JOURNAL OF BACTERIOLOGY, Oct. 1985, p. 223-229 Vol. 164, No. 10021-9193/85/100223-07$02.00/0Copyright C 1985, American Society for Microbiology

Cloning and Sequencing of the Metallothioprotein ,3-Lactamase IIGene of Bacillus cereus 569/H in Escherichia coli

MUSADDEQ 14USSAIN, ANTHONY CARLINO, M. JANE MADONNA, AND J. OLIVER LAMPEN*Waksman Institute of Microbiology, Rutgers University, Piscataway, New Jersey 08854

Received 8 April 1985/Accepted 28 June 1985

The structural gene for l-lactamase II (EC 3.5.2.6), a metallothioenzyme, from Bacillus cereus 569/H(constitutive for high production of the enzyme) was cloned in Escherichia coli, and the nucleotide sequence wasdetermined. This is the first class B ,l-lactamase whose primary structure has been reported. The amino acidsequence of the exoenzyme form, deduced from the DNA, indicates that P-lactamase II, like other secretedproteins, is synthesized as a precursor with a 30-amino acid N-terminal signal peptide. The pre-I8-lactamase II(Mr, 28,060) is processed in E. coli and in B. cereus to a single mature protein (Mr, 24,932) which is totallysecreted by B. cereus but in E. coli remains intracellular, probably in the periplasm. The expression of the genein E. coli RR1 on the multicopy plasmid pRWHO12 was comparable to that in B. cereus, where it is presumablypresent as a single copy. The three histidine residues that are involved (along with the sole cysteifte of themature protein) in Zn(II) binding and hence in enzymatic activity against ,-lactams were identified. Thesefindings will help to define the secondary structure, mechanism of action, and evolutionary lineage of B. cereusI8-lactamase II and other class B I8-lactamases.

P-Lactamnases are widely distributed in bacteria (10). Theydiffer in their enzymic and molecular properties and arethought to have a polyphyletic origin (2, 3). Some arechromosomally encoded (e.g., the ,-lactamase of Bacilluslicheniformis), while others are plasmid borne (e.g., someP-lactamases of Staphylococcus aureus). P-Lactamases aregrouped into three classes based on size and sequencehomology (3, 19). Some of the secreted 3-lactamnases ofBacillus spp. and Staphylococcus spp. and the periplasmicR6K ,-lactamase carried on pBR322 in Escherichia coli (42)fall in class A. They are highly active on benzylpenicillin,have an Mr of -30,000, and show considerable homologywith one another. They have a serine at the active site andare thought to have diverged from a single ancestral gene (3).Class B P-lactamases are Of Mr -23,000, are almost as activetowards cephalosporins as penicillins, and are metal-lothioenzymes. This class is restricted to B. cereus and veryclosely related bacilli (21) and possibly Pseudomonas mal-tophilia P-lactamase Li (37). Primary structure has not beenreported for any of the class B ,-lactamases. Class C wasadded by Jaurin and Grundstrom (19) to accommodate theampC gene product, a chromosomally encoded ceph-alosporinase of E. coli. It is a mnolecule of Mr -39,000, withno sequence homology to class A enzymes, but it alsofunctions by virtue of an active-site serine (19).

Bacillus cereus is unique among P-lactamase-producingbacteria in that it produces and secretes three different kindsof P-lactamases (12, 31, 33). P-Lactamases I and III are inclass A. At least 50% of the P-lactamase III is retained in themembrane as a lipoprotein (31), but nearly all of P-lactamaseI is secreted to the medium (21). Their exoenzymes have nocysteine residues (12). P-Lactamase II (EC 3.5.2.6), on theother hand, is a class B enzyme. It is totally secreted to themedium (1) and, in contrast to P-lactamases I and III, it is asulfhydryl enzyme of Mr 25,000 and requires a metal cofac-tor, normally Zn(II), for activity. It has been shown to bind

* Corresponding author.

two Zn(II) ions per enzyme molecule (5, 13). Hydrolysis ofbenzylpenicillin by ,B-lactamase II is dependent only on thepresence of bound metal at the site of higher affinity,whereas hydrolysis of cephalosporin C is further increasedby binding at the weaker site (13). The sole cysteine residueof the exoenzyme is involved in the metal binding, andreactivation by metal ions is inhibited by thiol reagents.Three histidine residues, which were partially identified, arealso involved (6).The gene for ,B-lactamase I from B. cereus 569/H has been

cloned previously in E. coli and sequenced (29, 41). Here wereport the cloning and sequencing of the gene for ,B-lactamase II of B. cereus 569/hI. This is the first gene for a,-lactamase of class B whose primary structure has beenelucidated. Like most of the proteins transported throughmembrane in both eucaryotes and procaryotes (listed inreference 45), P-lactamase II is synthesized as a preproteinwith an N-terminal signal sequence. This information shouldprovide a better understanding of the secondary structure,ligand binding, and evolutionary lineage of class B P-lactamases, particularly, the P-lactamase II of B. cereus.

MATERIALS AND METHODS

Bacteria and plasmids. B. cereus 569/H (29), a constitutiveproducer of ,-lactamases, was the source of chromosomalDNA.The vector for shotgun cloning was pRW33 (28). E. coliRR1 (7), a derivative of E. coli K-12, was used for plasmidpropagation. E. coli cells were grown in L broth or M9medium supplemented with proline, leucine (50 ,ug/ml), andthiamine (2 ,ug/ml), with the appropriate antibiotic (30). B.cereus cells were grown in L broth or 2% CH/S (31) medium.Growth was monitored with a Klett-Stimmerson colorimeter.

Preparation of DNA. Chromosomal DNA from B. cereus569/H cells grown on 2% CH/S medium was prepared by themethod of Dubnau and Davidoff-Abelson (14). Plasmid DNAin E. coli RR1 was amplified in the presence of spec-tinomycin (200 ,ug/ml) and isolated by the method of Ciewelland Helinski (11). DNA fragments were separated by poly-acrylamide gel electrophoresis and electroeluted. E. coli

223

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

224 HUSSAIN ET AL.

RR1 cells were made competent for transformation withplasmid by calcium chloride treatment (24). Plasmids in theresulting transformants were analyzed by the rapid methodof Holmes and Quigley (17).DNA sequencing. Purified large DNA fragments were

cloned directly into bacteriophage M13 mp8 or mp9 (26).Other samples were digested with RsaI and shotgunned intothe SmaI site of M13 mp9. The nucleotide sequences weredetermined by the method of Sanger et al. (38).

Cell fractionation and penicillinase assay. E. coli cells weresonicated in 20 mM sodium citrate (pH 6.0) and separatedinto membrane and soluble fractions by differential centrif-ugation (18). The iodometric assay for ,B-lactamases was thatof Sargent (39) with some modifications. The assays weredone in duplicate in 0.1 M sodium citrate buffer (pH 6.0)containing 0.1% taurodeoxycholate and either 0.5 mMZnSO4 or 50 mM EDTA. Activity for 1-lactamase II wasdetermined by subtracting the activity with EDTA from thevalue with ZnSO4. A suitable blank was included. 13-

Lactamase II activity was also evaluated by following thedecrease in A260 on cleavage of cephalosporin C (15). Reac-tions were run in 50 mM Tris hydrochloride (pH 7.0)containing 0.33 mM cephalosporin C, 0.5 mM ZnSO4, and 5to 15 ,u of cell extract. Hydrolysis of the substrate by zincwas insignificant under the conditions of the assay. Sensitiv-ity of the crude enzyme preparation to EDTA was deter-mined by adding EDTA to a final concentration of 0.5 mM tothe reaction mixture.

In vivo labeling and immunoprecipitation. E. coli cells werelabeled at mid-logarithmic phase with [35S]methionine (62,uCi/SO pmol per ml) for 30 min. Cells were rapidly chilled,pelleted, suspended in 0.015 M sodium phosphate buffer (pH8.0) containing 0.15 M NaCl, and sonicated. The debris wasremoved by centrifugation in a microfuge, and the superna-tant was subjected to immunoprecipitation in the samebuffer. Antibody to 1-lactamase II was prepared by immu-nizing male New Zealand White rabbits with purified P-lactamase II. The enzyme was suspended in Freund com-plete adjuvant at 1:1, and multiple intradermal injectionswere administered: 300 ,ug on day 1, 150 p.g on day 22, and750 ,ug on day 36. The rabbit was bled 5 days later. Theimmunoglobulin fraction was obtained by affinity columnchromatography with CM Affi-Gel Blue (Bio-Rad Laborato-ries, Richmond, Calif.), according to the specifications of themanufacturer.Other methods. The DNA-directed cell-free protein syn-

thesis by the method of Zubay (46) was performed with theS30 fraction from E. coli MRE600 (8) and covalently closedcircular DNA. [35S]methionine (1.35 mCi/1.27 mmol per ml)was used for labeling. Protein products were analyzed byelectrophoresis on 12.5% polyacrylamide-sodium dodecylsulfate gels by the method of Laemmli (22). Gels weretreated with En3Hance and exposed to Kodak X-Omat ARfilms. Protein was estimated by the method of Lowry et al.(23).

Materials. Purified B. cereus 569/H 1-lactamase II was agift of S. G. Waley of the Sir William Dunn School ofPathology, Oxford, United Kingdom. 1-Lactamase I fromthis strain (27) and 3-lactamase III (12) were prepared asdescribed previously. Cephalosporin C was from SigmaChemical Co., St. Louis, Mo. Enzymes for cloning andsequencing, M13 DNA, and primer DNA were purchasedeither from New England BioLabs, Inc., Beverly, Mass., orBethesda Research Laboratories, Inc., Gaithersburg, Md.L-[355]methionine (10 Ci/10 ,umol per ml) and En3Hancewere from New England Nuclear Corp., Boston, Mass.

RESULTS

Cloning of B. cereus P-lactamase II. The structural genefrom B. cereus 569/H, termed blm to indicate that thisP-lactamase is a metalloprotein, was isolated from a plasmidpool containing Hindlll fragments of B. cereus 569/H chro-mosomal DNA ligated into the unique Hindlll site ofpRW33. Hindlll was chosen because it would inactivate theP-lactamase I gene which has two internal HindlIl sites (29,41). (Plasmid pRW33 is a derivative of pBR325 [35] whosebla gene is inactive [28].) E. coli RR1 was transformed with0.4 ,ug of plasmid, and chloramphenicol-resistant transform-ants were transferred to plates containing ampicillin (25,ug/ml). The single (Apr Cmr Tcs) clone contained an 8.8-kilobase (kb) plasmid with a 4.2-kb insert in the HindIll siteof pRW33. This plasmid was designated pRWHO1. The4.2-kb insert consisted of two HindIII fragments of 1.8 and2.4 kb. The subclone containing the 2.4-kb HindIII fragment,also in the HindIII site of pRW33, was Apr Cmr Tcs andcarried the blm gene. The plasmid termed pRWHO12 (Fig.1A) was mapped with several restriction endonucleases.

Identification of I-lactamase II. Among the three -lactamases produced by B. cereus 569/H, only P-lactamaseII is a metallothioenzyme (2). Extracts of E. coliRR1(pRWHO1) and E. coli RR1(pRWHO12) were found tocontain a zinc-dependent, EDTA-sensitive cephalosporinaseactivity (based on a modification of the spectrophotometricassay of Hamilton-Miller et al. [15]). The same extracts wereactive on penicillin when assayed by the iodometric proce-dure (see Materials and Methods). This activity was simi-larly zinc dependent and EDTA sensitive and could becompletely inhibited by iodoacetate (Table 1). These criteriadistinguish the activity from that of ,B-lactamase I andP-lactamase III, which are insensitive to EDTA and iodo-acetate. To further eliminate the possibility that the cloned2.4-kb HindIII fragment of pRWHO12 contains the gene for3-lactamase I, its restriction map (Fig. 1B) was compared

with that of P-lactamase I, as determined by Mezes et al. (29)and Sloma and Gross (41). The maps were found to begrossly different from each other.To confirm the presence of P-lactamase II in E. coli

RRl(pRWH012), the proteins labeled in vivo with[35S]methionine were subjected to immunoprecipitation withanti-p-lactamase II antibodies. Upon sodium dodecyl sul-fate-polyacrylamide gel electrophoresis, the immu-noprecipitated band migrated to the same position as authen-

TABLE 1. The effect of chelating and thiol modifying agents onthe P-lactamases of B. cereus 569/H

P-Lactamase activity (U/ml)a with addition ofbEnzyme znso4 + znSO4 +

preparations None ZnSO4 EDT!'A iodoaceticacid

[B-Lactamase I 20,900 20,700 21,200 (0)C 20,400 (1)c,-Lactamase II 74 12,400 26 (>99) 52 (>99)1-Lactamase III 197 184 187 (0) 177 (4)Extract of E. coli 0 15,400 0 (100) 0 (100)RR1(pRWHO12)

aA unit hydrolyzes 1 j.mol of benzylpenicillin per h.bAll reaction mixtures were adjusted to pH 6.0 and 30°C and contained 0.1

M sodium citrate and 0.1% taurodeoxycholate. ZnSO4, EDTA, and iodoaceticacid were added to final concentrations of 0.5, 50, and 10 mM, respectively.

" Values in parentheses indicate the percentage of inhibition with respect tothe activity in 0.5 mM ZnSO4

J. BACTERIOL.

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

CLONING AND SEQUENCING OF B. CEREUS ,-LACTAMASE II

1200

C

.-=0C)--Cto toCO- a

LL a.n ZoD c.o co,IL IL IL )am

1600

0

c

2000

c

2400 bp

D'SoaFoI ( NH z

0 200

-, -.

---- -4-

400

0 c az IL Cr CLa . N I

600

0

cU.

800

COOH

1000 1700bp

FIG. 1. Restriction map and sequencing strategy for the B. cereus 569/ti ,-lactamase II gene. (A) Maps of plasmids pRWHO1 andpRWHO12. The heavy line indicates B. cereus DNA inserted in the HindIII site of pRW33. The insert in pRWHO1 is 4.2 kb and consists oftwo HindlIl fragments of 2.4 and 1.8 kb. A subclone containing only the 2.4-kb HindIll fragment is pRWHO12. The locations of the genesfor chloramphenicol resistance (Cmr) on the vector and ampicillin resistance (Apr) on the insert are shown. (B) Map of the 2.4-kb HindIIIfragment. (C) Region of the 2.4-kb JindIII fragment that was sequenced. The arrows indicate the length and which of the two strands wassequenced. The region corresponding to ,-lactamase II is boxed, while the area coding for the signal peptide at the N-terminal end is hatched.Only a part of one strand of the ClaI-HindIII fragment containing the C-terminal end was sequenced.

tic P-lactamase II exoenzyme from B. cereus 569/H (Fig. 2,lanes 2 and 3).

Sequencing of blm. The strategy for sequencing the P-lactamase II gene is shown in Fig. 1C. Initial sequencingaround the unique PstI site revealed a DNA sequence which,in one reading frame, corresponded to part of the amino acidsequence recently determined by Ambler and Fleming (R.Ambler and-J. Fleming, personal communication) for puri-fied exo-,-lactamase II of B. cereus 569/H. The 240-base-pair PstI-ClaI fragment and the 0.75-kb ClaI-Hind III frag-ment (Fig. 1B) were purified and cloned into M13 mp8 orM13 mp9 vectors. We sequenced both strands of the PstI-ClaI fragment and one strand of the ClaI-HindIII fragment(from the ClaI site) (Fig. 1C). FnuDII cleaved the 2.4-kb

HindIII fragmnent into five pieces. The 0.56-kb FnuDIIfragment upstream from the unique PstI site was purified,digested partially with RsaI and cloned at the SmaI site ofM13 mp9 DNA. Sequencing of these fragments providedoverlapping DNA sequences for both strands of the 0.56-kbFnuDII fragment and thus of the entire gene (Fig. 1C).

Nucleotide and amino acid sequence of I-lactamase II. TheDNA sequence of 1,124 bases (of the sense strand) is shownin Fig. 3. There is an open reading frame initiating at ATG(nucleotides 240 to 242) and terminating at TAA (nucleotides1011 to 1013) which is more than enough to code for a proteinthe size of exo-p-lactamase II (Mr, 25,000 [3]). The initiationcodon is preceded by a possible Shine-Dalgarno sequenceand this, in turn, is preceded by a -10 region TAATAT

00~

A

B

.cLFr0

C 0 CLL CO) U

ILL400 / 80

I 9 9

VOL. 164, 1985 225

r_:l

s

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

226 HUSSAIN ET AL.

TABLE 2. Distribution of P-lactamase lI in B. cereus andE. coli (pRWHO12)

Cell Sp act of fractions assayed forStrain density 13-lactamase II activityb(Klett Culture Cytoplasm- Membrane

unit)" fluid periplasm Mmrn

B. cereus 569/H 420 3,200 (99)' 23 (0.7)E. coli 214 44 (1.5) 2,900 (98) 24 (0.8)RR1(pRWHO12)

a This value corresponds to a predetermined growth point at which thespecific activity of ,-lactamase 1I was maximal. B. cereus was grown at 34°C,and E. coli was grown at 37°C in L broth containing ampicillin (50 ,tg/ml).

b Specific activities are expressed as ,umoles of benzylpenicillin cleaved perhour per milligram of cell protein.

Values in parentheses are percentages of total activity in the fraction.

(nucleotides 195 to 200) and -35 region (around nucleotides168 to 178) of a putative promoter (Fig. 3). There is aninverted repeat shortly after the termination codon whichmay form a stable stem-loop structure having a AG of -15kcallmol, calcuiated by the method of Kanehisa (20). Thededuced amino acid sequence shown in Fig. 3 is identical tothe amino acid sequence of purified exo-p-lactamase II of B.cereus 569/H (R. Ambler and J. Fleming, personal commu-nication).

Signal sequence of I-lactamase II. The coding sequence of771 nucleotides shown in Fig. 3 specifies a protein of 257amino acid residues. This is 30 residues longer than theexoenzyme which starts with Ser (nucleotides 330 to 332) (R.Ambler and J. Fleming, personal communication). The de-duced N-terminal extension has the characteristics of acleavable signal peptide and is, therefore, numbered -1 to-30, where -30 is the N-terminal methionine. It has apositively charged N-terminal segment with three lysinesamong the eight residues (Met-30-Lys-Lys-Asn-Thr-Leu-Leu-Lys-23). This is followed by 14 amino acid residuesthat are mostly hydrophobic, otherwise neutral (Val-22 toVal-9). The last eight residues of the signal peptide aremostly small amino acids (Ser-8-Thr-Ile-Ser-Ser-Val-Gln-Ala-1). The putative signal peptidase cleavage site at thebond between Ala-1-Ser+ 1 is compatible with the empiricalrules (e.g., -3, -1 rule; window of cleavage site) con-structed by von Heijne (43, 44) and Perlman and Halvorson(32).The calculated molecular weight of the putative pre-,-

lactamase II is 28,060 daltons, which is 3,128 daltons largerthan that of the exoenzyme (24,932 daltons). In vitro-coupled transcription and translation with an S30 extractfrom E. coli was employed to determine the size of theprimary translation product. [35S]methionine-labeled pro-teins synthesized from pRWHO12 were immunoprecipitatedwith antiserum specific for ,B-lactamase II of B. cereus andwere analyzed by SDS-polyacrylamide gel electrophoresis.There were two immunoprecipitable proteins (Fig. 2, lahe 4);one was the same in size as the authentic exoenzyme (Fig. 2,lane 2), while the other was about 3,000 daltons larger andcoincided with the deduced size of the pre-1-lactamase II.This implies that translation was initiated at the ATG codonindicated in Fig. 3.

Expression in E. coli. The expression of blm in E.coli(pRWHO12) was compared with that in its native host,B. cereus 569/H, on the basis of the specific activity of thecells (U/mg of protein). Although the gene was present in E.coli on a high-copy-number plasmid, its level of expressionwas similar to that in B. cereus 569/H, which presumably

carries only a single copy of the gene. While the enzyme wascompletely secreted into the surrounding medium by B.cereus, it was almost completely localized in the solublefraction of a sonic extract of E. coli cells (Table 2).

DISCUSSIONB. cereus 569/H is unusual in that it produces three quite

different 1-lactamases. The gene for ,-lactamase I has beencloned, and its sequence has been determined (29, 41). Herewe report the cloning in E. coli RR1 of the gene, blm, for themetallothioprotein P-lactamase II. The presence of the genein pRWHO0 and pRWHO12 was established (i) enzymati-cally by detecting the Zn-dependent, EDTA-sensitive cleav-age of cephalosporin and penicillin, (ii) by immunoprecipi-tation of ,B-lactamase II or pre-,B-lactamase II from the invivo (in E. coli) or in vitro protein products of pRWHO12,and (iii) by sequencing the DNA and deducing the aminoacid sequence (Fig. 3), which proved to be identical to that ofthe exo-,-lactamase II from B. cereus 569/H cultures (R. P.Ambler, M. Daniel, J. Fleming, J.-M. Hermoso, C. Pang,and S. G. Waley, FEBS Lett., in press).The gene for P-lactamase II contains promoter-like se-

MW

68-

43-

18.4- 53:12.3

1 2 3 4FIG. 2. Comparison of the in vitro translation product of blm

with the in vivo products found in B. cereus and E. coli. Proteinsamples were electrophoresed in a 12.5% polyacrylamide-sodiumdodecyl sulfate gel. Molecular weight standards (lane 1, in thou-sands) and purified exo-1-lactamase II from B. cereus 569/H (lane 2)were stained with silver by the method of Merril et al. (25).Immunoprecipitates with anti-.3-lactamase II antibodies of sonicextract of E. coli RR1(pRWHOi2) cells labeled with [35S]methionine(lane 3) and cell-free translation products with pRWHO12 and[35S]methionine (lane 4) are shown. Lanes 3 and 4 were autoradio-graphed for 48 h. Mr standards were: bovine serum albumin(68,000), ovalbumin (43,000), chymotrypsinogen (25,700), ,3-lactoglobulin (18,400), and cytochrome c (12,300).

J. BACTERIOL.

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

CLONING AND SEQUENCING OF B. CEREUS 1-LACTAMASE II

OG:CGGAGATTAMATGGTTATAATGGAAAMGMACTATATTGAmTTTAATGTATTATGGCAATGCuAGGA-C-TTGGArgtyAlrg7L*koeGStyTyrnGtyLyoGtuLysTyrrIteApLeuAsnVa tPheTyrGlyAsnGtuGCuGtuPhteGtu

100 . Real Real . . 15SMTTATGCMATGAMGATTAMGTTA MAGTGtTCJTTCTACC TGTTMTTACATA.AAA&TATGCM^A8TG>94tLjeAee^p *

200TCAAGATGAAcAAMCATTTAGAATGMTFGTCTMTATAGTMTAACTATTTGGCTFGAMGAAGGGTTGATGAC

' -351' -10 C,CUUUCJCCA.-3'-HO-U S.D.

250 . . . * 300E:AAM AATACCTTMGTTsTAAATCGATTAT,GTGTAGGTTACTAGGAACAATTCAATTTGrrAGCACAATTTCT

LyJLyeAenThrLuLLyVatGteyucysVaWtGtyLeuLeutGyThrIleGZnPheVatSerThrIleSer-30 -20 -10

.ReaI 350TCITAAAGCATCACAAAAGGTAGAGAAMACAGTMATAMAATGAGACGGGACCATTTCM TATCTCAGTTAACSerVWaWAInAlaSertnLyeVatOuLyslThrValIteLyaAenGZuThrSGyThrIteSerI'teSerGlnLeuAen

-1 +1 +10 +20

400 . . . . 450AAGAATGTATGGGTTCATACGGAGTTAGGTTCTTTTAATGGAGMA.CAGTTCCTTCGMCGGTCTAGTTCTTAATACTLysAanVaLTrpVatHisThrGLuLeuGlySerPheAenGlyGluAlaValProSerAanGlyLeuValLeuAsnThr

+30 +40

RsaI. 500 . . 550TCTAAACGGTTAGTACTTGTGGATTCTTCTTGGCATGACAAATTAACGAAGGAACTAATAGAAATGGTAGAAAGAASerLyeGtyLeuVatLeuValAspSerSerTrpAepAspLysLeuThrLyeGZuLeuIZeGluMetVaGIZuLyeLye

+50 +60 +70

FmuDII . . . 600rffCAGMGCGCGTMCGCATGTCATTATTACACkTGCGC&CGCTGATCGAATTGGCGGAATMAAACGTTGAAAGAAPhGI3nLyaArgValthrAepValIteIZeTh *t lZai,4tlaAapArgIIeGlyGtlyIleLysThrLeuLyaGZu

+80 -1 +90 +100

650 . PatI . . . 700AGAGGCATTAMAGCGCATAGTACAGCATTAACTCCAGAACTAGCAAAGAAAAATGGATATGAAGMCCGCTTGGAGATArgGtyrIteLyeAtaHisSerThrAlaLeuThrAlaGCuLeuAlaLysLysAsnGlyTyrCluGlzuProLeuGtyAap

+110 +120

750TTAAA('AC(;TTACAAATTTGAAGTTTCGAMATAATCAAAGTGCA/ACATTTTATCCAGCGAACGGGCATACAG,AAGATLeu;t'nThrV32l9hrA nLeuLy8Phet,PIyAsnMletLysVa iG,.*Th rPhleTyrProrlyZLyGl4yHiaThrGnuAsp

+110 +14S) +150

800 FnuDIIAATATTGTCGTATGGTTACCGCAATACAATATTTTAGTTGGAGGCTGTTTAGTGAAATCTACGTCCGCGAAAGATTTAAenIleValValtTrpLeuProCGnTyrAsnrIeLeuVaCtGtiG CySt euValLysSezrThrSerAtaLysAspLeu

+160 +170

AccI. CtarCGAAACGTTGCGGATGCTTATGTAAAMTAATGGTCTACATCGATTGAGAATGTGCTGAAGCGATATAGAAATATAAATGClAenVatAtaaApAlaTyrVatAsnGluTrpSerThrSerIeGluAanValLeuLyaArgTyrArgAsnIreAsn

+180 +190 +200

950 . . . . 1000GCAGTAGTGCCTGGTC&TGGCGAAGTAGGGGACAAAGGATTACTTTTACATACATTGGATTTATTAAMTAAGAAATTAlaValValProCI itylyuVaGuVlyAspLyGtyLeuLeLeeuHieThrLeuAspLeuLeuLys *

+220 +227

1050GTAGAAATACMAMAGAGGAGAATAAIIG.T TCTCTTTCTTCTAACTATATTTAAATGCTGAATCTGTTGAT

1100 . 1124TACGCCAC.CATTATATTACTGAGATTTT

FIG. 3. DNA sequence of the sense strand and the deduced amino acid sequence of B. cereus 569/H P-lactamase II (blm). The -35 and-10 regions of a promoter-like sequence are underlined, and the -35 region is underlined with a broken line. The Shine-Dalgarno sequence(S.D.) is indicated, and the complementary 3' end of 16S rRNA of B. subtilis is shown below it. The initiation codon is boxed, and thetermination codons are marked (*). The arrows ( ) indicate inverted repeats. The amino acid residues participating in ligand binding arecircled.

quences (Fig. 3). The -35 and -10 regions of the promoterare assigned following the observations of Rosenberg andCourt (36) and Siebenlist et al. (40) and from the consensussequences (i.e., TTGACA and TATAAT, respectively) for168 promoter regions of E. coli (16). The inverted repeat atthe end of the 1-lactamase II structural gene may function asa weak rho-independent transcription terminator (9). Thereare some indications that the B. cereus ,B-lactamases are

coregulated (34; M. J. Madonna, A. Carlino, and J. 0.Lampen, unpublished observations).There is another open reading frame, upstream from the

promoter region of 13-lactamase II, that terminates at nucle-otides 100 to 102 (TAA). It is followed by an inverted repeat,as indicated in Fig. 3, which may form a secondary structurewith a calculated AG of -7.0 kcal/mol. The 33 C-terminalamino acid residues of the putative polypeptide are shown.

VOL. 164, 1985 227

+2r6

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

228 HUSSAIN ET AL.

79Val -Thr-Asp-Val-le-lIe-Thr-HIS-Ala-HIS-Ala-Asp-Arg'

Poptide 2 Val (Asx2, Thr2, Ala2, Va!, His ) ArgAsnVanaaa rl'-HIS-Gly 1-2

202 2Asn -IIe-Asn-Ala-Val-VaI-Pro-Gly-HIS-Gly-GIu-Val-GIy-Asp-Lys2'

Asn (Asx2, Gix, Pro, GIy3 , Ala, Val2, 19,9 His ) Lys

FIG. 4. Location of histidine residues interacting with zinc ions. Peptides 2 and 3, shown in italics, are from Baldwin et al. (6). Matchedagainst them and shown above each are the sole tryptic peptides deduced from the sequence in Fig. 3 that correlate with the peptide data.The histidine residues involved in Zn(II) binding are in capital letters and are underlined.

The identity and function of this protein and any possiblerelation to the ,-lactamase II gene are unknown to us. Itdoes not appear to be closely related to any previouslydescribed Bacillus proteins (J. L. Modelevsky, personalcommunication).

It seemed likely from the DNA sequence that the primarytranslation product of blm is a preprotein with an N-terminalsignal peptide of 30 amino acid residues. This was confirmedwhen pRWHO12 was translated in an in vitro protein trans-lating system. Unlike pre-3-lactamase I of B. cereus 569/H,which is processed differently in E. coli, Bacillus subtilis,and B. cereus (27), we find that pre-p-lactamase II isprocessed to a single product, the exoenzyme form, in bothE. coli and B. cereus (1; Fig. 2). Most probably the onlyprocessing that pre-f3-lactamase II undergoes is removal ofthe signal peptide by a signal peptidase similar in specificityto the type discovered by Zwizinski and Wickner (47). (Thepresence of such an enzyme has been observed in B. cereus

569/H [F. I. J. Pastor, M. Hussain, and J. 0. Lampen,unpublished observations].) Furthermore, in the in vitroprotein translating system, some of the pre-i-lactamase II isprocessed to the mature form, possibly by a signal peptidasepresent in the S30 fraction which is not totally free frommembrane vesicles. The final locations of the mature formsof P-lactamases I and II are similar. In B. cereus bothproteins are released into the medium, whereas in E. colithey are retained in the cell.The elucidation of the primary structure of P-lactamase II

should be important for understanding its secondary struc-ture, ligand binding, and mode of action. Davies andAbraham (13) and Baldwin et al. (5) showed that there are

two Zn(II) binding sites in the protein and that the site withhigher affinity includes the sole cysteine of the exoenzymeand three histidine residues. These residues were present intwo tryptic peptides (numbers 2 and 3) purified by Baldwin etal. (6). By aligning the tryptic peptides with the relevantsegments that can be generated from 1-lactamase II bytryptic digestion (Fig. 3), the residues which are involved inligand binding could be identified (Fig. 4). Peptide 2 and thepotential tryptic fragment Val-79 to Arg-91 are identical inamino acid content. Similarly, peptide 3 and fragmentAsn-202 to Lys-216 are almost identical (two and three Valresidues, respectively). Therefore, the histidine residuesbinding Zn(II) are His-86, His-88, and His-210. ApparentlyHis-28, His-106, His-149, and His-221 are not involved inligand binding. The sole cysteine residue (Cys-168), whichalso participates in binding Zn(II), is indicated as well (Fig.3). The fact that the cysteine and histidine residues are

positioned in three separated sites on the primary structureof the enzyme should be helpful in predicting the secondarystructure. Presumably, the three sites are drawn togetheraround a Zn(II) ion. It should be noted that a mutant form of,B-lactamase II has been isolated which is only 10% as activeas the parent in hydrolyzing cephalosporin C but retains fullactivity on benzylpenicillin (4). Determination of the primarystructure of this mutant enzyme and its comparison with thatof the wild type reported here should throw light on themode of action of the enzyme.The expression of blm in E. coli(pRWHO12) was compa-

rable to that in its native host, B. cereus (Table 2), in contrastto the lower expression observed for 3-lactamase I (29, 41),despite the fact that in E. coli both genes are present inhigh-copy-number plasmids. Possibly, both promoters areinefficient in E. coli. Beyond this difference, the higherexpression of the P-lactamase II may reflect the fact that itspromotor region and initiation codon are more conventionalthan those of P-lactamase I (27, 29).

ACKNOWLEDGMENTSRichard Ambler and Joan Fleming of the University of Edinburgh

generously shared their data on the amino acid sequence off-lactamase II in advance of publication. We thank Steven Waley ofOxford University for a sample of purified ,3-lactamase II and J. L.Modelevsky of Eli Lilly & Co. for carrying out the computercomparison of the C-terminal region of the potential polypeptide,located upstream of the ,-lactamase II gene, with those Bacillusproteins whose sequences have been reported. We are grateful toJulie Sohm for expert technical assistance.

This work was supported by grants from the National ScienceFoundation (PCM 8116888), Miles Laboratories, Inc., and theCharles and Johanna Busch Fund.

LITERATURE CITED1. Abraham, E. P., and S. G. Waley. 1979. ,-Lactamases from

Bacillus cereus, p. 311-338. In J. M. T. Hamilton-Miller andJ. T. Smith (ed.), Beta-lactamases. Academic Press, Inc. (Lon-don), Ltd., London.

2. Ambler, R. P. 1979. Amino acid sequences of P-lactamases, p.99-125. In J. M. T. Hamilton-Miller and J. T. Smith (ed.),Beta-lactamases. Academic Press, Inc. (London), Ltd., Lon-don.

3. Ambler, R. P. 1980. The structure of P-lactamases. Philos.Trans. R. Soc. London Ser. B 289:321-331.

4. Baldwin, G. S., G. F. S. Edwards, P. A. Kiener, M. J. Tully,S. G. Waley, and E. P. Abraham. 1980. Production of a variantof P-lactamase II with selectively decreased cephalosporinaseactivity by a mutant of Bacillus cereus 569/H/9. Biochem. J.191:111-116.

Peptide 3

J. BACTERIOL.

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

CLONING AND SEQUENCING OF B. CEREUS 3-LACTAMASE II

5. Baldwin, G. S., A. Galdes, H. A. 0. Hill, B. E. Smith, S. G.Waley, and E. P. Abraham. 1978. Histidine residues as zincligands in P-lactamases II. Biochem. J. 175:441-447.

6. Baldwin, G. S., S. G. Waley, and E. P. Abraham. 1979.Identification of histidine residues that act as zinc ligands in,B-lactamase II by differential tritium exchange. Biochem. J.179:459-463.

7. Boyer, H. W., and D. Roulland-Dussoix. 1969. A complementa-tion analysis of the restriction and modification of DNA inEscherichia coli. J. Mol. Biol. 41:459-472.

8. Cammack, K. A., and H. E. Wade. 1965. The sedimentationbehavior of ribonuclease-active and -inactive ribosomes frombacteria. Biochem. J. 96:671-680.

9. Christie, G. E., P. J. Farnham, and T. Platt. 1981. Rho-independent transcription termination: comparison of naturaland synthetic terminator sites in vitro. Proc. Natl. Acad. Sci.USA 78:4180-4184.

10. Citri, N. 1971. Penicillinases and other P-lactamases, p. 23-46.In P. D. Boyer (ed.), The enzymes, 3rd ed., vol. 4. AcademicPress, Inc., New York.

11. Clewell, D. B., and D. R. Helinski. 1972. Effect of growthconditions on the formation of the relaxation complex ofsupercoiled ColEl deoxyribonucleic acid and protein in Esche-richia coli. J. Bacteriol. 110:1135-1146.

12. Connolly, A. K., and S. G. Waley. 1983. Characterization of themembrane ,B-lactamase in Bacillus cereus. Biochemistry22:4647-4651.

13. Davies, R. B., and E. P. Abraham. 1974. Metal cofactor require-ments of 3-lactamase II. Biochem. J. 143:129-135.

14. Dubnau, D., and R. Davidoff-Abelson. 1971. Fate of transform-ing DNA following uptake by competent Bacillus subtilis. I.Formation and properties of the donor-recipient complex. J.Mol. Biol. 56:209-221.

15. Hamilton-Miller, J. M. T., G. G. F. Newton, and E. P. Abraham.1970. Products of aminolysis and enzymatic hydrolysis of thecephalosporins. Biochem. J. 116:371-384.

16. Hawley, D. K., and W. R. McClure. 1983. Compilation andanalysis of Escherichia coli promoter DNA sequences. NucleicAcids Res. 11:2237-2255.

17. Holmes, D. S., and M. Quigley. 1981. A rapid boiling method forthe preparation of bacterial plasmids. Anal. Biochem.114:193-197.

18. Inouye, M., and J. P. Guthrie. 1969. A mutation which changesa membrane protein of E. coli. Proc. Nati. Acad. Sci. USA64:957-961.

19. Jaurin, B., and T. Grundstrom. 1981. amp C cephalosporinaseof Escherichia coli K-12 has a different evolutionary origin fromthat of f-lactamases of the penicillinase type. Proc. Natl. Acad.Sci. USA 78:4897-4901.

20. Kanehisa, M. I. 1982. Los Alamos sequence analysis packagefor nucleic acids and proteins. Nucleic Acids Res. 10:182-196.

21. Kuwabara, S., and E. P. Abraham. 1967. Some properties oftwo extracellular 13-lactamases from Bacillus cereus 569/H.Biochem. J. 103:27C-30C.

22. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

23. Lowry, 0. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall.1951. Protein measurement with the Folin phenol reagent. J.Biol. Chem. 193:265-275.

24. Mandel, M., and A. Higa. 1970. Calcium-dependent bacterio-phage DNA infection. J. Mol. Biol. 53:154-162.

25. Merril, D. R., D. Goldman, S. A. Sedman, and M. H. Ebert.1981. Ultrasensitive strain for proteins in polyacrylamide gelsshows regional variation in cerebrospinal fluid proteins. Science

211:1437-1438.26. Messing, J., and J. Vieira. 1982. A new pair of M13 vectors for

selecting either DNA strand of double-digest restriction frag-ments. Gene 19:269-276.

27. Mezes, P. S. F., R. W. Blacher, and J. 0. Lampen. 1985.Processing of Bacillus cereus 569/H P-lactamase I in Esche-richia coli and Bacillus subtilis. J. Biol. Chem. 260:1218-1223.

28. Mezes, P. S. F., W. Wang, E. C. H. Yeh, and J. 0. Lampen.1983. Construction of penPAli Bacillus licheniformis 749/CP-lactamase lacking site for lipoprotein modification. Expres-sion in Escherichia coli and Bacillus subtilis. J. Biol. Chem.258:11211-11218.

29. Mezes, P. S. F., Y. Q. Yang, M. Hussain, and J. 0. Lampen.1983. Bacillus cereus 569/H 1-lactamase I: cloning in Esche-richia coli and signal sequence determination. FEBS Lett.161:195-200.

30. Miller, J. H. 1972. Experiments in molecular genetics, p. 433.Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.

31. Nielsen, J. B. K., and J. 0. Lampen. 1983. ,-Lactamase III ofBacillus cereus 569: membrane lipoprotein and secreted protein.Biochemistry 22:4652-4656.

32. Perlman, D., and H. 0. Halvorson. 1983. A putative signalpeptidase recognition site and sequence in eukaryotic andprokaryotic signal peptides. J. Mol. Biol. 167:391-409.

33. Pollock, M. R. 1963. Penicillinase-antipenicillinase. Ann. N.Y.Acad. Sci. 103:989-1004.

34. Pollock, M. R., and J. Fleming. 1969. Heritable mass conversionof a mutant penicillinase-negative culture of Bacillus cereus to apositive fully de-repressed state. J. Gen. Microbiol. 59:303-316.

35. Prentki, P., F. Karch, S. Iida, and J. Meyer. 1981. The plasmidcloning vector pBR325 contains a 482 base-pair long invertedduplication. Gene 14:289-299.

36. Rosenberg, M., and D. Court. 1979. Regulatory sequencesinvolved in the promotion and termination of RNA transcrip-tion. Annu. Rev. Genet. 13:319-353.

37. Saino, Y., F. Kobayashi, M. Inoue, and S. Mitsuhashi. 1982.Purification and properties of inducible penicillin P-lactamaseisolated from Pseudomonas maltophilia. Antimicrob. AgentsChemother. 22:564-570.

38. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Nati. Acad. Sci.USA 74:5463-5467.

39. Sargent, M. G. 1968. Rapid fixed-time assay for penicillinase. J.Bacteriol. 95:1493-1494.

40. Siebenlist, U., R. B. Simpson, and W. Gilbert. 1980. E. coli RNApolymerase interacts homologously with two different promot-ers. Cell 20:269-281.

41. Sloma, A., and M. Gross. 1983. Molecular cloning and nucleo-tide sequence of the type I ,B-lactamase gene from Bacilluscereus. Nucleic Acids Res. 11:4997-5004.

42. Sutcliffe, J. G. 1978. Nucleotide sequence of the ampicillinresistance gene of E. coli plasmid pBR322. Proc. Natl. Acad.Sci. USA 75:3737-3741.

43. von Heijne, G. 1983. Patterns of amino acids near signal-sequence cleavage sites. Eur. J. Biochem. 133:17-21.

44. von Heine, G. 1984. How signal sequences maintain cleavagespecificity. J. Mol. Biol. 173:243-251.

45. Watson, M. E. E. 1984. Compilation of published signal se-quences. Nucleic Acids Res. 12:5145-5164.

46. Zubay, G. 1973. In vitro synthesis of protein in microbialsystems. Annu. Rev. Genet. 7:267-287.

47. Zwizinski, C., and W. Wickner. 1980. Purification and charac-terization of leader (signal) peptidase from Escherichia coli. J.Biol. Chem. 255:7973-7977.

229VOL. 164, 1985

on May 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from