tTitmtpmccishaIlpn

i(irispfrpth1

RS(

Genomics 56, 310–316 (1999)Article ID geno.1998.5728, available online at http://www.idealibrary.com on

0CA

Coding Sequence, Genomic Organization, ChromosomalLocalization, and Expression Pattern of the Signalosome

Component Cops2: The Mouse Homologue of Drosophila Alien

Laura Schaefer,*,† Mary Lou Beermann,* and Jeffrey B. Miller*,†,1

*Myogenesis Research Laboratory, Massachusetts General Hospital, 149 13th Street, Charlestown, Massachusetts 02129; and†Program in Neuroscience, Harvard Medical School, Boston, Massachusetts 02115

Received October 5, 1998; accepted December 22, 1998

tTmtdtawiRafrpM

tmtlcsmivTasoccy1hc

tisp

The Drosophila alien gene is highly homologous tohe human thyroid receptor interacting protein,RIP15/COPS2, which is a component of the recently

dentified signalosome protein complex. We identifiedhe mouse homologue of Drosophila alien through ho-ology searches of the EST database. We found that

he mouse cDNA encodes a predicted 443-amino-acidrotein, which migrates at ;50 kDa. The gene for theouse alien homologue, named Cops2, includes 12

oding exons spanning ;30 kb of genomic DNA on theentral portion of mouse chromosome 2. Mouse Cops2s widely expressed in embryonic, fetal, and adult tis-ues beginning as early as E7.5. Mouse Cops2 cDNAybridizes to two mRNA bands in all tissues at ;2.3nd ;4 kb, with an additional ;1.9-kb band in liver.mmunostaining of native and epitope tagged proteinsocalized the mouse Cops2 protein in both the cyto-lasm and the nucleus, with larger amounts in theucleus in some cells. © 1999 Academic Press

INTRODUCTION

In an effort to identify new vertebrate genes involvedn skeletal muscle development, we searched Flybase1998) for Drosophila genes with potential involvementn myogenesis. One such gene, Drosophila alien, waseported to be expressed during embryogenesis specif-cally in the epidermis at the attachment sites for theomatic muscles in the head, thorax, abdomen, andharynx (Goubeaud et al., 1996). A mutant phenotypeor alien has not yet been described. The promoteregion of the Drosophila alien gene contains severalutative E-box binding sites, raising the possibilityhat alien expression is regulated by basic helix-loop-elix (bHLH) transcription factors (Goubeaud et al.,996).

1 To whom correspondence should be addressed at Myogenesisesearch Laboratory, Massachusetts General Hospital, 149 13thtreet, Charlestown, MA 02129. Telephone: (617) 726-5754. Fax:

617) 726-8543. E-mail: Miller@helix.mgh.harvard.edu.

310888-7543/99 $30.00opyright © 1999 by Academic Pressll rights of reproduction in any form reserved.

In addition to its expression pattern in Drosophila,he interaction of the alien homologue in humans,RIP15, with nuclear receptors suggests that alienay play a role in vertebrate myogenesis. In yeast

wo-hybrid assays, TRIP15 interacts in a ligand-depen-ent fashion with both the thyroid receptor TRb andhe retinoid X receptor RXRa (Lee et al., 1995). In thebsence of thyroid hormone (T3), TRIP15 interactsith TRb, and this interaction is inhibited by increas-

ng amounts of T3. Conversely, TRIP15 interacts withXRa only in the presence of its ligand, 9-cis-retinoiccid (9-cis-RA). Both the TR and the RXR receptoramilies play significant roles during myogenesis inegulating differentiation and muscle-specific gene ex-ression (Froeschle et al., 1998; Marchal et al., 1993;uscat et al., 1995 and references within).Recently, the mammalian alien homologue was iden-

ified in association with a complex that is conserved inulticellular eukaryotes from plants to vertebrates,

he signalosome or COP9 complex. The alien homo-ogue has been designated Sgn2 in the signalosomeomplex in humans (Seeger et al., 1998) and COP9ubunit 2 (Cops2) of the COP9 complex in plants andouse (Wei et al., 1998). The COP9 complex was orig-

nally identified as a repressor of light-controlled de-elopment in Arabidopsis thaliana (Wei et al., 1994).his complex was independently identified during anttempt to identify new components of the 26S proteo-ome complex and given the name “signalosome” basedn its kinase activity (Seeger et al., 1998). The complexonsists of at least eight subunits, including a proteinalled JAB1, which in humans binds to and phosphor-lates the activation domain of c-Jun (Seeger et al.,998). Six of the subunits, including alien, containomology to subunits of the 26S proteosome regulatoryomplex (Wei et al., 1998).In this paper we describe the isolation and charac-

erization of Cops2, the mouse homologue of Drosoph-la alien, including the genomic structure and chromo-omal location of the locus, the mRNA expressionattern, and the cellular localization of the protein.

TSstSsDmw(B

wCG

eg(cdsipwmaa(a

cmtwsBbd

ii(TTwmaRm7vprtEwc

CiciAS

sEu

tbiptApt(awb(

fcfTohagatt

I

m1gfmcDsSsfistAsqehctstDttDTi

311MOUSE Cops2

MATERIALS AND METHODS

Identification, sequencing, and sequence analysis of mouse Cops2.he alien Drosophila sequence was used to search the Expressedequence Tag Database (dbEST) using the BLAST program (Alt-chul et al., 1997). EST clones 518651 and 58370 were obtained fromhe IMAGE Consortium via Research Genetics (Huntsville, AL).equencing was performed by the Sequencing Core Facility at Mas-achusetts General Hospital using the Applied Biosystems TaqyeDeoxy Terminator sequencing kit and an ABI 377 Prism auto-ated sequencer. Computer analysis of sequences was performedith the Wisconsin Package Version 9.1, Genetics Computer Group

GCG; Madison, WI). Similarity searches were performed using theLAST program (Altschul et al., 1997).

Identification of BAC clone containing mouse Cops2. A BAC cloneas identified using a probe containing the first 500 bp of mouseops2 coding sequence to hybridize the 129SvJ/6 BAC library fromenome Systems.

Characterization of Cops2 genomic structure. Sequencing prim-rs were designed across the Cops2 cDNA through comparison toenomic sequence in the database corresponding to the human locusGenBank Accession No. AP000028). Several different BAC sub-lones were used as templates. Primers to the Cops2 cDNA wereesigned using the Primer program in the Wisconsin Package Ver-ion 9.1, (GCG) and were used to amplify 20 ng BAC subclone DNAn 13 Fisher Taq polymerase buffer A, 0.25 mM dNTP, 1 mM of eachrimer, and 0.025 units/ml Fisher Taq polymerase. PCR amplicationsere carried out in an MJ Research thermal cycler with 94°C for 3in, 30 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 4 min, andfinal extension at 72°C for 7 min. Southern analysis of BAC DNA

nd mouse genomic DNA was carried out using Zetaprobe membraneBio-Rad) as described (Schaefer et al., 1996) using 2 mg BAC DNAnd 10 mg genomic DNA per digest.

Interspecific mouse backcross mapping. The BSS mouse back-ross panel [(C57BL/6JEi 3 SPRET/Ei)F1 females 3 SPRET/Eiales] digested with BglII was obtained from The Jackson Labora-

ory (Bar Harbor, ME) (Rowe et al., 1994). The panel was hybridizedith a probe containing the first 500 bp of mouse Cops2 coding

equence which detects a BglII band of ;23 kb in SPRET/Ei and twoglII bands of ;18 and 8 kb in C57BL/6JEi. Analysis was performedy The Jackson Laboratory (http://www.jax.org/resources/ocuments/cmdata/).

Constructs. The pGEX–Cops2 construct was generated by clon-ng a PCR product containing the entire open reading frame of Cops2nto the vector pGEX-4T-1 (Pharmacia Biotech). PCR primersBamHI forward, CGCGGATCCATGTCTGACATGGAGGATGAT-TC; EcoRI reverse, CCGGAATTCACTATGGTGTTGTATGTT-AGGG), one containing a BamHI tail and the other an EcoRI tail,ere used to amplify the Cops2 open reading frame using Pfu poly-erase (Stratagene) in 13 Stratagene Pfu buffer, 0.25 mM dNTP,

nd 1 mM of each primer. Amplifications were carried out in an MJesearch thermal cycler with 94°C for 3 min, 30 cycles of 94°C for 1in, 55°C for 1 min, 72°C for 4 min, and a final extension at 72°C formin. The PCR product was cloned into the BamHI and EcoRI

ector sites. The C-myc-tagged Cops2 construct was similarly pre-ared by cloning Pfu-amplified Cops2 PCR product into pJ7V (Mo-enstern and Land, 1990). A 58-bp HindIII/BamHI fragment con-aining the coding sequence for the human myc epitopeQKLISEEDL (gift from R.Boyce, Massachusetts General Hospital)as cloned into the HindIII/BamHI sites at the 59 end of the Cops2

oding sequence. Clones were verified by sequencing.

Expression analysis. The multiple tissue Northern blots fromlontech, which contain 2 mg poly(A)1 mRNA per lane, were hybrid-

zed according to the manufacturer’s specifications with a probeontaining the first 500 bp of mouse Cops2 coding sequence, washedn 13 SSC/0.1% SDS at 65°C, and exposed to film (Kodak XOMAT-R) for 48 h at 280°C. RT-PCR was performed using the Gibcouperscript II kit and standard PCR conditions as previously de-

cribed (Schaefer et al., 1996). Whole mount in situ hybridization of8.5–10.5 embryos was performed as described (Hogan et al., 1994)sing the the first 400 bp of the cDNA as a probe.

Immunoblotting. Nuclear, cytoplasmic, and total cellular frac-ions were prepared for Western analysis and solubilized in RIPAuffer as described (Ausubel et al., 1997). Cops2 polyclonal antibod-es for Western analysis were produced using GST–Cops2 fusionrotein generated by using the vector pGEX-4T-1 (Pharmacia Bio-ech) with commercial production of antibody in rabbits (Berkeleyntibody Co.) and affinity purified with the Pharmacia Biotech GSTurification kit. Protein lysates were run on 10% SDS–PAGE andransferred electrophoretically onto PVDF membrane (Millipore)Dominov et al., 1998). Membranes were incubated with monoclonalntibody to human c-myc (5 mg/ml, Zymed), and antibody bindingas detected using a horseradish peroxidase-linked secondary anti-ody system (Vectastain ABC kit) and chemiluminescent substrateECL, Amersham) (Kachinsky et al., 1994).

Immunocytochemistry. C2C12 myoblasts were cultured in 15%etal bovine serum/DMEM in 5% CO2. Plates were grown to 60–70%onfluence, and cells were transfected with 10 mg DNA using Lipo-ectamine (Gibco BRL) according to the manufacturer’s protocol.ransfected cells were fixed and immunostained as described previ-usly (Kachinsky et al., 1994) either with monoclonal antibodies touman c-myc (5 mg/ml, Zymed) or with affinity-purified polyclonalntibody to GST–Cops2 and visualized with either Texas red-conju-ated anti-mouse IgG (1 mg/ml, Vector) or fluorescein-conjugatednti-rabbit IgG (1 mg/ml, Vector), respectively. The optimal concen-ration of affinity-purified Cops2 polyclonal antibody was experimen-ally determined for each batch of affinity-purified antibody.

RESULTS AND DISCUSSION

solation and Characterization of the Mouse Cops2Gene

To identify Drosophila genes with potential roles inuscle development, the Flybase database (Flybase,

998) was searched with the keywords “muscle,” “myo-enesis,” and “myoblast.” The gene alien was chosenor further study because of its specific expression at

uscle attachment sites during embryogenesis and be-ause of its homology with TRIP15. The sequence ofrosophila alien was used to perform homology

earches of the EST database (Boguski et al., 1993).everal overlapping mouse ESTs were identified; theequence for the entire open reading frame except therst five nucleotides was obtained both from existingequence in the database and from our sequencing ofwo overlapping EST clones (Research Genetics, IM-GE Consortium clones 518651 and 58370). To obtainequence for the start codon, we subcloned and se-uenced a genomic fragment containing the 59-mostxon from a BAC clone containing the mouse alienomologue coding sequence. The genomic sequenceontained five additional nucleotides that are identicalo the Drosophila alien sequence and included the Dro-ophila start codon. The sequence upstream of the pu-ative start codon in mouse was divergent from therosophila cDNA. Given the high homology between

he Drosophila and the mouse genes, it is likely thathe ATG in the mouse sequence that corresponds to therosophila start codon is also the start codon in mouse.he open reading frame from the putative start codon

s 1329 nucleotides in length, encoding a 443-amino-

aOGC(

smipsaew

twWmechi

shtol

ETnUlnck

312 SCHAEFER, BEERMANN, AND MILLER

cid protein, which has a predicted weight of 49 kDa.n Western blot analysis, polyclonal antibody to aST–Cops2 fusion protein detects a 50-kDa band in2C12 myoblast lysates, confirming this prediction

data not shown).During homology searches with the Drosophila alien

equence, ESTs from several other species besidesouse were identified, including human and Drosoph-

la. Our comparison between the mouse and previouslyredicted Drosophila sequence (Goubeaud et al., 1996)howed that the mouse protein was larger, with 83dditional amino acids at the carboxy-terminus. How-ver, alignment of newly identified Drosophila ESTsith the published sequence revealed that the fly pro-

FIG. 1. (A) Multiple alignment of the protein sequences of mousST, and C. elegans (predicted protein from genomic sequence). Amhe underlined portion indicates the region of homology with compumbers are as follows: mouse Cops2/COP9 subunit 2, AF0876897190; R. communis EST, T14894; C. elegans, U97190 (predicted pr

ocus. The coding exons of mouse Cops2 are depicted as boxes, with groncoding regions. Restriction sites for PstI and HindIII are depicteomplex subunits is indicated by the bracket. The slash marks indicb.

ein actually contained the additional 83 residues andas 444 instead of 360 amino acids in length (Fig. 1A).e also aligned human ESTs with the published hu-an TRIP15 sequence, which is a partial sequence

ncompassing 700 bp of open reading frame, not in-luding the start codon. Alignment of TRIP15 withuman ESTs resulted in 1.8 kb of sequence encompass-

ng the entire open reading frame (Fig. 1A).Comparison between the mouse and full-length Dro-

ophila amino acid sequences shows that the protein isighly conserved, with 89% similarity and 84% iden-ity. The mouse and human sequences are very homol-gous, with no sequence differences at the amino acidevel and 94% identity at the nucleotide level. Align-

ops2, human COPS2/TRIP15/Sgn2, Drosophila alien, R. communisacids identical in at least four of the sequences are shaded in gray.nts of the proteosome regulatory complex. The GenBank accession09166; human TRIP15/Sgn2, L40388/3514097; Drosophila alien,

in from ORFs B0025.3/.2). (B) Genomic structure of the mouse Cops2ortions representing coding regions and black portions representings bars with “P” and “H,” respectively. The homology to proteosomethe large intron between exons 1 and 2, which is approximately 10

e Cinoone8/33oteay pd aate

minTgsEsfiouAsqgatstWhp

G

ccresssletfirh1w

tlshesgeiwh

C

ifccmrjcwbt1TotadC

E

amat

s

313MOUSE Cops2

ent of the Drosophila, human, and mouse sequencess depicted in Fig. 1A along with sequences from Cae-orhabditis elegans and the plant Riccinus communis.he C. elegans protein sequence was predicted fromenomic sequence in GenBank, and the R. communisequence is a partial sequence from the EST database.STs corresponding to alien homologues in rat, Dictyo-telium discoideum, and A. thaliana were also identi-ed by BLAST searches. The carboxy-terminal portionf the protein contains homology with proteosome sub-nit p44.5 in humans (GenBank Accession No.B003102), with 36% identity over a 155-amino-acidtretch. We also identified homology to a protein se-uence predicted from Saccharomyces cerevisiaeenomic DNA (GenBank Accession No. X95644), whichppears to be analogous to human p44.5 (45% iden-ity). The alien protein has recently been identified asubunit 2 in a highly conserved protein complex calledhe signalosome or COP9 complex (Seeger et al., 1998;

ei et al., 1998). For this reason, the mouse alienomologue has been designated Cops2 (constitutivehotomorphogenic Arabidopsis homologue subunit 2).

enomic Organization of the Mouse Cops2 Locus

The genomic locus of the mouse gene was physicallyharacterized through restriction mapping of a BAClone containing the Cops2 gene and confirming theestriction pattern on genomic DNA. Subsequently, thexon–intron boundaries were precisely determined byequencing BAC subclones (Table 1). We designed theequencing primers through comparison to genomicequence in the database corresponding to the humanocus (GenBank Accession No. AP000028). These prim-rs were also used to PCR-amplify genomic BAC DNAo determine the sizes of all the introns, except for therst large intron, the size of which was estimated byestriction map analysis and by comparison with theuman genomic sequence. Mouse Cops2 is encoded by2 coding exons spanning approximately 30 kb of DNA,ith the largest intron at approximately 10 kb between

TAB

Exon–Intron Junctions

Exon 39 Splice acceptor 59 Splic

1 CGACCTGg2 tactacacagGAGTACT CCAAAAGg3 tccattgtagGTTTTGG CAAGTTGg4 tttctcacagACAAACT TAAACAGg5 tttatgtcagATGGATT CACAAAGg6 ttttttacagCTTGGAA TTGTCAGg7 gttttcctagACTGATG ATCAGAGg8 ttgtttacagAATGCGG TAGTAAGg9 tccatgttagTGCCTAT ATTGAAGg

10 tgtctttcagAACTTTT TTCTAAGg11 tttgttacagGAGCTAA TGGATAAg12 ttggttccagCACTATT

Note. The exon and intron sequences are shown in upper- and lowehown in boldface type.

he first and the second exon (Fig. 1B and Table 1). Theocation of the exon–exon boundaries and the relativeizes of the introns are conserved between mouse anduman. Both species have a very small intron betweenxons 5 and 6 (110 bp in mouse, 118 in human), theequence of which is conserved at 80% identity, sug-esting possible functional significance. There is novidence to date for alternative splicing that wouldnclude this intron as part of the cDNA; inclusionould result in the introduction of a stop codon in bothuman and mouse.

hromosomal Localization of Mouse Cops2

The mouse Cops2 locus was genetically mapped us-ng the BSS C57BL/6J 3 Mus spretus backcross panelsrom The Jackson Laboratories to the central portion ofhromosome 2 between Ltk (67 cM) and Ptpns1 (70M), shown in Fig. 2. Comparison of the region ofouse chromosome 2 where Cops2 maps to syntenic

egions in human reveals that this area has been sub-ect to several rearrangements during evolution. Byytogenetic mapping, human LTK maps to 15q15,hereas human PTPNS1 maps to 20p13. The gene for-2 microglobulin (B2m, 69 cM), which maps proximalo Ptpns1 in mouse by cytogenetic mapping, maps to5q21–q22 in humans (Mouse Genome Informatics,he Jackson Laboratory, http://www.informatics.jax.rg). The adjacent interval distal to Cops2 also con-ains genes that map to human 2q13, including Il1and Il1b (73 cM). According to genomic sequence in theatabase corresponding to the human locus, humanOPS2 unexpectedly appears to be on 21q22.11.

xpression Analysis

Mouse Cops2 is widely expressed in embryonic, fetal,nd adult tissues. By Northern analysis, we found thatouse Cops2 cDNA hybridizes to two mRNA bands in

ll tissues examined at ;2.3 and ;4 kb, with an addi-ional ;1.9-kb band in liver, shown in Fig. 3A. Expres-

1

the Mouse Cops2 Gene

nor Exon size (bp) Intron size (bp)

ggcgca .56ttcaaa 114 ;10,000gattta 78 ;1,800gacttg 126 ;4,000

acaattg 90 ;2,200cattcc 78 110

agtttgg 175 ;2,200gattta 232 ;1,500gttgtt 98 ;1,600ttgtgg 83 ;1,800gtactc 59 ;1,100

.700 ;1,700

se letters, respectively. The splice acceptor and donor sequences are

LE

in

e do

tgatgctaattatataatataatgctattaa

rca

sefi1aisicmctbetabm(s

ts

C

mppnbittkbfCitplHsdastn1tCTnsr(ot

kboia(mtasnaIfinprm2

2mac6tbptbTtGmR

314 SCHAEFER, BEERMANN, AND MILLER

ion was detected as early as E7.5. This widespreadxpression pattern during embryogenesis was con-rmed by whole mount in situ hybridization on E8.5–0.5 embryos and by RT-PCR on several embryonicnd postnatal tissues (data not shown). In situ hybrid-zation on sections of E11.5, E15.5, and E16.5 embryoshowed expression in a wide variety of tissues, includ-ng skeletal muscle, lung, liver, kidney, retina, and theentral nervous system; only cartilage and smoothuscle did not have detectable expression levels (pers.

omm., Gary Lyons, University of Wisconsin). Cops2ranscript was also detected in the C2C12 mouse myo-last cell line by RT-PCR and Northern analysis. Ourxpression analysis data showing widespread distribu-ion of the Cops2 transcript both pre- and postnatallyre supported by data from other groups who haveeen able to extract the protein biochemically fromouse brain, liver, spleen, and human erythrocytes

Seeger et al., 1998; Wei et al., 1998). The possiblepecies-dependent, tissue-specific functions of Cops2

FIG. 2. Cops2 maps in the central portion of mouse chromosome. Cops2 was mapped using The Jackson Laboratory BSS backcrossapping panel (Rowe et al., 1994). The segregation patterns of Cops2

nd flanking loci are shown at top with each column representing thehromosome in the backcross progeny inherited from the (C57BL/J 3 M.spretus) F1 parent. The number of offspring inheriting eachype of chromosome is depicted below each column. Black and whiteoxes represent C57BL/6J and M.spretus alleles, respectively. Theartial chromosome 2 linkage map at the bottom of the figure depictshe location of Cops2 with respect to flanking loci, with the recom-ination frequency 6 standard error shown between pairs of loci.he locations of loci in the human genome are shown to the right ofhe loci names (Genome Data Base, http://gdbwww.gdb.org/; Mouseenome Informatics, http://www.informatics.jax.org/). The Cops2apping data are available in the Mouse Genome Database undereference No. J:51125.

hat lead to its restricted expression pattern in Dro-ophila remain to be determined.

ellular Localization of Cops2 Protein

C-myc-tagged Cops2 protein was expressed in C2C12yoblasts to examine the cellular localization of the

rotein. Cops2 appears to be present in both the cyto-lasm and the nucleus, with larger amounts in theucleus in some cells (Fig. 3B). Similarly, Westernlots detected approximately equal amounts of Cops2n nuclear and cytoplasmic fractions prepared fromransfected C2C12 cultures (data not shown). The myc-agged Cops2 protein migrated at approximately 50Da on Western blots; this size was confirmed by hy-ridization with a polyclonal antibody to a GST–Cops2usion protein (data not shown). In contrast to our2C12 data, the immunostaining pattern in Drosoph-

la embryos indicated a primarily cytoplasmic localiza-ion (Goubeaud et al., 1996). The COP9 protein com-lex, which includes the Cops2 protein, was foundocated in the nucleus in Arabidopsis (Wei et al., 1998).owever, antibody to a different subunit (COP9, i.e.,

ubunit 8) was used to visualize the complex in Arabi-opsis, and the cellular location of unbound subunit 8nd Cops2 (subunit 2) could differ. Antibody to anotherubunit of the complex, Sgn3 (subunit 3), detected cy-oplasmic localization with concentration around theucleus in human mesothelioma cells (Seeger et al.,998). It is possible that free Cops2 protein remains inhe cytoplasm, whereas Cops2 associated with theOP9 protein complex is translocated into the nucleus.his idea is supported by data from Arabidopsis. Ge-etic crosses with plants mutant for one of the otherubunits, COP11 (subunit 1), resulted in cytoplasmicather than nuclear localization of the COP9 complexChamovitz et al., 1996), demonstrating a requirementf at least one of the other subunits for proper nuclearranslocation.

The Cops2 protein is conserved in multicellular eu-aryotic organisms from plants to worms to verte-rates. The recent identification of Cops2 as subunit 2f the signalosome/COP9 complex gives some insightnto its function. In plants, the complex was identifieds a developmental regulator of photomorphogenesisWei et al., 1998). Sequence analysis of its subunits in

ouse and human revealed that one of the subunits ishe JAB1 protein, which binds and phosphorylates thectivation domain of c-Jun. In addition, three otherubunits contain activation loops for MAP kinase ki-ase (MAPKK) (Seeger et al., 1998). The complex haslso been shown to phosphorylate NF-kB inhibitorskBa and p105 in vitro (Seeger et al., 1998). Thesendings suggest that the complex is involved in a sig-al transduction pathway. In the absence of a phos-horylation substrate, purified human complex waseported to autophosphorylate an ;50-kDa band thatay correspond to Sgn2, i.e., human Cops2 or subunit(Seeger et al., 1998). Cops2 may function as part of a

dsrlthc

fmHthrhocffasKZdtaMsd

owboa

DULa

A

A

A

B

C

A(p

315MOUSE Cops2

evelopmental regulator in higher eukaryotes. Thepecific interaction of Cops2 with nuclear DNA-bindingeceptors may suggest a role for this complex in regu-ation of gene expression by affecting DNA binding andhus gene transcription. In support of this idea, JAB1as been shown to stabilize c-Jun with AP-1 sites inell extracts (Claret et al., 1996).The ligand-dependent interactions with TR and RXR

amily members suggest a possible role of Cops2 inyogenic differentiation and fiber-type specification.ypothyroidism, i.e., lack of the TR ligand T3, slows

he normal transition of embryonic to adult myosineavy chain (MHC) expression and in adults causeseinduction of embryonic MHC isoforms. Conversely,yperthyroidism results in acceleration of the embry-nic-to-adult MHC conversion and in adults causesonversion from slow twitch to fast twitch muscle iso-orms (for review see Muscat et al., 1995). RXR and TRamily members have been shown to heterodimerizend bind to the regulatory sequences of several muscle-pecific genes (Conlon, 1995; Downes et al., 1993;liewer et al., 1992; Muscat et al., 1993, 1994, 1995;hang et al., 1992). RXRs and TRs appear to haveifferential effects on inducing myoblast differentia-ion (Albagli-Curiel et al., 1993) and can modulate onenother’s transcription (Cassar-Malek et al., 1996;ano et al., 1993), suggesting that the retinoid and T3

ignaling pathways may have both overlapping andistinct roles in myogenesis. The converse interaction

FIG. 3. Expression analysis of mouse Cops2. (A) Clontech multiprrows indicate the Cops2 transcripts. (B) C2C12 myoblasts transf

Left) Immunostaining with monoclonal antibodies to human c-molyclonal antibody to GST–Cops2 fusion protein. (Right) The cells s

f Cops2 (and thus the COP9/signalosome complex)ith inactivated, unbound TRb and activated, ligand-ound RXRa could underlie the differential regulationf myogenesis by thyroid hormone and 9-cis-retinoiccid.

ACKNOWLEDGMENTS

This work was supported by NIAMS, NIDR, and the Muscularystrophy Foundation. The authors thank Dr. Gary E. Lyons at theniversity of Wisconsin for in situ hybridization on embryo sections,ucy Rowe at The Jackson Laboratory for assistance in the mappingnalysis, and Jeremy Lambert for technical assistance.

REFERENCES

lbagli-Curiel, O., Carnac, G., Vandromme, M., Vincent, S.,Crepieux, P., and Bonnieu, A. (1993). Serum-induced inhibition ofmyogenesis is differentially relieved by retinoic acid and triiodo-thronine in C2 murine muscle cells. Differentiation 52: 201–210.

ltschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z.,Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: A new generation of protein database search programs.Nucleic Acids Res. 25: 3389–3402.usubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman,J. G., Smith, J. A., and Struhl, K. (Eds.) (1997). “Current Protocolsin Molecular Biology,” Wiley, New York.oguski, M. S., Lowe, T. M., and Tolstoshev, C. M. (1993). dbEST—Database for “expressed sequence tags.” Nat. Genet. 4: 332–333.

assar-Malek, I., Marchal, S., Rochard, P., Casas, F., Wrutniak, C.,Samarut, J., and Cabello, G. (1996). Induction of c-Erb A-AP-1interactions and c-Erb A transcriptional activity in myoblasts by

issue Northern blots hybridized with mouse Cops2 coding sequence.ed with myc-tagged Cops2 protein to examine cellular localization.. (Center) The same cells immunostained with affinity-purifieded with bisbenzimide to visualize nuclei. The bar represents 28 mm.

le tect

yctain

C

C

C

D

D

F

F

G

H

K

K

L

M

M

M

M

M

M

R

S

S

W

W

Z

316 SCHAEFER, BEERMANN, AND MILLER

RXR: Consequences for muscle differentiation. J. Biol. Chem. 271:11392–11399.hamovitz, D. A., Wei, N., Osterlund, M. T., von Arnim, A. G., Staub,J. M., Matsui, M., and Deng, X.-W. (1996). The COP9 complex, anovel multisubunit nuclear regulator involved in light control of aplant developmental switch. Cell 86: 115–121.

laret, F.-X., Hibi, M., Dhut, S., Toda, T., and Karin, M. (1996). Anew group of conserved coactivators that increase the specificity ofAP-1 transcription factors. Nature 383: 453–457.onlon, R.A. (1995). Retinoic acid and pattern formation in verte-brates. Trends Genet. 11: 314–319.ominov, J. A., Dunn, J. J., and Miller, J. B. (1998). Bcl-2 expressionidentifies an early stage of myogenesis and promotes clonal expan-sion of muscle cells. J. Cell Biol. 142: 537–544.ownes, M., Griggs, R., Atkins, A., Olson, E. N., and Muscat, G. E. O.(1993). Identification of a thyroid hormone response element in themouse myogenin gene: Characterization of the thyroid hormoneand retinoid X receptor heterodimeric binding site. Cell GrowthDiffer. 4: 901–909.

lybase (1998). FlyBase—A Drosophila database. Nucleic Acids Res.26: 85–88. [http://flybase.bio.indiana.edu/].

roeschle, A., Alric, S., Kitzmann, M., Carnac, G., Aurade, F., Ro-chette-Egly, C., and Bonnieu, A. (1998). Retinoic acid receptorsand muscle b-HLH proteins: Partners in retinoid-induced myogen-esis. Oncogene 16: 3369–3378.oubeaud, A., Knirr, S., Renkawitz-Pohl, R., and Paululat, A. (1996).The Drosophila gene alien is expressed in the muscle attachmentsites during embryogenesis and encodes a protein highly con-served between plants, Drosophila, and vertebrates. Mech. Dev.57: 59–68.ogan, B., Beddington, R., Constantini, F., and Lacy, E. (Eds.)(1994). “Manipulating the Mouse Embryo,” 2nd ed., Cold SpringHarbor Laboratory Press, Cold Spring Harbor, NY.achinsky, A. M., Dominov, J. A., and Miller, J. B. (1994). Myogen-esis and the intermediate filament protein nestin. Dev. Biol. 165:216–228.liewer, S. A., Umesono, K., Manglesdorf, D. J., and Evans, R. M.(1992). Retinoic X receptor interacts with nuclear receptors inretinoic acid, thyroid hormone, and vitamin D3 signalling. Nature355: 446–449.

ee, J. W., Choi, H.-S., Gyuris, J., Brent, R., and Moore, D. D. (1995).Two classes of proteins dependent on either the presence or ab-sence of thyroid hormone for interaction with the thyroid hormonereceptor. Mol. Endocrinol. 9: 243–254.ano, H., Ozawa, T., Takeyama, K., Yoshizawa, Y., Kojima, R., Kato,S., and Masushige, S. (1993). Thyroid hormone affects the gene

expression of retinoid X receptors in the adult rat. Biochem. Bio-phys. Res. Commun. 191: 943–949.archal, S., Cassar-Malek, I., Pons, F., Wrutniak, C., and Cabello,G. (1993). Triiodothyronine influences quail myoblast proliferationand differentiation. Biol. Cell 78: 191–197.orgenstern, J. P., and Land, H. (1990). A series of mammalianexpression vectors and characterization of their expression of areporter gene in stably and transiently transfected cells. NucleicAcids Res. 18: 1068.uscat, G. E. O., Downes, M., and Dowhan, D. H. (1995). Regulationof vertebrate muscle differentiation by thyroid hormone: The roleof the myoD gene family. BioEssays 17: 211–218.uscat, G. E. O., Griggs, R., Downes, M., and Emery, J. (1993).Characterization of the thyroid response element in the skeletala-actin gene: Negative regulation of T3 receptor binding by theretinoid X receptor. Cell Growth Differ. 4: 269–279.uscat, G. E. O., Mynett-Johnson, L., Dowhan, D., Downes, M., andGriggs, R. (1994). Activation of myoD gene transcription by 3,5,39-triiodo-L-thyronine: A direct role for the thyroid hormone andretinoid receptors. Nucleic Acids Res. 22: 583–591.owe, L. B., Nadeau, J. H., Turner, R., Frankel, W. N., Letts, V. A.,Eppig, J. T., Ko, M. S., Thurston, S. J., and Birkenmeier, E. H.(1994). Maps from two interspecific backcross DNA panels avail-able as a community genetic mapping resource. Mamm. Genome 5:253–274.

chaefer, L., Ballabio, A., and Zoghbi, H. Y. (1996). Cloning andcharacterization of a putative human holocytochrome c-typesynthetase gene (HCCS) isolated from the critical region formicrophthalmia with linear skin defects (MLS). Genomics 34:166 –172.

eeger, M., Kraft, R., Ferrell, K., Dawadschargal, B.-O., Dumdey,R., Schade, R., Gordon, C., Naumann, M., and Dubiel, W. (1998).A novel protein complex involved in signal transduction possess-ing similarities to 26S proteosome subunits. FASEB J. 12: 469 –478.ei, N., Chamovitz, D. A., and Deng, X.-W. (1994). ArabidopsisCOP9 is a component of a novel signaling complex mediating lightcontrol of development. Cell 78: 117–124.ei, N., Tsuge, T., Serino, G., Dohmae, N., Takio, K., Matsui, M., andDeng, X.-W. (1998). The COP9 complex is conserved betweenplants and mammals and is related to the 26S proteosome regu-latory complex. Curr. Biol. 8: 919–922.

hang, X.-K., Hoffman, B., Tran, P. B. V., Graupner, G., andPfahl, M. (1992). Retinoid X receptor is an auxiliary protein forthyroid hormone and retinoic acid receptors. Nature 355: 441–446.