comm 125 5c: slide redesign

Comm 125 5C: Slide Redesign Slide 1 List 8 things that are wrong with the example shown.

Upload: kristen-larson

Post on 10-Feb-2017

554 views

Category:

Education

0 download

Report

Download

Embed Size (px):

TRANSCRIPT

Comm 125 5C: Slide Redesign

Slide 1List 8 things that are wrong with the example shown.

Comm 125 5C: Slide Redesign

Slide 2On the second slide you will create another BETTER slide design. Recreate a BETTER slide based on one of the three slides given in I-Learn.

Comm 125 5C: Slide Redesign

Slide 3Take the information from the second slide and choose one idea and make a BEST slide.

PART5C · 2018-05-26 · installation of lifts and escalators table of contents no. title page 5c.1 scope 1 5c.2 terminology 1 5c.3 general 9 5c.4 essential requirements 12 5c.5 dimensional

Existing Building Summary Redesign Goals Ventilation Redesign Mechanical Redesign

5c. Acceptance Sampling.ppt

495 Internship Class - College of Communicationscommunications.fullerton.edu/studentsuccess/... · (6 units max) pREREQuisites ADV JOURN PR COMM COMM COMM COMM 325 COMM COMM CTVA

Hydraulic Model Study of the American River Pumping ... · Hydraulic Model Study of the American River Pumping Station, Phase II Redesign 5c. PROGRAM ELEMENT NUMBER 5d. PROJECT NUMBER

Nokia bl 5c

5C Midterm

REDESIGN OF COPPER CYLINDER USED FOR M4, M16, AND … · redesign of copper cylinder used for m4, m16, and m249 firing pin indent 5a. contract number 5b. grant number 5c. program

HAN - ReDesign - Company ReDesign (5)

R8/5C/3J/16C COLLETS217 Big... · All 5C collets (except 5C Step Collets) have external and internal threads. 5C Collet Sets Accuracy (For 5C Hex & Square) Steps Collets have a soft

Strategy of Redesign for CTLMA2 Target Site AniI WT: TGAGGAGGTTTCTCTGTAAA || | ||| ||||| || CTLMA2 : AGAAGCCGTTCATCTGTCAA -7A -10A/-7A -5C/-4C Semi-saturation

5C Performance

ALASKA MEDICAID REDESIGN UPDATE - dhss.alaska.govdhss.alaska.gov/HealthyAlaska/Documents/redesign/20181010_DHSS... · Medicaid Redesign . Behavioral Health Redesign . The Healthy

Amendment in ANF-5A, ANF 5C and Appendix 5C

Assignment 5c fa102

REGULAR MEETING Comm. Wendy Guzman Comm. Manuel Martinez · 22.01.2014 · Comm. Wendy Guzman Comm. Manuel Martinez Comm. Jonathan Hodges Comm. Alex Mendez Comm. Errol Kerr Comm

Laredo Medical Center’s new outpatient Infusion Center ... 2/Laredo Medical Center...5C, Adriana Leal, RN, 5C, Isaac Martinez, RN, 5C, Erica Sarmiento, RN, 5C, Frances Uresti, RN,

Section 5C: Vertical Load Bearing Wall Panel Installation ... · PDF fileSTRUCTURAL GUIDES - 5C 1 Section 5C: Vertical Load Bearing Wall Panel Installation Guide 5C.1 Introduction

Portfolio 5c

5c Presentation

Lösungen 5c

aLscvl scc-HANstreamlinermemories.info/CAN/CN30Arbutusdinner.pdf · Ginger Beer in Stone Bottle I 5c Orange Crush I 5c Lemon Crush I 5c Lime Crush I 5c Coca-Cola I 5c Inds. Grape

Assignment 5c

Unit 5C: Unit 5C: Gases around us. Unit 5C: Unit 5C: Gases around us Gases around us Divide the substances into 2 groups. List the similarities and differences

Redesign and NEST - aci.health.nsw.gov.au · Redesign and NEST . Surgery Redesign. 1. Essence of Redesign 2. Is more Redesign required? 3. Redesign for NEST . EBERS PAPYRUS (1534

5c Fruity Muffins

Website Redesign Services | Website Redesign Company Hyderabad | Website redesign Prices – Webdesigning Companies