Molecular & Biochemical Parasitology 130 (2003) 133–138

Short communication

Cloning of 5′ and 3′ flanking regions of theSchistosoma mansonicalcineurin A gene and their characterization in

transiently transformed parasites�

Alessandro Rossia,∗,1, Volker Wipperstegb,1, Mo-Quen Klinkerta, Christoph G. Greveldingba Department of Parasitology, Institute for Tropical Medicine, University of Tübingen, Wilhelmstrasse 27, Tübingen 72074, Germany

b Institute for Genetics, Heinrich-Heine-University, Düsseldorf, Germany

Received 31 March 2003; received in revised form 23 May 2003; accepted 28 May 2003

Keywords: Schistosoma mansoni; Calcineurin promoter; Protonephridium; Particle bombardment; GFP

Calcineurin (CN) is a Ca2+/calmodulin dependentserine-threonine protein phosphatase conserved in eukary-otic cells (reviewed in Ref.[1]). The protein is composedof a catalytic A subunit (CNA) and a regulatory B subunit(CNB), the latter being indispensable for the basal activity ofthe enzyme. Upon calmodulin binding, an autoinhibitory do-main in the C-terminal portion of subunit CNA is displacedfrom the catalytic site, resulting in a 20-fold stimulation ofthe basal activity (reviewed in Ref.[1]). Once activated, CNcan carry out the dephosphorylation of many different tar-get proteins involved in the regulation of gene expression,ion homeostasis and other crucial cellular processes, suchas apoptosis or cytokinesis (reviewed in Ref.[1]).

In a previous study, we cloned and characterized CNsubunits A and B from the blood flukeSchistosoma man-soni [2]. By immunofluorescence the protein was localizedin the tegument, the excretory tubules and at the root of theexcretory system in the so-called flame cells of all life cy-cle stages ([2]; Rossi, unpublished results). Flame cells aresmall ciliated cells, distributed in the parasite parenchyma,and connected to a network of excretory tubules terminatingin the excretory pores (reviewed in Ref.[3]). These cellsare believed to collect catabolites and body fluids from theparenchyma through an ultrafiltration process and to drivethem into the tubular network of the protonephridium forexcretion. Such a protonephridial system based on flame

� Note: Nucleotide sequence data reported in this paper are availablein the GenBankTM database under accession numbers AY254855 andAY254856.

∗ Corresponding author. Tel.:+49-7071-2986020;fax: +49-7071-295189.

E-mail address: alessandrorossi@gmx.de (A. Rossi).1 Both authors have contributed equally to this work.

cell activity is commonly found in many invertebrates butso far, very little experimental work has been carried outto link a function to the observed morphological structures(reviewed in Ref.[3]).

Besides CN, other schistosome enzymes have beenmapped to the excretory system, but nothing is knownabout the regulation of their activities at the molecularlevel. Immunolocalization and transgene expression studieshave so far confirmed the expression of the proteases ER60,Sm31 and Sm32 in the protonephridia of different life cy-cle stages of the parasite[4–6], and structures related tothe protonephridial system have also been microscopicallyvisualized using specific dyes[7] or monoclonal antibodiesrecognizing unknown schistosome antigens[2,8].

As a first step to identify and characterize regulatory ele-ments of the SmCNA gene, we cloned its 5′-upstream and3′-downstream regions. Based on the sequence of the previ-ously characterized SmCNA cDNA[2], appropriate primersGSP1 and GSP2 were designed around the ATG codon andused for PCR-based genome walking[9] (Fig. 1). This ledto the identification of additional 1358 bp upstream of thestart codon (accession number AY254855). A genomic walkPCR in the 3′ direction, using the forward primers 3UTR1and 3UTR2, allowed the identification of a sequence of572 bp downstream the TAA stop codon (accession numberAY254856). The isolated genomic sequences were furthercharacterized by 5′ RACE and 3′ RACE in order to map the5′ end and the polyadenylation site in SmCNA transcript.

Using RNA from adult worms as template and the GSP1and GSP2 primers for amplification, the 5′ RACE yieldeda single PCR product of less than 200 bp, suggesting thepresence of a single transcription start site. The ampliconwas cloned in the pCR 2.1-TOPO sequencing vector, and10 randomly chosen clones were sequenced. Eight of the

0166-6851/$ – see front matter © 2003 Elsevier B.V. All rights reserved.doi:10.1016/S0166-6851(03)00158-0

134 A. Rossi et al. / Molecular & Biochemical Parasitology 130 (2003) 133–138

Fig. 1. (A) Sequence of SmCNA promoter obtained using the Universal Genome Walker Kit (Clontech). Briefly, genomic DNA was digested with theblunt-end restriction enzymePvuII and ligated to adaptor oligonucleotides provided in the kit. This ligated product was then PCR amplified using theadaptor-specific primer AP1 and the SmCNA gene-specific primer GSP1 (5′GACAATGCGATCAACTGTCGGCAGTTT). A 1:50 dilution of the primaryPCR product served as template for a second amplification using the nested primers AP2 and GSP2 (5′TGTTTCTGATCGCGTCATTAGTGTTGA).Nested PCR products were gel purified, cloned into a T/A TOPO cloning vector pCR 2.1-TOPO (Invitrogen) and sequenced. A similar strategy wasfollowed to isolate the 3′ flanking sequence using the SmCNA specific primers 3UTR1 (5′CCAGTGCCAAGACCACCATCGATTTGTG) and 3UTR2(5′GAACACTCATCTGATGACGATAATGTTGG) and AP1/AP2. Within the promoter sequence, transcription factor binding sites and a putative Inr

A. Rossi et al. / Molecular & Biochemical Parasitology 130 (2003) 133–138 135

cloned sequences indicated that the transcriptional start site(labeled+1 in Fig. 1A) is probably located 118 bp upstreamof the ATG codon. The fact that the majority of sequenceswas of this length, led us to conclude that transcription startsat this position. Two shorter clones, which revealed a startat 86 bp upstream of the ATG codon, may be the product ofRNA degradation or incomplete reverse transcription. Thepostulated start site is embedded in a putative Inr elementin perfect accordance with the consensus YYA+1NWYY(where A is the start site; W is A/T and Y a pyrimidine)[10](Fig. 1A). Performing 3′ RACE of adult worms RNA usingthe 3UTR1 and 3UTR2 primers, we were able to identifya polyadenylation site 139 bp downstream of the TAA stopcodon and a noncanonical polyadenylation signal (AATATA)25 bp upstream of the poly(A) site.

In order to test whether SmCNA tissue-specific expres-sion is regulated bycis-acting elements in the 5′ and 3′flanking sequences, we subcloned them in a green fluores-cence protein (GFP) expression vector to evaluate the reg-ulation of transgene expression in transiently transformedparasites. SmCNA 5′ and 3′ flanking sequences were lig-ated to the green fluorescence protein (GFP) open readingframe using the previously described hsp70-GFP expres-sion plasmid as a starting vector[11]. The plasmid construct5′CNA/GFP/3′Hsp70 as the name suggests, carries the Sm-CNA 5′ flanking sequence, whereas the second construct5′CNA/GFP/3′CNA has both the Hsp70 promoter and ter-minator cassettes replaced with the novel SmCNA 5′ and 3′flanking sequences (see also legends toFig. 1B).

Both plasmid constructs were functionally tested bytransient transformation of adult worms using a recentlydeveloped particle bombardment method[11]. Followingbiolistics, worms were examined for GFP fluorescence byconfocal laser scanning microscopy. As expected, wormstransformed with a control plasmid (GFP without pro-moter) did not show any fluorescence (data not shown).In a first set of transformation experiments using bothplasmids 5′CNA/GFP/3′Hsp70 and 5′CNA/GFP/3′CNA,similar GFP expression pattern in the excretory system aswell as in the tegument of the transformed parasites wasobserved. This suggested that the SmCNA 3′ UTR does notcontribute to tissue specificity. The Y-shaped structure be-neath the tegument displaying GFP fluorescence, as shownafter bombardment using the plasmid 5′CNA/GFP/3′CNA

�

element are highlighted in gray: (+) or (−) indicate the relative orientation of the core consensus. The transcription start site overlapping Inr is indicatedby +1. The numbers that follow correspond to the positions of some of the transcription factor binding sites (see text for details) and also delimit the5′ end of the isolated sequence. The 5′ UTR of the transcript, determined by 5′ RACE, is underlined and the ATG start codon is indicated (Met). 5′and 3′ RACE-PCR protocols were based on the instructions of the 5′/3′ RACE-PCR Kit (Roche). A common S8/GATA element was observed in boththe SmCNA promoter as well as in the promoter of cysteine protease gene ER60, both of which are aligned after gap insertion. Identical nucleotidesare shaded in black. (B) Construction of the 5′CNA/GFP/3′CNA plasmid. The previously described hsp70-GFP expression plasmid[11] was treated withEcoRI and Klenow polymerase, followed byNcoI. The Hsp70 promoter cassette removed in this way was replaced by the SmCNA 5′ flanking regioncassette, which had been previously digested withSmaI and NcoI. The resulting product was the 5′CNA/GFP/3′Hsp70 plasmid. The Hsp70 terminatorsequences were then removed by aBamHI and SalI digestion and replaced with the SmCNA 3′ flanking sequence cassette treated in the same way toyield the final 5′CNA/GFP/3′CNA plasmid. The backbone vector is pUC18 (accession number L08752). Only the restriction sites used in the subcloningprocedures are shown. The ampicillin resistance selection marker is also shown (AmpR).

(Fig. 2A), probably represents a branch of the excretorytubules, which terminate with the flame cells. In order toverify this observation, we repeated the particle bombard-ment experiment and simultaneously labeled worms usingthe fluorescent dye Texas Red BSA (TxR-BSA), which isknown to specifically tag the excretory system[7]. Due totechnical constraints, this second set of experiments wascarried out using the plasmid 5′CNA/GFP/3′CNA only. Thebombarded worms were analyzed under the confocal micro-scope for GFP staining (Fig. 2B) and for TxR-BSA staining(Fig. 2C). Again, GFP signals were detected in Y-shapedbranches and found to colocalize with the Texas Red signal(merged image inFig. 2D). In both sets of experiments,GFP expression was also observed in the tegumental areaof the parasite (Fig. 2F).

Our data show that a 1.2 kb region upstream of the tran-scription start site of the SmCNA promoter is sufficient todirect GFP expression to the protonephridial system andthe tegument (Fig. 2). These results are consistent withthe immunofluorescence pattern obtained with adult andlarval worms using an anti-SmCNA antiserum. CNA pro-tein was in fact detected in the excretory tubules and thetegument of adults and within the flame cells of larvaeand adults[2]. However, the lack of GFP expression inthe flame cells of adult worms is an unexpected result,but could possibly be explained by a failure of the goldparticles to precisely hit these structures during the bom-bardment procedure. An indication that this could be thecase comes from preliminary bombardment experimentsusing in vitro transformed sporocysts. Larvae transientlytransformed with the 5′CNA/GFP/3′CNA plasmid exhib-ited GFP expression in two distinctively spotted structures,which could be interpreted as spots corresponding to flamecells (data not shown). However, this finding remains tobe confirmed in colocalization experiments using anti-GFPand anti-SmCNA antibodies.

The GFP expression results obtained using the 5′CNA/GFP constructs were similar to data recently reported for theexpression of GFP under the control of the ER60 promoter[5]. In this study, reporter gene activity was also observedin the branches of the excretory tubules of adult worms. Inview of the similar GFP expression pattern obtained in theexcretory system with both ER60 and SmCNA promotersequences, we searched for common motifs that may be

136 A. Rossi et al. / Molecular & Biochemical Parasitology 130 (2003) 133–138

Fig. 2. GFP expression in the excretory system and the tegument of schistosomes. Gold particles of 0.6 or 1.6�m in diameter, used as microprojectiles,were coated with 5�g of column-purified 5′CNA/GFP/3′CNA plasmid DNA and directed at male adult worms using the PDS 100/HE particle bombardmentsystem (Bio-Rad). Conditions were set at 1550 psi helium pressure, 15–20 in.Hg of chamber vacuum and a target distance of stage 1 (3 cm). Worms werewashed once with medium and cultured for further 48 h. Counterstaining of the excretory tubules was performed by incubating the worms for 30 min inculture medium containing TxR-BSA (Molecular Probes; 10�g/ml) prior to microscopic examination. (A) GFP expression is observed in the excretorytubules and indicated by the asterisks. (B) A different Y-shaped structure from a second bombardment experiment also displays GFP fluorescence (see textfor details). (C) The structure is verified to be a branch of an excretory tubule by counterstaining with TxR-BSA. (D) Merged images of B and C confirmthe colocalization of GFP and TxR-BSA. The bars correspond to 20�m (A–D). (E) Bright field view of a worm bombarded with 5′CNA/GFP/3′CNA.(F) The same specimen displays GFP expression in the tegument. Indicated are the dorsal tegument (dt) and the tubercules (tu). Scale bars of 100�mare shown (E and F).

A. Rossi et al. / Molecular & Biochemical Parasitology 130 (2003) 133–138 137

responsible for tissue specificity. Promoter sequences wereanalyzed for conserved transcription factor binding sites us-ing the program Mat Inspector[12] available on the TRANS-FAC web site (http://transfac.gbf.de/TRANSFAC/).

Within the ER 60 promoter sequence (276 bp) used inthe transgene analyses[5,13], we indeed found a commonmotif of 25 nucleotides at position−131, consisting ofa S8 homeodomain binding site followed by an invertedGATA element (Fig. 1). The homeobox protein S8 belongsto the paired homeodomain subfamily, including alsoS.mansoni homologs[14], and binds to the consensus WN-NANYYAATTANYNN ( [15]; TRANSFAC website) whilethe Cys4 zinc finger GATA factors bind to a core consensusWGATAR (W = A/T, R = A/G) [16]. A similar S8/GATAbinding site encompassing a stretch of 27 nucleotides ispresent in the SmCNA sequence at position−296 (Fig. 1).

Besides the presence of this common motif, sequenceanalyses of the SmCNA promoter revealed other interestingfeatures. In addition to the inverted GATA box adjacentto the S8 element at position−275, two other GATA-likeelements were also found at positions−340 and−267.Interestingly, the GATA boxes at positions−275 and−267are in opposite orientation to each other and form a palin-drome TATCTNNAGATA. Experiments carried out onvertebrate sequences have shown that the interaction ofGATA-1 transcription factors is stronger at a palindromicsite than at a single GATA site[17]. Therefore, it is rea-sonable to assume that the schistosome GATA palindromecould have the function to bind relevant transcription fac-tors strongly. In the distal portion of SmCNA promoter wefound four binding sites for transcription factors of the forkhead/winged helix family. This includes theDrosophilafactor fork head (fkh) and the vertebrate hepatocyte nuclearfactor-3 (HNF-3)/fork head homolog (HFH) proteins, whichare expressed in Malpighian tubules in insects and in thedistal tubules of vertebrate kidney. Both are also involvedin the development of these organs[18,19]. The boxes atpositions−1035 and−990 completely match the HFH-8consensus NNNTGTTTATNYR (refer to the TRANSFACtranscription factor databasewww.transfac.gbf.de). On theother hand, the box at position−818 has two mismatchescompared to the HFH-3 consensus DBDTRTTTRYDTD(D is not C, B is not A, R= A/G, Y = A/T) [19], whilethe box at position−773 has one mismatch comparedto the HFH-8 consensus. Blast search analysis revealedthe existence of homologs of a HFH-8 transcription fac-tor in S. japonicum (accession number BU719394) and aforkhead-like transcription factor inS. mansoni (accessionnumber BH207970), supporting the hypothesis that geneexpression in the excretory system of schistosomes couldalso be regulated by HFH transcription factors.

Five binding sites for the CN-regulated transcription fac-tor NF-AT (nuclear factor of activated T cells), matching thecore consensus GGAAA, were found at positions−1160,−996, −949, −891 and−437. These elements often oc-cur in tandem with AP-1 or Oct elements, forming com-

posite elements involved in tissue-specific gene regulation(reviewed in Ref.[20]; [21]). Interestingly, one of theseNF-AT elements (−949) is adjacent to a canonical Oct-1 siteATGCAAAT [22], an observation that is supportive of thepossibility that this site may be functional in cooperativebinding. Moreover, a notable characteristic of NF-AT reg-ulated promoters is the presence of multiple (three to five)NF-AT sites concentrated within a length of 200–300 bp (re-viewed in Ref.[20]). In agreement with this observation,it is noted that the first four NF-AT sites in the SmCNApromoter are located within a region of 269 bp. The occur-rence of NF-AT binding sites within the SmCNA promotersequence coincides with the presence of NF-AT homologsin Schistosoma, as previously proposed by Serra et al.[23].This finding raises the possibility of a feedback regulationof SmCNA promoter through CN-mediated dephosphoryla-tion of NF-AT in the parasite.

A priority in future experiments will be to analyze thefunctional relevance of the elements found in the Sm-CNA promoter. Particular emphasis will be placed on theS8/GATA site present in both the ER60 and the SmCNApromoters and its importance investigated both by muta-tional analysis and by assessing its presence in the 5′ flank-ing region of other protonephridium expressed genes. Addi-tional work involving the cloning of CNA promoters fromotherSchistosoma species and testing their ability to driveGFP expression in the excretory system inS. mansoni couldlead to the identification of crucial conserved sequencesassociated with tissue-specific gene expression in the pro-tonephridium. Knowledge of functionally relevant genesand understanding how they are regulated in the parasiteexcretory system will help us to specify novel targets andto define new strategies in our fight against schistosomiasis.

Acknowledgements

This work received the financial support of the DeustcheForschungsgemeinschaft (KL 587/6-1 and GR 1549/1-3).

References

[1] Klee CB, Ren H, Wang X. Regulation of the calmodulin-stimulatedprotein phosphatase, calcineurin. J Biol Chem 1998;273:13367–70.

[2] Mecozzi B, Rossi A, Lazzaretti P, et al. Molecular cloning ofSchis-tosoma mansoni calcineurin subunits and immunolocalization to theexcretory system. Mol Biochem Parasitol 2000;110:333–43.

[3] Wilson RA, Webster LA. Protonephridia. Biol Rev Camb Phil Soc1974;49:127–60.

[4] Finken-Eigen M, Kunz W.Schistosoma mansoni: gene structure andlocalization of a homologue to cysteine protease ER60. Exp Parasitol1997;86:1–7.

[5] Wippersteg V, Ribeiro F, Liedtke S, Kusel JR, Grevelding CG. Theuptake of Texas red BSA in the excretory system of schistosomes andits colocalisation with ER60 promoter-induced GFP in transientlytransformed adult males. Int J Parasitol [in press].

138 A. Rossi et al. / Molecular & Biochemical Parasitology 130 (2003) 133–138

[6] Skelly PJ, Shoemaker CB.Schistosoma mansoni proteases Sm31(cathepsin B) and Sm32 (legumain) are expressed in the cecum andprotonephridia of cercariae. J Parasitol 2001;87:1218–21.

[7] Tan HHC, Thornhill JA, Al-Adhami BH, Akhkha A, Kusel JR.A study of the effect of surface damage on the uptake of TexasRed-BSA by schistosomula ofSchistosoma mansoni. Parasitology2003;126:235–40.

[8] Bogers JJ, Nibbeling HA, van Marck EA, Deelder AM. Immunofluo-rescent visualization of the excretory and gut system ofSchistosomamansoni by confocal laser scanning microscopy. Am J Trop MedHyg 1994;50:612–9.

[9] Siebert PD, Chenchik A, Kellogg DE, Lukyanov KA, Lukyanov SA.An improved PCR method for walking in uncloned genomic DNA.Nucleic Acids Res 1995;23:1087–8.

[10] Lo K, Smale ST. Generality of a functional initiator consensussequence. Gene 1996;182:13–22.

[11] Wippersteg V, Kapp K, Kunz W, Jackstadt WP, Zahner H, GreveldingCG. HSP70-controlled GFP expression in transiently transformedschistosomes. Mol Biochem Parasitol 2002;120:141–50.

[12] Quandt K, Frech K, Karas H, Wingender E, Werner T. MatIndand MatInspector—new fast and versatile tools for detection ofconsensus matches in nucleotide sequence data. Nucleic Acids Res1995;23:4878–84.

[13] Wippersteg V, Kapp K, Kunz W, Grevelding CG. Characterisationof the cysteine protease ER60 in transgenicSchistosoma mansonilarvae. Int J Parasitol 2002;32:1219–24.

[14] Webster PJ, Mansour TE. Conserved classes of homeodomainsin Schistosoma mansoni, an early bilateral metazoan. Mech Dev1992;38:25–32.

[15] de Jong R, van der Heijden J, Meijlink F. DNA-binding specificityof the S8 homeodomain. Nucleic Acids Res 1993;21:4711–20.

[16] Patient RK, McGhee JD. The GATA family (vertebrates and inver-tebrates). Curr Opin Genet Dev 2002;12:416–22.

[17] Trainor CD, Omichinski JG, Vandergon TL, Gronenborn AM, CloreGM, Felsenfeld G. A palindromic regulatory site within verte-brate GATA-1 promoters requires both zinc fingers of the GATA-1DNA-binding domain for high-affinity interaction. Mol Cell Biol1996;16:2238–47.

[18] Hoch M, Jackle H. Kruppel acts as a developmental switch genethat mediates Notch signalling-dependent tip cell differentiation inthe excretory organs ofDrosophila. EMBO J 1998;17:5766–75.

[19] Overdier DG, Ye H, Peterson RS, Clevidence DE, Costa RH. Thewinged helix transcriptional activator HFH-3 is expressed in thedistal tubules of embryonic and adult mouse kidney. J Biol Chem1997;272:13725–30.

[20] Rao A, Luo C, Hogan PG. Transcription factors of the NFAT family:regulation and function. Annu Rev Immunol 1997;15:707–47.

[21] Bert AG, Burrows J, Hawwari A, Vadas MA, Cockerill PN. Re-constitution of T cell-specific transcription directed by compositeNFAT/Oct elements. J Immunol 2000;165:5646–55.

[22] Verrijzer CP, Alkema MJ, van Weperen WW, Van Leeuwen HC,Strating MJ, van der Vliet PC. The DNA binding specificity of thebipartite POU domain and its subdomains. EMBO J 1992;11:4993–5003.

[23] Serra EC, Lardans V, Dissous C. Identification of NF-AT-like tran-scription factor inSchistosoma mansoni: its possible involvementin the antiparasitic action of cyclosporin A. Mol Biochem Parasitol1999;101:33–41.