combination effect of pectasol and doxorubicin on viability, cell cycle arrest and apoptosis in...
DESCRIPTION
The effect of PectaSol on Dox (Doxorubicin) cytotoxicity in terms of apoptosis and cell cycle changes in PCa (prostate cancer) cell lines (DU-145 and LNCaP) has been investigated. Combination of PectaSol and Dox resulted in a viability of 29.4 and 32.6% (P,0.001) in DU-145 and LNCaP cells. The IC50 values decreased 1.5-fold and 1.3-fold in the DU-145 and LNCaP cells respectively. In the DU-145 cells, combination of PectaSol and Dox resulted in a reduction in p27 gene and protein expression (P,0.001). In LNCaP cells, this combination increased p53, p27 and Bcl-2 expression. Treatment with both drugs in DU-145 cells led to an increase in sub-G1 arrest (54.6% compared with 12.2% in Dox). In LNCaP cells, combination of the drugs led to an increased in G2/M arrest (61.7% compared with 53.6% in Dox). Based on these findings, progressive cytotoxicity effect of Dox and PectaSol together rapidly induce cell death in DU-145 through apoptosis and in LNCaP cells through cell cycle arrest (G2/M arrest).TRANSCRIPT
![Page 1: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/1.jpg)
Combination effect of PectaSol and Doxorubicin on viability,cell cycle arrest and apoptosis in DU-145 and LNCaPprostate cancer cell linesNajmeh Tehranian*, Houri Sepehri1*, Parvin Mehdipour{, Firouzeh Biramijamal1, Arash Hossein-Nezhad",I, AbdolfattahSarrafnejadI and Ebrahim Hajizadeh*** Animal Biology Department, School of Biology, University College of Sciences, University of Tehran, PO Box 1415, Tehran, Islamic Republic of Iran{ Department of Medical Genetics, School of Medicine, Tehran University of Medical Sciences, PO Box 1417613151, Tehran, Islamic Republic of Iran1
National Institute of Genetic Engineering and Biotechnology, PO Box 14965/161, Tehran, Islamic Republic of Iran"
Bio and Nanotechnology group, Endocrinology and Metabolism Research Center, Shariati Hospital, Tehran University of Medical Sciences,PO Box 14965/161, Tehran, Islamic Republic of Iran
IDepartment of Pathology, School of Public Health, Tehran University of Medical Sciences, PO Box 1417613151, Tehran, Islamic Republic of Iran
**Department of Biostatistics, Faculty of Medical Sciences, Tarbiat Modares University, PO Box 14115-111, Tehran, Islamic Republic of Iran
AbstractThe effect of PectaSol on Dox (Doxorubicin) cytotoxicity in terms of apoptosis and cell cycle changes in PCa (prostate
cancer) cell lines (DU-145 and LNCaP) has been investigated. Combination of PectaSol and Dox resulted in a viability of
29.4 and 32.6% (P,0.001) in DU-145 and LNCaP cells. The IC50 values decreased 1.5-fold and 1.3-fold in the DU-145 and
LNCaP cells respectively. In the DU-145 cells, combination of PectaSol and Dox resulted in a reduction in p27 gene
and protein expression (P,0.001). In LNCaP cells, this combination increased p53, p27 and Bcl-2 expression. Treatment
with both drugs in DU-145 cells led to an increase in sub-G1 arrest (54.6% compared with 12.2% in Dox). In LNCaP cells,
combination of the drugs led to an increased in G2/M arrest (61.7% compared with 53.6% in Dox). Based on these findings,
progressive cytotoxicity effect of Dox and PectaSol together rapidly induce cell death in DU-145 through apoptosis and in
LNCaP cells through cell cycle arrest (G2/M arrest).
Keywords: Doxorubicin (Dox); gene expression; PectaSol; prostate cancer (PCa) cell lines (DU-145; LNCaP); protein expression; viability
1. Introduction
PectaSol MCP (modified citrus pectin), a complex water-soluble
indigestible polysaccharide obtained from the peel and pulp of
citrus fruits and modified by means of high pH treatment, which
was invented by Isaac Eliaz and uses as a dietary supplement has
emerged as one of the most promising anti-metastatic drugs
(Glinsky and Raz, 2009) that decreases PSA (Pisum sativum
agglutinin) in prostatic cancer patients (Guess et al., 2003; Elsadek
et al., 2011). PCa (prostate cancer) is the world’s most common
malignancy and the second leading cause of death from cancer
(Sanches et al., 2009). It is an androgen-dependent tumour, and
therefore hormone ablation therapy is often used as a primary
treatment option for symptomatic advanced patients, but 20% of
patients are refractory to treatment. Furthermore patients who
exhibit an initial therapeutic response will relapse within 3 years
with androgen-independent carcinoma that is rapidly fatal (Nehme
et al., 2001). Cytotoxic chemotherapy is currently used to control
and treat PCa. Dox (Doxorubicin) has broad spectrum therapeutic
activity against various types of cancers, including PCa. It induces
apoptosis in LNCaP (androgen-dependent; Kang et al., 2005) and
DU-145 (androgen-independent; Tyagi et al., 2002) cell lines (Wu
et al., 2002). Treatment with high doses of Dox causes .40% of
LNCaP cells to have fragmented DNA in a dose-dependent
manner. Also Dox in low doses activates the G1 checkpoint via a
p53 pathway (Collins et al., 2006). Chemotherapy or irradiation
primarily act by triggering apoptosis in cancer cells (Opel et al.,
2008), and Dox induces apoptosis by a p53-dependent (Wang
et al., 2004). The Bcl-2 family plays a critical role in the regulation
of apoptosis by functioning as promoters (e.g. Bax) or inhibitors
(Bcl-2 or Bcl-xL) of cell death (Mantena et al., 2006). The
knockdown of anti-apoptotic genes [Bcl-2, Bcl-xL and XIAP (X-
linked inhibitor of apoptosis)] should enhance chemosensitivity to
the Dox (Kim et al., 2009), and therefore the effects of combining
Dox and PectaSol on the expression of p53, p21, p27, Bax and
Bcl-2 genes were examined. The use of Dox in patients with PCa
is limited because concentrations required to kill cancerous cells
cannot be attained without systemic toxicity, including severe
immunosuppression and cardiomyopathy (Tyagi et al., 2002).
There has been intense public and scientific interest in finding
other approaches to controlling and treating PCa, resulting in the
use of natural substances and/or combination chemotherapy
(Tyagi et al., 2002; Rabi et al., 2009). Combination therapy draws
on PectaSol MCP with its high anticancer effects and low toxicity
to normal tissues, as well as dietary supplements and anticancer
drugs (Johnson et al., 2007). The exact mechanism by which MCP
produces its effects has not been established, but is probably
mediated via the regulation of cell cycle arrest and apoptosis
(Glinsky and Raz, 2009). However, the molecular signalling
1 To whom correspondence should be addressed (email [email protected]).Abbreviations: Dox, Doxorubicin; MCP, modified citrus pectin; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide; PTEN, phosphatase andtensin homologue deleted on chromosome 10; RT-PCR, real-time PCR.
Cell Biol. Int. (2012) 36, 601–610 (Printed in Great Britain)
Short Communication
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N doi:10.1042/CBI20110309 N www.cellbiolint.org 601
![Page 2: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/2.jpg)
involved in combination of Dox and PectaSol-mediated anti-
tumour activity has not been fully explored. Our strategy has been
to explore and understand the mechanisms of action of combined
Dox and PectaSol treatment. Genetic targeting or pharmaco-
logical manipulation of the cyclin-dependent kinase inhibitors, p27
and p21, and its major regulator, p53, which are important
regulators of cell cycle progression, and the ratio of Bax/Bcl-2 that
is in favour of apoptosis, might provide better strategies. Targeting
the expression of p53, p21, p27, Bax and Bcl-2 is shown here to
be a useful approach for investigating cell cycle arrest and
apoptosis.
2. Materials and methods
2.1. Cell lines and reagents
Human PCa DU-145 and LNCaP cells obtained from [NCBI
(National Cell Bank of I.R. Iran] were grown in RPMI 1640
medium supplemented with 10% heat inactivated FBS (fetal
bovine serum), L-glutamine 1%, penicillin 100 units/ml strep-
tomycin 100 mg/ml, and antibiotics at 37uC in a 5% CO2 in air
atmosphere at 90–95% humidity. A 10 mg stock solution of
PectaSol was obtained from EcoNugenics, Inc. (Santa Rosa,
CA), whereas Dox was obtained from (EBEWE Pharma Gmbh
Nfg). Antibodies to P53 and P27 were purchased from Santa
Cruz Biotechnology. The stock solutions were brought to their
final concentrations by dilution in medium immediately before
use.
2.2. Measurement of cell growth inhibition by MTT[3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide] assay
DU-145 and LNCaP cells were seeded at 16105 cells per well in
96-well microtitre culture plates. The cells were maintained in the
exponential growth phase after an overnight incubation by
removing the medium with a pipette and replacing it with a fresh
medium containing different concentrations of PectaSol (0.5, 1, 3
and 5 mg/ml), Dox (10.25, 50, 100, 250 and 500 nM) or a
combination of both. The cells were cultured for 24, 48 and
72 h. At each point, cell viability was determined by measuring
MTT absorbance dye; Sigma–Aldrich) at 570 nm by a multi-well
spectrophotometer. The required concentration necessary to
produce 50% cell growth inhibition (IC50) was determined by
interpolation from dose-response curves. The control wells were
untreated cells that only received fresh medium.
2.3. Measurement of expression of p53, p21, p27,Bcl-2 and Bax genes by RT-PCR (real-time PCR)in DU-145 and LNCaP cell lines
To determine gene expression, cDNA was generated. Total
RNA was reverse transcribed using Revert Aid First Strand
cDNA Synthesis Kit (Fermentas). One microgram of total RNA
was reversibly transcribed to cDNA in a reaction condition of
0.2 mg/ml Oligo (dt)18 primer, 4 ml 56 reaction buffer, 20 mg/ml
RibolockTM RNase inhibitor, 10 mM dNTP mix, 200 mg/ml MuLV
reverse transcriptase in 20 ml and incubated for 5 min at 65uC,
60 min at 42uC and the reaction stopped by incubating for
5 min at 70uC. To confirm cDNA, each cDNA was tested by PCR
using Taq DNA Polymerase master Mix Red (Amplicon).
PCR was carried out in 20 ml containing 50 ng of the resulting
cDNA, 20 pmol/ml of sense and antisense b-actin primer, 10 ml
of 26 Master Mix Red (0.5 unit/ml Taq polymerase, 1.5 mM
MgCl2, 150 mM Tris/HCl, 40 mM (NH4)2S04, 0.2% Tween 20
and 0.4 mM dNTP). The reactions were subjected to 30 cycles
of 94uC for 20 s (denaturation), 65uC for 10 s (annealing) and
72uC for 30 s (extension), followed by 10 min at 72uC (final
extension).
2.4. Real-time PCR
To quantify p53, p21, p27, Bcl-2, Bax and b-actin genes by
quantitative RT-PCR, approximately 50 ng of their cDNAs was
treated with 26 MaximaTM SYBR Green/ROX qPCR (quantitat-
ive PCR) Master Mix (Fermentas) and 10 mM of each primer in
20 ml. These reactions were performed on a Step-One-PlusTM
real-time (ABI Applied Biosystems). All assay efficiencies were
monitored using a standard curve. The resulting CTs (computed
tomographies) were normalized to the b-actin housekeeping
gene. All samples were analysed independently at least 3 times
for each gene. Primers sequences for the reactions are given in
Table 1.
2.5. Measurement of p53 and p27 protein expression
The cell lines were cultured at 16105 cells in 96-well plates. The
DU-145 and LNCaP cells were treated after overnight culture with
IC50 concentrations of Dox, 250 and 290 nM, and PectaSol 3 at
4 mg/ml alone or together for 48 h. At each time-point, the cells
were incubated for 2 h at 4uC with primary antibody against p53
and p27 in a 1:200 dilution (Dako and Santa Cruz Biotechnology).
The cells were thereafter washed once in PBS and incubated with
secondary FITC-linked antibody for 45 min at room temperature in
Table 1 Primer sequences
mRNA target Forward (5) primers Reverse (3) primers Amplicon size (bp)
Bcl2 59GCCTTCTTTGAGTTCGG39 59GGGTGATGCAAGCTCC39 286Bax 59GCATCGGGGACGAACTGG39 59GTCCCAAAGTAGGAGAGGA39 306p53 59GGCCCACTTCACCGTACTAA39 59GTGGTTTCAAGGCCAGATGT39 156P21 59GACACCACTGGAGGGTGACT39 59CAGGTCCACATGGTCTTCCT39 172P27 59TCTACTGCGTGGCTTGTCAG39 59C1TGTATTTGGAGGCAGAGCA39 240bactin 59GCAAGCAGGAGTATGACGAG39 59CAAATAAAGCCATGCCAATC39 144
Effect of Doxorubicin and PectaSol on prostate cancer cell lines
602 www.cellbiolint.org N Volume 36 (7) N pages 601–610 E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
![Page 3: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/3.jpg)
the dark. Finally, the cells were washed with PBS and fixed in
paraformaldehyde. Fluorescence was measured by FACScan
equipment (Becton Dickinson). p53 and p27 were detected by
flow cytometry using the Flow Max programme.
2.6. Cell cycle analysis
DU-145 and LNCaP cells were treated with PectaSol and Dox
either alone or in combination for 48 h. After treatment the cells
were trypsinized and treated with blocking solution (PBS–
ethanol: 70%) and incubated at 4uC for 2 h in the dark. The
cells were incubated in PI Master Mix (40 ml/ml PI, 950 ml/ml PBS
and 10 ml/ml RNase) at 37uC for 0.5 h in dark. Cell cycle
distribution was analysed by flow cytometry analysis of the Flow
Max program.
2.7. Statistical analysis
Statistical evaluation of the data was performed using the
parametric test of one-way ANOVA. P,0.05 was considered
statistically significant. All the experiments were repeated at least
three times, and the results are presented as means¡S.D. with
SPSS 13 software.
3. Results
3.1. Effects of PectaSol and Dox alone or incombination on DU-145 cell-growth inhibition
Treatment of DU-145 cells with PectaSol (0.5–5 mg/ml) resulted in
a significant reduction in proliferation and viability, ranging from
77.25 to 24.67% (P,0.001) after 48 h (optimum condition;
Table 2). Similar effects were obtained with Dox (10–500 nM),
ranging from 76.25–23.67% (P,0.001) after 48 h (optimum
condition; Table 2).
IC50 values were calculated from the cell proliferation plots.
Cytotoxicity increased in a time- and dose-dependent manner for
each agent. Greater cytotoxicity was observed at 48 h for each
agent, and the IC50 values of PectaSol and Dox in the DU-145 cell
lines were 3 mg/ml and 250 nM respectively (Table 2).
The cell growth suppressing effects of the PectaSol and Dox
combination in DU-145 cells by increasing concentrations of both
drugs at 48 h. In the first combination experiment, 100 and
250 nM of Dox (for 48 h) were added in combination with 3 mg/ml
(added for the last 24 h), and treatment with combination of
250 nM of Dox with 3 mg/ml resulted in a 29.4% viability of the
DU-145 cells by comparison with Dox alone 47.0% (Table 3 and
Figure 1).
IC50 values decreased 1.5-fold in the DU-145 cells (Table 3). In
the second combination, 250 nM Dox and 3 mg/ml PectaSol (IC50
dose) used together (for 48 h), the viability was 28.6% (P,0.001;
Table 3).
3.2. Effects of PectaSol and Dox alone or incombination on LNCaP cell-growth inhibition
The treatment of the LNCaP cells with PectaSol (1–10 mg/ml)
resulted in a significant reduction in proliferation/viability of LNCaP
cells ranging from 78.25 to 34.92% (P,0.001) after 48 h (optimum
condition) treatment.
Treatment of the LNCaP cells with Dox (10–500 nM) showed
decrease viability ranging from 85.42 to 32.53% (P,0.001) after
48 h (optimum condition; Table 2).
The respective IC50 values of PectaSol and Dox in LNCaP cells
were 4 mg/ml and 290 nM (Table 2).
Table 2 Effects of Dox and PectaSol on the viability of the DU145 and LNCaP cell lines after 48 h treatment
Cell lines Therapeutic agents Dose % Viability IC50 P value
DU145 Dox 10 nM500 nM
76.2523.67
250 nM 0.0010.001
PectaSol 0.5 mg/ml5 mg/ml
77.2524.67
3 mg/ml 0.001
LNCaP Dox 10 nM500 nM
85.4232.53
290 nM 0.0010.001
PectaSol 1 mg/ml10 mg/ml
78.2534.92
4 mg/ml 0.0010.003
Table 3 Effects of combination of Doxorubicin and PectaSol on viability of DU145 and LNCaP cell lines after 48 h treatmentDox+Pectasol treatment with Dox for first 24 h before adding PectaSol for second 24 h. Dox/Pectasolsimultaneous treatment with Dox and PectaSoltogether.
Cell lines Therapeutic agents Dose % Viability % IC50 decrease P value
DU145 Dox 100 nM250 nM
55.0247.04
0.0010.001
PectaSol 3 mg/ml 49.08 0.001Dox+PectaSol 100 nM+3 mg/ml
250 nM+3 mg/ml47.2429.36
1.5 fold
Dox/PectaSol 250 nM/3 mg/ml 28.6LNCaP Dox 100 nM
290 nM6252.25
0.0010.001
PectaSol 4 mg/ml 53.21 0.001Dox+PectaSol 100 nM+4 mg/ml
290 nM+4 mg/ml52.5032.50
1.3 fold
Dox/PectaSol 290 nM/4 mg/ml 31.6
Cell Biol. Int. (2012) 36, 601–610
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N www.cellbiolint.org 603
![Page 4: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/4.jpg)
In the first combination experiment, 100 and 290 nM of Dox for
48 h in combination with 4 mg/ml PectaSol (added for the last
24 h) was done, and treatment with combination of 290 nM of Dox
with 4 mg/ml resulted in 32.6% viability of the LNCaP cells by
comparison with Dox alone, 52.5%, (Table 3 and Figure 2).
The IC50 values decreased 1.3-fold in the LNCaP cells
(Table 3). In the second combination, 290 nM Dox and 4 mg/ml
PectaSol treatment of LNCaP cells were added for 48 h. Viability
was 31.6% (P,0.001; Table 3).
3.3. Effects of PectaSol and Dox on p53, p27 and p21gene expressions in DU-145 cells
In these experiments, the DU-145 cells were exposed to 250 nM
Dox (IC50) in the absence and presence of 3 mg/ml PectaSol for
48 h (IC50). RT-PCR showed that in the DU-145 cells, PectaSol
and Dox had no effect on the expression level of mutant p53
(Figure 3, Table 4).
RT-PCR demonstrated a significant decrease in the level of
p27 in the DU-145 cells exposed to both agents compared with
Dox alone (P,0.001; Figure 3 and Table 4). This shows that a
combined treatment compared with Dox alone down-regulated
p27 expression. This combination had no effect on p21
expression (Figure 3).
3.4. Effects of PectaSol and Dox on Bcl-2 and Baxand Bax/Bcl-2 gene expressions in DU-145 cells
The proteins of the Bcl-2 family play critical roles in the regulation
of apoptosis by functioning as promoters (e.g. Bax) or inhibitors
(Bcl-2 or Bcl-xL) of cell death process (Mantena et al., 2006). As
the levels of combination of Dox and PectaSol decreased the
viability of DU-145 cells compared with either agent alone,
the mechanisms underlying Dox/PectaSol decrease in viability is
probably through apoptosis. RT-PCR was used to detect Bcl-2
and Bax after Dox and PectaSol in combination. This had no effect
on the ratio of Bax/Bcl-2 compared with Dox alone, which
indicates that decreased viability probably relates to other
pathways of cell death (Figure 3, Table 4).
3.5. Effects of PectaSol and Dox on p53, p27, p21gene expression in LNCaP cells
A 290 nM/4 mg/ml combination of Dox and PectaSol significantly
increased the expression level of wild-type p53 in LNCaP cells
(P,0.05; Figure 4 and Table 4). An increase in p27 was found in
cells given a combination of both agents compared with PectaSol
and Dox alone (P,0.001). In these androgen-dependent PCa
cells, a combination of Dox and PectaSol had significant effect on
the level of p27 expression compared with either agent alone or
untreated controls (Figure 4 and Table 4).
3.6. Effects of PectaSol and Dox on Bcl-2, Bax andBax/Bcl-2 gene expression in LNCaP cells
RT-PCR used to detect Bcl-2 and Bax in the cells treated with Dox
or PectaSol or in combination showed that of the two together
Dox and PectaSol had no effect on the ratio of Bax/Bcl-2 in com-
parison with Dox alone, which may indicate a decrease in viability
due to other pathways of cell death (Figure 4 and Table 4).
3.7. Effects of PectaSol and Dox alone or incombination on p53 and p27 protein expressionin DU-145 and LNCaP cell lines
p53 and p27 expression in DU-145 and LNCaP were assessed in
cells exposed to 250 and 290 nM Dox (IC50 dose) in the absence
and presence of 3 and 4 mg/ml PectaSol for 48 h (IC50 dose).
PectaSol and Dox had no effect on the expression level of p53
protein (P,0.05; data not shown) (Figure 5).
In contrast with the above-mentioned lack of effects on Dox
and MCP (PectaSol), possible augmented effects of their
combination on the DU-145 and LNCaP cells were thereafter
examined with regard to p27 expression in response to either
agent or in combination. Flow cytometry clearly demonstrated a
significant decrease in the level of p27 in the DU-145 cells
exposed to a combination of both agents as compared with
Figure 1 MTT analysis for DU-145 cell line after 48 h treatment with PectaSol,Dox or a combination of both drugs
Determination of viability measured by MTT in DU-145 cell line after in vitro treatmentwith PectaSol or Dox either alone or in combination. *P,0.05 compared with control,"P,0.05 compared with 250 nM Dox+3 mg/ml PectaSol. IC50 of Dox is 250 nM andthat of PectaSol is 3 mg/ml in the DU-145 cell line.
Figure 2 MTT analysis for LNCaP cell line after 48 h treatment with PectaSol,Dox or a combination of both drugs
Determination of viability evaluated by MTT in LNCaP cell line after in vitro treatmentwith PectaSol or Dox either alone or in combination. *P,0.05 compared with untreatedcells (control). IC50 value of Dox is 290 nM and that of PectaSol 4 mg/ml in the LNCaPcell line.
Effect of Doxorubicin and PectaSol on prostate cancer cell lines
604 www.cellbiolint.org N Volume 36 (7) N pages 601–610 E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
![Page 5: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/5.jpg)
Dox alone (P,0.001) and an increase in the level of p27 in the
DU-145 cells exposed to a combination of both agents
compared with PectaSol alone (P50.002) (Figure 6). These
results showed that a combination of Dox and PectaSol, in
comparison with Dox alone, down-regulates P27 expression
probably through the inhibition of Gal-3 anti-anoikis effect. In
androgen-dependent PCa (LNCaP), a combination of Dox and
PectaSol had no significant effect on the levels of P27
expression when compared with any other agent alone or
untreated control (data not shown).
3.8. Effects of PectaSol and Dox alone or incombination on cell cycle progression on theDU-145 cell line
PectaSol treatment showed sub-G1 arrest (47.0% compared with
17.3% in control; Figure 7A), whereas Dox caused G2/M arrest
(20.5% compared with 8.7% in the control; Figure 7D) after 48 h
of treatment. Interestingly, PectaSol treatment after Dox-induced
sub-G1 arrest (45.3%) compared to that caused by Dox alone
(12.2%; Figure 7A). Similarly, treatment of PectaSol-treated cells
Figure 3 Effect of PectaSol and Dox on gene expression of DU-145 cell line after 48 hDetermination of gene (p21, p27, p53, Bax and Bcl-2) expression in DU-145 cells after in vitro treatment with PectaSol or Dox alone or in combination.*P,0.05 compared with control, £P,0.05 compared with PectaSol, +P,0.05 compared with Dox, #P,0.05 compared with PectaSol/Dox.
Table 4 Means of p53, p21, p27, Bcl2 and Bax gene expression in DU145 and LNCaP cell lines after 48 h treatment
DU145 cell line LNCaP cell line
Dose
Control 250 nM 3 mg/ml 250 nM+3 mg/ml
Control 290 nM* 4 mg/ml{ 290 nM+4 mg/ml
Gene Dox PectaSol Dox PectaSolGenes whichinvolved incell cycle
P53P21P27
15161026
12961026
10961026
15461026
15961026
20661026
16261026
12461026
12161026
14361026
14061026
15161026
23061026
18261026
23261026
15961026
14361026
16761026
18861026
16361026
16861026
23861026
15961026
25561026
Genes whichinvolved inapoptosis
Bcl2BaxBax/Bcl2
15961026
17161026
10861026
20861026
22561026
10861026
18861026
18861026
11361026
16161026
19461026
12961026
20561026
21661026
11261026
15261026
16661026
10961026
16461026
20961026
12661026
23161026
21461026
9261026
* IC50 value of Doxorubicin is different between two cell line.{ IC50 value of PectaSol is different between two cell line.
Cell Biol. Int. (2012) 36, 601–610
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N www.cellbiolint.org 605
![Page 6: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/6.jpg)
with Dox led to a further increase in sub-G1 arrest (54.6%)
compared to that caused by Dox alone (12.2%; Figure 7A). In
contrast, when cells were simultaneously treated with both agents
for 48 h, a much stronger G1 arrest (35.5%) was evident at the
expense of both the sub-G1 and G2/M populations (Figure 7B).
These results suggest that a combination of PectaSol and Dox
causes a very strong sub-G1 arrest compared with these agents
alone, and that DU-145 cell growth inhibition in the combination
could be, in part, attributable to a stronger arrest in cell cycle
progression at the sub-G1.
3.9. Effects of PectaSol and Dox alone or incombination on cell cycle progression in LNCaPcells
PectaSol treatment produced sub-G1 arrest (21.7% compared
with 6.4% in control), whereas Dox caused G2/M arrest (53.6%
compared with 38.2% in control) after 48 h of treatment.
Treatment of PectaSol-treated cells with Dox led to a further
increase in sub-G1 arrest (16.3%) to that caused by Dox alone
(5.1%; Figure 8A). However, treatment of Dox-treated cells with
PectaSol led to a stronger G1 and S arrest (18.2% compared with
8.3% in Dox alone: Figure 8B: 1.7% compared with 6.4% in Dox
alone; Figure 8C respectively) was evident. When cells were
simultaneously treated with both agents for 48 h, this led to a
further increase in S arrest (24.1%) due to Dox alone (6.4%;
Figure 8C).
4. Discussion
PectaSol synergizes with Dox in the treatment of prostate carcinoma
DU-145 and LNCaP cells by decreasing the viability and proliferation
of cells. Combination of PectaSol and Dox led to a concentration-
dependent decrease of 1.3- and 1.5-fold in the IC50 value of in
LNCaP and DU-145 cells respectively. Dox side-effects, such as
immunosuppression and cardiomyopathy, which severely increases
in a dose-dependent manner, as well as development of primary or
secondary drug resistance in tumour cells, limit their clinical success
in cancer chemotherapy. In this regard, combination chemotherapy
has received more attention for the purpose of finding compounds
with a known mechanism of action that could increase the
therapeutic index and decrease effective dose of clinical anticancer
drugs (Tyagi et al., 2002). Other studies show that PectaSol MCP can
affect the rate-limiting steps in cancer metastasis, has anti-adhesion
properties and also increases apoptosis of tumour cells by
sensitizing them to this drug (Glinsky and Raz, 2009) and reducing
Dox IC50 by 10.7-fold in human ASA (angiosarcoma) and HAS
(hemangiosarcoma) respectively (Johnson et al., 2007).
Figure 4 Effect of PectaSol and Dox on gene expression in the LNCaP cell line after 48 hDetermination of gene (p21, p27, p53, Bax and Bcl-2) expression in LNCaP cells after in vitro treatment with either drug alone or in combination. *P,0.05compared with control, #P,0.05 compared with PectaSol/Dox.
Effect of Doxorubicin and PectaSol on prostate cancer cell lines
606 www.cellbiolint.org N Volume 36 (7) N pages 601–610 E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
![Page 7: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/7.jpg)
To characterize the combined effects of PectaSol and Dox on
apoptosis and cell cycle progression, the cyclin-dependent kinase
inhibitors p27, p21, Bcl-2 and Bax genes and the major regulator,
p53, which are important regulators of apoptosis and cell cycle
progression genes were measured.
4.1. LNCaP
In LNCaP cells, PectaSol plus Dox therapy increased p53, p27
and Bcl-2 gene expression levels. Yan and Katz (2010) found Bim
(BH3-only), a pro-apoptotic gene downstream similar to Bax
(Multidomain) a pro-apoptotic gene in our study decreased.
Therefore, it seems the increase in gene expression of p53 and
consequently increase in gene expression levels of genes related
to p53 involved in apoptosis was not equivalent to an increase
in the cytotoxic effect of Dox and does not justify the overlap with
the MTT results. However, this activates the apoptosis pathways
related to p53. The expression of other genes involved in
apoptosis clearly need to be investigated.
Genes other than p53 increasing the cytotoxic effect of Dox in
combination with PectaSol, such as FasL by enhancing AP-1
(activator protein 1) DNA binding, increase cell death compared
with overexpression of Ras that decreased the amount of Fas,
thereby decreasing Dox-mediated aggressive cell death (Wang
et al., 2004). Increased cytotoxicity caused by Dox combination
therapy might not be mediated by inhibition of Bcl-2 expression
and probably other pathways including p53 are involved. Since
other pathways than p53 can be involved, Manna et al. (2010)
have shown in p53-negative cells that Dox was more cytotoxic
(faster and intensity).
4.2. DU-145
Not only were the observations similar to LNCaP, but also
expression of p53 was decreased, which probably is due to
other pathways than p53 being involved, such as MAPK
(mitogen-activated protein kinase) and PTEN (phosphatase and
tensin homologue deleted on chromosome 10)/Akt (also known
as protein kinase B) signalling pathways of central importance
for a particular tumour cell line to readily undergo apoptosis or
not, namely Ras. The results of the profiling of DU-145 and PC-3
support the notion that an intact PTEN–Akt pathway (as found in
DU-145 and 22RV1 cells) and the presence of active p38 are
responsible for the high sensitivity to apoptosis; and that neither
the androgen receptor nor the p53 status is of primary
importance for the differences observed with respect to
apoptosis induction (Iben et al., 2006). Manna et al. (2010)
reported that the basal expression of Fas was greater in p53-
negative cells compared with p53-positive cells and over-
expression of Ras decreased the amount of Fas in p53-negative
cells. In another study, it was reported that UNG (Uracil DNA
glycosylase) inhibition in DU-145 cells resulted in elevated p21,
although mutant p53 and Bax levels remained unchanged
(Pulukuri et al., 2009).
Another point is that in DU-145, unlike LNCaP, the expres-
sion of Bcl-2 was decreased and Bax increased, which is an
Figure 5 Effect of PectaSol and Dox on p53 protein expression in DU-145 and LNCaP cell linesDetermination of protein p53 expression in DU-145 and LNCaP cell lines after in vitro treatment with PectaSol or Dox either alone or in combination.£P,0.05 compared with PectaSol.
Cell Biol. Int. (2012) 36, 601–610
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N www.cellbiolint.org 607
![Page 8: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/8.jpg)
indicator of more pronounced effects of these two therapies on the
Bcl-2 and Bax pathways compared with LNCaP cells. However,
since the cytotoxic effects of combination therapy is greater, it is
probable that other pathways are also involved in apoptosis. Servida
et al. (2011) showed that mimicking Smac can induce apoptosis in
tumour cells. Evaluation of other genes in future studies is required.
Our findings suggest that the effects of combination of Dox
and PectaSol on p53 and p27 proteins and their genes in DU-145
cells are similar. The effect of Dox on the expression of p27 and
p53 proteins differ between cell types, so in MCF-7 cells, it
decreased p27 protein expression, whereas it up-regulated p53
and p21 levels. In contrast, in MDA-MB-231 cells, p27 levels were
unaffected by Dox treatment (Bar-On et al., 2007). Our results
showed that the combination of both drugs had no effect on
expression of p53, but resulted in a reduction in p27. Mutational
inactivation of p53 is frequently observed in various human
cancers (Wang et al., 2004). Other studies reported that Dox
triggers different pathways involved in cell death, such as the
activation of serine proteases, which occurs in parallel and
upstream of caspase activation (Grassilli et al., 2004).
In DU-145 and LNCaP cells, Dox causes G2/M arrest,
whereas PectaSol treatment showed sub-G1 arrest. PectaSol
seems to strongly synergize in its therapeutic effect with Dox in
advanced human PCa DU-145 cells by inducing more apoptosis
(sub-G1 arrest) and in LNCaP cells via G2/M arrest. Dox causes
G2/M arrest in DU-145 cells (Tyagi et al., 2002) and another
study showed that Dox induced G2/M arrest in MDA-MB-231
cells, but both G1/S and G2/M arrest in MCF-7 cells (Bar-On
et al., 2007). Pectin is capable of inducing apoptosis in
androgen-responsive (LNCaP) and androgen-independent
(LNCaP C4-2) human PCa cells (Jackson et al., 2007). MCP
also can increase the apoptotic response of tumour cells to
chemotherapy (Yan and Katz, 2010).
Our findings show that the combination effects of PectaSol
and Dox in DU-145 cells on cycle progression is not related to
p53 and p27 genes and their protein expression; however, it is
associated with p53 and p27 gene expression in LNCaP cells. p53
and p27 are important regulators of cell cycle progression, but
several other factors can induce arrest independent of p53
(Manna et al., 2010). Therefore, PectaSol synergy in combination
with Dox chemotherapy and its related effects on cyclin-
dependent kinase inhibitor function leads to the suggestion that
modulation of checkpoint regulators may contribute to the latter’s
cytotoxicity (Bar-On et al., 2007).
5. Conclusion
PectaSol effectively enhances the effects of Dox and may be
useful anticancer agent for PCa, as shown in the cell lines, LNCaP
and DU-145.
In LNCaP cells, the combination of PectaSol and Dox can
inhibit growth and cause apoptosis partially through the activation
Figure 6 Effect of PectaSol and Dox p27 protein expression in DU-145 and LNCaP cell linesDetermination of protein p27 expression in DU-145 and LNCaP cell lines after in vitro treatment with PectaSol or Dox either alone or in combination.*P,0.05 compared with untreated cells (control), £P,0.05 compared with PectaSol, #P,0.05 compared with PectaSol/Dox.
Effect of Doxorubicin and PectaSol on prostate cancer cell lines
608 www.cellbiolint.org N Volume 36 (7) N pages 601–610 E The Author(s) Journal compilation E 2012 International Federation for Cell Biology
![Page 9: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/9.jpg)
of p53 signal pathway and p27 expression, as well as G2/M arrest
in cell cycle progression. However, this combination had no effect
on expression of p53 and p27 in DU-145, in which other pathways
than p53 may be involved in induction of apoptosis (sub-G1
arrest). The findings demonstrated that PectaSol can synergisti-
cally enhance Dox toxicity in vitro independent of androgen
dependency. The data can support the role of this dietary
carbohydrate compound as a chemotherapeutic supplement that
could be given at relatively low doses of Dox, indicating that it is
worthwhile undertaking further clinical and basic science investi-
gations.
Figure 7 Effect of PectaSol and Dox alone and in combination on cell cycleprogression of DU-145 cell line
Cells were treated with either media alone, 250 nM Dox, 3 mg/ml PectaSol (pect),250 nM Dox and 24 h later with 3 mg/ml Pectasol, 3 mg/ml Pect and 250 nMDox24 h later; or a combination of both 250 nM Dox and 3 mg/ml Pect for 48 h. At theend of treatments, cells were harvested and stained with PI for flow cytometry. Thepercentage of cells in sub-G1 (A), G1 (B), S (C), or G2/M (D) phases represent means ofthree independent samples at each treatment, which were reproducible in threeindependent experiments.
Figure 8 Effects of PectaSol and Dox alone and in combination on cell cycleprogression in the LNCaP cell line
Cells were treated with either media alone (control), 290 nM Dox, 4 mg/ml Pectasol,290 nM Dox and 4 mg/ml Pectasol 24 h later, 4 mg/ml Pect and 290 nM Dox 24 hlater, or a combination of both for 48 h. At the end of treatments, cells were harvestedand stained with PI for flow cytometry. The data shown for the percentage of cells insub-G1 (A), G1 (B), S (C), or G2/M (D) phases are means of three independent samplesin each treatment, which were reproducible in three independent experiments.
Cell Biol. Int. (2012) 36, 601–610
E The Author(s) Journal compilation E 2012 International Federation for Cell Biology Volume 36 (7) N pages 601–610 N www.cellbiolint.org 609
![Page 10: Combination effect of PectaSol and Doxorubicin on viability, cell cycle arrest and apoptosis in DU-145 and LNCaP prostate cancer cell lines](https://reader034.vdocument.in/reader034/viewer/2022042815/557211d5497959fc0b8f9101/html5/thumbnails/10.jpg)
Author contribution
Najmeh Tehranian is the main author. Houri Sepehri and Parvin
Mehdipour are the first and second supervisors. Firouzeh
Biramijamal and Arash Hossein-Nezad are the first and second
advisors. All other authors are collaborators.
Acknowledgments
We acknowledge the contribution of Ladan Delph, Ziba Maghboli,
Maryam Mobiny and Hossain Asgarian for their assistance.
Funding
This study was supported by a research grant from the Science
Faculty of Tehran University.
ReferencesBar-On O, Shapira M, Hershko DD. Differential effect of doxorubicin
treatment on cell cycle arrest and SKP2 expression in breastCancer cells. Anticancer Drugs 2007;18:1113–21.
Collins L, Zhu T, Guo J, Xiao ZJ, Chen C-Y. Phellinus Linteus sensitisesapoptosis induced by doxorubicin in prostate cancer. Br J Cancer2006;95:282–8.
Elsadek B, Graeser R, Esser N, Schafer-Obodozie C, Tsurumi C, AbuAjaj K. In vivo evaluation of a novel albumin-binding prodrug ofdoxorubicin in an orthotopic mouse model of prostate cancer(LNCaP). Prostate Cancer Prostatic Dis 2011;14:14–21.
Glinsky VV, Raz A. Modified citrus pectin anti-metastatic properties: onebullet, multiple targets. Carbohydr Res 2009;344:1788–91.
Grassilli E, Ballabeni A, Maellaro E, Del Bello B. Loss of MYC confersresistance to Doxorubicin-induced apoptosis by preventing theactivation of multiple serine protease- and caspase-mediatedpathways. J Biol Chem 2004;279:21318–26.
Guess BW, Scholz MC, Strum SB, Lam RY, Johnson HJ. Modified citruspectin (MCP) increases the prostate-specific antigen doubling timein men with prostate cancer: a phase II pilot study. Prostate CancerProstatic Dis 2003;6:301–4.
Jackson CL, Dreaden TM, Theobald LK, Tran NM, Beal TL, Eid M. Pectininduces apoptosis in human prostatic cancer cells: correlation ofapoptotic function with pectin structure. Glycobiology2007;17:805–19.
Johnson KD, Glinskii OV, Mossin VV, Turk JR. Galactin-3 as a potentialtherapeutic target in tumors arising from malignant. Neoplasia2007;9:662–70.
Kang J, Bu J, Hao Y, Chen F. Subtoxic concentration of doxorubicinenhances TRAIL-induced apoptosis in human prostate cancer cellline LNCaP. Prostate Cancer Prostatic Dis 2005;8:274–9.
Kim DW, Kim KO, Shin MJ, Ha JH. siRNA-based targeting ofantiapoptotic genes can reverse chemoresistance in P-glycoprotein expressing chondrosarcoma cells. Mol. Cancer2009:8:28.
Manna SK, Gangadharan C, Edupalli D. Ras puts brake doxorubicinmediated cell death in p53 expressing cells. J. Biol. Chem.2010;286:7339–47.
Mantena SK, Sharma SD, Katiyar SK. Berberine, a natural product,induces G1-phase cell cycle arrest and caspase-3-dependentapoptosis in human prostate carcinoma cells. Mol Cancer Ther2006;5:296–308.
Neheme A, Varadarajan P, Sellakumar G, Gerhold M, Niedner H, ZhangQ et al. Modulation of docetaxel induced apoptosis and cell cyclearrest by all-trans retinoic acid in prostate cancer cells. Br J Cancer2001;84:1571–1576.
Opel D, Westhoff M, Bender A, Braun V, Debatin K, Fulda V.Phosphatidylinositol 3-kinase inhibition broadly sensitizesglioblastoma cells to death receptor and drug induced apoptosis.Am Assoc Cancer Res 2008;68:6271–80.
Pulukuri S, Knost J, Estes N, Rao JS. Small interfering RNA (siRNA)-directed knockdown of uracil DNA glycosylase induces apoptosisand sensitizes human prostate cancer cells to genotoxic stres. MolCancer Res 2009;7:1285–93.
Rabi T, Bishayee A. d-Limonene sensitizes docetaxel-inducedcytotoxicity in human prostate cancer cells: generation of reactiveoxygen species and induction of apoptosis. J. Carcinog.2009:8–9.
Sanches C, Mendoza P, Contreras HR, Vergara J. Expression ofresistance proteins in prostate cancer is related with cell sensitivityto chemotherapeutic drugs. Prostate 2009;69:1448–59.
Servida F, Lecis D, Scavullo C. Novel second mitochondria-derivedactivator of caspases (Smac) mimetic compounds sensitize humanleukemic cell lines to conventional chemotherapeutic drug-inducedand death receptor-mediated apoptosis. Invest New Drugs2011;29:1264–75.
Tyagi AK, Singh RP, Agrawal C, Chan DCF, Agrawal R. Silibinin stronglysynergizes human prostate carcinoma DU-145 cells todoxorubicin-induced growth inhibition, G2-M Arrest, andapoptosis. Clin Cancer Res 2002;8:3512–9.
Wu XX, Kakehi Y, Mizutani Y, Kamoto T, Kinoshita H, Isogawa Y.Doxorubicin enhances TRAIL-induced apoptosis in prostatecancer. Int J Oncol 2002;20:949–54.
Wang S, Konorev EA, Kotamraju S, Joseph J, Kalivendi S, KalyanaramanB. Doxorubicin induces apoptosis in normal and tumor cells viadistinctly different mechanisms. J Biol Chem 2004;279:25535–43.
Yan J, Katz A. PectaSol-C modified citrus pectin induces apoptosis andinhibition of proliferation in human and mouse androgen-dependentand -independent prostate cancer cells. Integr Cancer Ther2010;9:197–203.
Received 25 May 2011/ 19 September 2011; accepted 4 January 2012
Published as Immediate Publication 4 January 2012, doi 10.1042/CBI20110309
Effect of Doxorubicin and PectaSol on prostate cancer cell lines
610 www.cellbiolint.org N Volume 36 (7) N pages 601–610 E The Author(s) Journal compilation E 2012 International Federation for Cell Biology