides and membrane

receptors for cholera toxin. Biochemistry. 1973;

12:3558-3566.

3. Pierre, P., Denis, O., Bazin, H., Mbongolo, E. M.

and Vaerman, J. P. Modulation of oral tolerance

to ovalbumin by cholera toxin and its B subunit.

Eur. J. Immunol. 1992; 22: 3179-3182.

PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE

ISBN: 978-960-474-148-9 22 ISSN: 1790-5095

4. Sun, J. B., Holmgren, J. and Czerkinsky, C.

Cholera toxin B subunit: An efficient

transmucosal carrier-delivery system for

induction of peripheral tolerance. Proc. Natl.

Acad. Sci. USA.1994; 91: 10795-10799.

5. Sun, J. B., Li, B. L., Czerkinsky, C. and

Holmgren, J. Enhanced immunological tolerance

against allograft rejection by oral administration

of allogenic antigen linked to cholera toxin B

subunit. Clin. Immunol. 2000; 97: 30-139.

6. Sun, J. B., Rask, C., Olson, T., Holmgren, J. and

Czerkinsky, C. Treatment of experimental

autoimmune encephalomyelitis by feeding myelin

basic protein conjugated to cholera toxin B

subunit. Proc. Natl. Acad. Sci. USA. 1996;

93:7196-7201.

7. Bregenholt, S., Wang, M., Wolfe, T., Hughes, A.,

Baerentzen, L., Dyrberg, T., von Herrath, M. G.

and Petersen, J. S. The cholera toxin B subunit is

a mucosal adjuvant for oral tolerance induction in

type 1 diabetes. Scand. J. Immunol. 2003;57:

432-438.

8. Li, T. K. and Fox, B. S. Cholera toxin B subunit

binding to an antigen presenting cell directly co-

stimulates cytokine production from a T cell

clone. Int. Immunol. 1996; 8: 1849-1856.

9. Holmgren, J., Adamsson, J., Anjuere, F.,

Clemens, J., Czerkinsky, C., Eriksson, K., Flach,

C. F., George-Chandy, A., Harandi, A. M.,

Lebens, M., Lehner, T., Lindblad, M., Nygren, E.,

Raghavan, S., Sanchez, J., Stanford, M., Sun, J.

B., Svennerholm, A. M. and Tengvall, S. Mucosal

adjuvants and anti-infection and anti-

immunopathology vaccines based on cholera

toxin, cholera toxin B subunit and CpG DNA.

Immunol. Lett. 2005; 97: 181-188.

10. Zhang, P., Yang, Q. B., Balkovetz, D. F., Lewis,

J. P., Clements, J. D., Michalek, S. M. and Katz,

J. Effectiveness of the B subunit of cholera toxin

in potentiating immune responses to the

recombinant hemagglutinin/adhesin domain of

the gingipain Kgp from Porphyromonas

gingivalis. Vaccine. 2005; 23: 4734-4744.

11. Ana Paula de Mattos Areas, Maria Leonor

Sarno de Oliveira Celso Raul Romero Ramos,

Maria Elisabete Sbrogio-Almeida, Isa Raw, and

Paulo Lee Hoa. Synthesis of cholera toxin B

subunit gene: cloning and expression of a

functional 6XHis-tagged protein in Escherichia

coli. Protein Expression and Purification. 2002;

25: 481–487.

12. A. Rudin, G.C. Riise, J. Holmgren, Antibody

responses in the lower respiratory tract and male

urogenital tract in humans after nasal and oral

vaccination with cholera toxin B subunit, Infect.

Immun. 1999; 67: 2884–2890.

13. C. Bergquist, E.V. Johansson, T. Lagergard, J.

Holmgren, A. Rudin, Intranasal vaccination of

humans with recombinant cholera toxin B subunit

induces systemic and local antibody responses in

the upper respiratory tract and the vagina, Infect.

Immun. 1997; 65: 2676–2684.

14. S. Tamura, Y. Samegai, H. Kurata, T. Nagamine,

C. Aizawa, T. Kurata, Protection against

influenza virus infection by vaccine inoculated

intranasally with cholera toxin B subunit,

Vaccine.1998; 6: 409–413.

15. C. Czerkinsky, M.W. Russell, N. Lycke, M.

Landblad, J. Holmgren, Oral administration of a

streptococcal antigen coupled to cholera toxin B

subunit evokes strong antibody responses in

salivary glands and extramucosal tissues, Infect.

Immun.1989; 57: 1072–1077.

16. U. Wiedermann, B. Jahn-Schmid, M. Lindblad,

C. Rask, J. Holmgren, D. Kraft, C. Ebner,

Suppressive versus stimulatory effects of

allergen/cholera toxoid (CTB) conjugates

depending on the nature of the allergen in a

murine model of type I allergy, Int.

Immunol.1999; 11: 1717–1724.

17. I. Bergerot, C. Ploix, J. Petersen, V. Moulin, C.

Rask, N. Fabien, M. Lindblad, A. Mayer, C.

Czerkinsky, J. Holmgren, C. Thivolet, A cholera

toxoid-insulin conjugate as an oral vaccine

against spontaneous autoimmune diabetes, Proc.

Natl. Acad. Sci. USA 1997; 94: 4610–4614.

18. J.B. Sun, C. Rask, T. Olsson, J. Holmgren, C.

Czerkinsky, Treatment of experimental

autoimmune encephalomyelitis by feeding myelin

basic protein conjugated to cholera toxin B

subunit, Proc. Natl. Acad. Sci. USA 1996; 93:

7196–7201.

19. C. Czerkinsky, J.B. Sun, M. Lebens, B.L. Li, C.

Rask, M. Lindblad, J. Holmgren, Cholera toxin B

subunit as transmucosal carrier-delivery and

immunomodulating system for induction of

antiinfectious and antipathological immunity,

Ann. N. Y. Acad. Sci. 1996; 778: 185–193.

20. J.B. Sun, J. Holmgren, C. Czerkinsky, Cholera

toxin B subunit: an efficient transmucosal carrier-

delivery system for induction of peripheral

immunological tolerance, Proc. Natl. Acad. Sci.

USA. 1994; 91: 10795–10799.

21. Zhaohui Gong, Xiang Long, Lin Pan, Yanping

Le, Qiong Liu, Shaomin Wang , Junming Guo,

Bingxiu Xiao, Mi Zhou, Disen Mei. Cloning,

expression, purification and characterization of

the cholera toxin B subunit and triple glutamic

acid decarboxylase epitopes fusion protein in

PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE

ISBN: 978-960-474-148-9 23 ISSN: 1790-5095

Escherichia coli. Protein Expression and

Purification .2009; 66: 191–197.

22. C. Rask, J. Holmgren, M. Frederiksson, M.

Lindblad, I. Nordström, J.B. Sun, C. Czerkinsky,

Prolonged oral treatment with low doses of

allergen conjugated to cholera toxin B subunit

suppresses immunoglobulin E antibody responses

in sensitized mice, Clin. Exp. Allergy.2000; 30:

1024–1032.

23. Gholamreza Goudarzi, Morteza Sattari, Mehryar

Habibi Roudkenar Mehran, Montajabi-Niyat,

Ahmad Zavaran-Hosseini, Kamran Mosavi-

Hosseini. Cloning, expression, purification, and

characterization of recombinant flagellin isolated

from Pseudomonas aeruginosa. Biotechnol Lett.

2009; 31:1353–1360.

24. Young-Sook Kim, Bang-Geul Kim, Tae-Geum

Kim, Tae-Jin Kang, Moon-Sik Yang. Expression

of a cholera toxin B subunit in transgenic lettuce

(Lactuca sativa L.) using Agrobacterium-

mediated transformation system. Plant Cell Tiss

Organ Cult.2006; 87:203–210.

25. Jia-Bin Sun, Janholmgren and Cecil Czerkinsky.

Cholera toxin B subunit: An efficient

transmucosal carrier-delivery system for

induction of peripheral immunological tolerance.

Proc. Nadl. Acad. Sci. USA. 1994; 91: 10795-

10799.

PROCEEDINGS OF THE 3RD INTERNATIONAL CONFERENCE ON ENERGY AND DEVELOPMENT - ENVIRONMENT - BIOMEDICINE

ISBN: 978-960-474-148-9 24 ISSN: 1790-5095