A Board of Education Publication

www.commackschools.orgwww.commackschools.org

Abbigayle and Elizabeth achieved Semifi nalist status in the prestigious Siemens Math, Science, and Technology Com-petition. Their science research project was selected from ap-proximately 2,250 project entries submitted by students nation-wide. The Siemens Competition honors the best and brightest students for their accomplishments in math and science stu-dents who are changing the world for the better. Their project, The Implementation and Verifi cation of a Forest Fire Index for the Northeast United States, focused on

developing a predictive model to determine the intensity and spread of a forest fi re in the Northeastern United States, pos-sibly helping to save lives and property in the future. In photo, from left to right, Catherine Nolan, Principal, Ab-bigayle, Dr. Donald James, Commack Superintendent, Eliza-beth, Alison Offerman-Celentano, Director of Science, and the tireless and incredibly dedicated science research team, Rich-ard Kurtz, Andrea Beatty, Dr. Lorraine Solomon, and Jeanette Collette (not in photo).

Siemens Semifinalists Project: Predicting Forest Fire IntensitySiemens Semifinalists Project: Predicting Forest Fire Intensity

Advocacy in Action: Lets Talk About Testing, Unfunded Mandates & State AidAdvocacy in Action: Lets Talk About Testing, Unfunded Mandates & State Aid We are serious about reducing the amount of testing our children are subjected to each year, stated Dr. James, Superin-tendent. The combined efforts of educators and parents are causing the political lead-ers to not only take notice, but to fi nally take action to relieve the burden of over-testing, but... we must continue to exert pressure for signifi cant change to occur. Testing, state aid, and other matters affecting our District will be topics for con-sideration for our new advocacy commit-tees. Members will be asked to attend at

minimum, the scheduled meetings, and to participate in other events-based activities. Would you like to join the advocacy ef-forts? Members are needed for a District Ad-vocacy Steering Committee and three ad hoc committees:

Common Core Testing and the APPR Safety and Security State and Federal Funding

Not enough time to serve on an advocacy

committee? Attend one of the Superinten-dents Outreach meetings or forums on topics such as:

Educational Priority Setting Budget Development Mandated State Testing Safety and Security Cyber Awareness and more

For all the information, visit the Com-mack Website and click on the Advocacy in Action link. These meetings will typi-cally last 90 minutes.

A BoBoarrdddddddddddd ofofooooffoooofffofffffofofffffooffoffffoofffoff EEEEEEEEEdududududududududuududdddddddddddddddddddd cacacacaccacacaacacaaaaacacacaacacaccaacacacaacccaaaacaaaacaaatittititittttttttititttitiiittiiiittiiittitttionononononononononononoooonoooooonononoonononoononon PPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPubuuuuuuuuu lication

December 2015

2 T h e C o m m a c k C o u r i e r T h e C o m m a c k C o u r i e r

More than 50 Hong Kong delegates representing the International Alliance for Invitational Education were welcomed by Commack High School on October 19, 2015. Commack High School was chosen for the visit with the overseas educators and students because of its positive climate ini-tiative and successful strategies for creating the optimal environment for teaching and learning. The International Alliance for Invitation-al Education helps schools to become more intentionally optimistic, respectful, trust-worthy, and caring in the messages sent to all stakeholders. This in turn helps people to see themselves as able, valuable, and responsible, and motivates them to take charge of their learning and choose benefi -cial actions. Commack High School is eligible to receive the Inviting School Award in 2016,

for its drive for increased academic success, atten-dance, effort, collabora-tion, positive behaviors, and morale. The IAIE hosted its 33rd Annual World Con-ference: Beyond the Test: Inviting School Success, from October 21-24, 2015. Conference participants included visiting delegates from China, Australia, Mexico, Malta, Canada, and school leaders from 44 award-winning schools in the U.S. and Hong Kong. Implementation of new testing proce-dures, curriculum, and teacher evaluation systems has met with concern nationally. A call for balance and an intentional focus on choice, motivation, and positive self-regard

will ensure that all students and staff realize their full potential. In photo above, Dr. James and Mrs. Nolan accept a beautiful fan from the Hong Kong visitors.

Invitational Education

The Hong Kong delegates were greeted by Commacks student ambassadors and the Commack Cougar mascot. The Cougar stole the show and it everyone wanted a photo with our fearless mascot.

Student ambassadors Carly and Matthew gave the grand tour of the high school to Vincent and Holly, the only two student delegates from Hong

Kong.

French students in Dominick Kosci-uks classes at Commack High School expressed their sympathy and showed their solidarity with the people of France after the attacks on Paris on November 13, 2015. My students and I needed to share our grief and show our support. The

classes composed letters of sympathy which were delivered to the French Con-sulate in New York. The photos above were also included. High School Principal, Catherine Nolan, was thankful to the students and their teacher for increasing our students sensitivity about this horrifi c event and

for this display of empathy towards hu-manity. As New Yorkers, and as part of the global community, this act of terrorism transcends borders and impacts all of us, said Superintendent, Dr. James. We send our sincere sympathies to those af-fected by this senseless tragedy.

blentschTypewritten TextClick here for more photos!

T h e C o m m a c k C o u r i e r 3

Happy New Year!Happy New Year!

BOARD OF EDUCATIONMEETINGS

Thursday, January 21, 2016

Thursday, February 11, 2016

Hubbs Administrative Center at 8:00 p.m.**The Board will convene at 6:30 p.m. and is expected to adjourn into Executive Session. Public meetings will commence at times

stated above.

Schools will be closed from December 24, 2015

through January 3, 2016

District Art Walk/Music ConcertFebruary 8, 2016

6:00 p.m. - 8:00 p.m. at Commack Middle SchoolSnow Date February 10th

Click the Community Events Community Events link on the Commack Website for more events

www.commackschools.org

NYSSMA Solo and EnsembleFestivals Registration

FOR PIANO: The annual NYSSMA Solo and Ensemble Festival for piano will be held at Commack High School on Wednes-day and Thursday, March 30 & 31, 2016. To register your child, please complete the registration form and return it to his/her music teacher on or before Friday, January 8, 2016.

FOR JAZZ, GUITAR and DRUM SET: The annual NYSSMA Solo and Ensemble Festival for jazz, guitar, and drum set will be held at West Islip Schools Friday and Saturday, April 1 & 2, 2016. To register your child, please complete the registration form and return it to his/her music teacher on or before Friday, February 5, 2016.

FOR PERCUSSION, WIND, STRING and VOICE: The annual NYSSMA Solo and Ensemble Festival for percussion, wind, string, and voice will be held at Kings Park School District on Friday and Saturday, May 13 & 14, 2016. To register your child, please complete the registration form and return it to his/her music teacher on or before Friday, February 5, 2016.

PLEASE NOTE!To obtain a NYSSMA registration form

for any of the above mentioned festivals, go to:http://www.commack.k12.ny.us/music/nyssma.asp

Is your contact information up to date? Vital school to home information is sent via email, text, and phone. More than ever, we are using email and texts to inform you about school matters. Parents: The best way to update your email information is on the Parent Portal. Instructions are on the Commack Website. Just click the Parent Portal button on the top of the page. Community Members/Parents: For Community News, you can update your email address, text number, and preferences by clicking the Email Notifi cation link on the top of the home page.

The holiday season is upon us, and the Board of Education and I wish you all a joyous and peaceful holiday season. As you will see on the following pages, our community and schools have shown generosity and charitableness through a profusion of caring acts of kindness. Giving from the heart and taking care of others is just as gratifying for the giver as it is for those who receive the clothing, food, cards, letters, and toys we collect. I am so proud of the efforts our students and staff, and thankful for the time spent on organizing, wrapping, and distributing. Kudos to the students who take the time to help our senior citizens and those in need. These are the lessons that are so important in forming character and com-passion. We look forward to welcoming our students, staff, and the community to the many events planned in the new year. Plan to attend our winter or spring concerts and art shows for a real treat. Our students are so tal-ented, and hold much promise for the future. Hope to see you around town!

Sincerely,

Dr. Donald JamesSuperintendent, Commack School District

NNNNNNNNNNYYYYYYYYYYYYSSSSSSSSSNNNNNYYYYSSSSS

FFFFOOFOFOOFOOFOORRR RRRRRR PPIPIIAANANNff i

4 T h e C o m m a c k C o u r i e r

All-County Students

Five Commack High School instrumental and vo-cal musicians were selected to participate in the 2015 New York State School Music As-sociation (NYSSMA) All-State Winter Conference. The selection of these tal-ented students followed com-petitive auditions involving thousands of music students from throughout New York State. During a lengthy selec-tion process that takes place during the summer, chair-people from across the state

gather to select the fi nest mu-sicians to perform in various All-State ensembles. The concerts will take place in the Eastman Theater located in Rochester, New York. Being selected to per-form in an All-State ensemble is quite an honor, stated Mr. Paul R. Infante, Director of Fine and Applied Arts. Each of these musicians possesses exceptional talent and we are proud to have them represent Commack.

Students who participate in Commacks music program are continually recognized for their exceptional talents in band, cho-rus, and orchestra. This year, the New York State Council of Administra-tors of Music Education Suffolk County Chapter (NYSCAME/Suffolk) and the Suffolk County Music Educators Association (SCMEA), selected 22 high school student musicians to participate in the annual High School All-County Festival. Those selected to perform in the All-County Band, Or-chestra, Mixed Chorus, and the Womens Chorus go through a rigorous evaluation process and competitive auditions based on the New York State School Music Association (NYSSMA) standards adjudicated by music educators. Performing in this yearly event is one of the highest hon-ors a student can achieve on the county level. We are extremely proud to have these young tal-ented musicians represent the music department in this, and other well-known music festi-vals, said Paul R. Infante, Di-rector of Fine and Applied Arts.

All-County Musicians FestivalAll-County Musicians Festival

Band Evan

Genevieve Jared Kelli

Mixed ChorusKristina Kelsey Maxwell David

Matthew Sarah

Kimberly Austin

HassamMorgan

OrchestraKevin Caleb Daniel JinminRobert

Johann Y

Women ChorusChristine Kristen

All-State Students 2015

Caleb Viola String OrchestraKelsey Soprano II Mixed Chorus Evan Trumpet Symphonic BandSarah Alto I Mixed Chorus Morgan Alto I Mixed Chorus

All-State Achievement

T h e C o m m a c k C o u r i e r 5

Burr Intermediate School in Commack holds an annual Kick for a Cause fundraiser. This year, all monies raised were donated to the Madagascar Ankizy Fund (ankizy means children in the Malagasy language). Dr. David Krause, renowned paleontolo-gist and a founder of the fund, visited Burr Intermediate School to share fascinating stories of his worldwide expeditions and dis-coveries. Dr. Krause has led numer-ous paleontological expeditions. In 1993 he fulfi lled a childhood dream and journeyed to the re-mote island of Madagasar to search for Cretaceous fossils. There he found a treasure trove of nearly complete fossil dinosaurs, crocodiles, amphibians, and even mammals. His early fi eld crews spent time searching for these fossils and camping near the village of Berivotra in northwestern Madagascar, and Dr. Krause and the members of his expedition found

themselves surrounded by children who were observing their work. Along with the remarkable fossils that they were uncov-ering, they also found some of the most abandoned and destitute children in the world, children who couldnt read and write, children whod never been seen by a doctor or dentist, and who were dying of easily treatable ailments.

Very quickly it became clear that the paleontologists were in a unique position to help these children, and were amazed to discover that $500 U.S. dollars would pay the salary of a teacher for an entire year, and that $300 could buy school supplies for a year. With this knowledge in hand, members of the fi eld crew came together with several relatively small donations, and the Mada-gascar Ankizy Fund was born. The goals of the Madagascar Ankizy Fund are to build schools and hold clinics in remote areas of Madagascar. They also support basic health and hygiene by pro-

viding training, digging clean water wells, distributing mosquito nets, and installing latrines. Through their efforts, Burr students donated $1,000, and are changing the world and improving the lives of so many who are so far away.

From Commack to Madagascar

Commack High School is proud to an-nounce that 16 students have been named Commended Students in the 2016 Nation-al Merit Scholarship Program. Framed Let-ters of Commendation were presented to these scholastically talented seniors.

Commended students placed among the top fi ve percent of the more than 1.5 million students who entered the 2016 competition by taking the 2014 Preliminary SAT/National Merit Scholarship Qualifying Test.

Commacks Director of Guidance, Jon-athan Macaluso, stated, These students have a high potential for future academic success, and we are proud of their accom-plishments on this test and in the class-room.

Commacks Commended StudentsCommacks Commended Students

6 T h e C o m m a c k C o u r i e r

Kindness iswhich the deaand the blind

Welive in a

ing communiknows no limits o

helping those in neshown during this hol

outpouring of food, cloetary donations. Our Cvided Thanksgiving dinin the hundreds to locand the military. Hereples of the efforts of o

with the support ofthe good folks i

School Distric

Burr students in Jeff Trebours class went on a shop-ping trip to purchase food for Marine and Army per-sonnel stationed on Long Island who wouldnt be able to travel home for Thanksgiving. We were savvy shoppers, and used math skills to compare prices, shop sales, and turn the funds collected from the class into scrumptious feasts for the soldiers, said Mr. Trebour. This effort was initi-ated by the SCPD Second Precincts Deputy Inspector Bill Read and Police Offi cer Angela Ferrara. Adults in photo with Mr. Trebours class (left to right) are PO Ferrara, Burr Principal Paul Schmelt-er, Marine Sergeant Brian Lydenmayer, Mr. Trebour, and Deputy Inspector Read.

Kindergarten classes at Rolling Hills celebrated Thanksgiving by giving back to the community. The chil-dren made Happy Thanks-giving Meal bags, which were donated to L.I. Cares Harry Chapin Food Bank in Hauppauge. They were given to families in need. The children deco-rated lunch bags with Thanksgiving pictures and fi lled each bag with a microwaveable Mac-n-Cheese, a drink, a snack, a small toy, and of course good wishes. In addition, each child de-signed a laminated Thanksgiving-themed place mat to go along with the Happy Meal.

The North Ridge Family collect-ed over 40 loaves of home-baked and store-bought bread to donate to the Northport Ecumenical Food Pantry. Their efforts are part of a year-long commitment to the com-munity which includes donating home-baked breads in the fall, cook-ies for the holidays, and soups in the late winter.

Wood Park Primary School children in Danielle Sanseverinos kindergarten class, with the help of teacher Justine Buono-

More on the following pages!

Kindness Multiplied: Small R

s at Rolling Hills lsg by givingThe chil-anks-ich s

n-k, a

e goodh child de-ksgiving-themed med

T h e C o m m a c k C o u r i e r 7

s a language af can hear

d can see. Mark Twain

e an amaz-ity, one that n good deeds and eed. The generosity liday season led to an othing, gifts, and mon-Commack Schools pro-nner baskets numbering cal families, missions, e are just a few exam-our staff and students, f their families and in the Commack ct.

In the spirit of the season, Commack High Schools Pay it Forward Club began its annual Rake-It-Forward

drive, with club members lending a helping hand by raking leaves for senior citizens in the commu-

nity. Another in the long list of events driven by the selfl ess members of the Pay it Forward Club, the students fi lled over 50 bags of leaves after school at three seniors resi-dences, before darkness stopped them for the day. These young adults set an example for all of us; they give freely and will-

ingly of their time without the expectation of anything in return, said club co-advisor

Rob Raeihle. They are driven by the self-less goal of spreading their message of giving

to the community, and setting an example to do for others and pass it on. When we help each other,

giving willingly and spreading positivity, everything is possible.

The students in Tracy Goldmans fi fth grade class at Mandracchia

Sawmill Intermediate School participated in an adopt a family program with We the People United, a local non-profi t. They learned about the struggles of local families on Long Island and the ways to help them during this holi-

day season through giving. They worked together to pack

food boxes for three local fami-lies to provide a wonderful Thanks-

giving meal, and made centerpieces and coloring stations for the children of the families.

The fi rst graders at Indian Hollow Primary School had a Showing Thanks celebra-tion in lieu of a party that helped them understand the true meaning of being thankful for what they have and giving to others. Currently there are approxi-mately 109 active marines on Long

Island who did make it home for the holidays. The Commack School District

showed its thanks by providing them a Thanksgiving Dinner with all the trimmings.

Each fi rst grade class at Indian Hollow collected gift cards to supermarkets, decorated

boxes for the project, and made cards for the soldiers and their families.

volonta, created cards and coloring pages for

the veterans at the Stony Brook Veterans home.

Ripples Can Change the World

8 T h e C o m m a c k C o u r i e r

On average, fi ve people die from shark attacks each year. Humans kill 100 million sharks each year, with fi shing rates out-stripping the ability of populations to recover (www.theguardian.com). Students in Jeanne Sutties Regents Living Environment classes have a whole new view of sharks after Skyping with Jillian Morris, a marine biologist and advocate for shark con-servation. Her organization, Sharks4Kids, offers a wide range of educational materials to help bring shark education into the classroom. Prior to the session, students read Saving the Great White Monster, and posted questions about sharks on Padlet through Google Classroom. Students learned about the biol-ogy and diversity of sharks both locally and globally as well as the impact that overfi shing and fi nning are having on the shark populations. For more info: www.sharks4kids.com

Fourth grade students from Burr and Sawmill in Leah Bernsteins Challenge and Discovery Program classes visited Dolans labo-ratories in Cold Spring Har-bor in conjunction with their study of the Microcosmos. In October, the students investigated taxonomy using microscopes at the lab. Re-turning in November, the ex-cited, budding biologists ex-tracted DNA from harmless bacteria. Mrs. Bernstein said, They gasped in wonder as they twirled the spaghetti-like DNA strands on glass pi-pettes, and even touched the code of life! The Dolan DNA Learning Centers genetics laboratory

includes a variety of hands-on experiments to introduce students to the wonderful world of molecular biology, usually restricted to middle school and high school stu-dents. Mrs. Bernstein formed a connection between the Challenge and Discovery Program and the Dolan Cen-ter in 1999, when she cajoled them into agreeing to allow our fourth graders into their facility. Our students cer-tainly made an outstanding impression, because weve been welcomed every year since! Challenge and Discovery classes run in grades three through fi ve every other week in Burr and Sawmill.

Sharks Get a Bad RapSharks Get a Bad Rap

Theres a new addition in Maureen Murphy and Patricia Dannas fourth grade classroom at Burr Intermediate School. Chex, a therapy dog, visits the class once a week to work with the very lucky students during their guided reading groups. Chex is quite a busy dog, as he currently spends his free time at one of the community living centers at the Northport VA Hospital to participate in the recreational therapy program. Chex interacts with veterans who are staying in the center for respite, rehab, or palliative care. The veterans often have dogs at home and enjoy petting Chex while telling stories about their own furry friends. Chex is enjoying his new role, and the students are ex-cited for his arrival each Thursday, as they improve their reading skills in a new and exciting way. The class is thankful to Little Shelter for facilitating this incredible opportunity.

Shaggy New StudentShaggy New Student

CHALLENGE & DISCOVERY:DOLAN DNA

LEARNING CENTER

Nathaniel is researching the mystery of Anastasia Romanov.

Jordan and Sabrina are using the microscopes to view cell samples rep-

resenting the 5 Domains of Life.

T h e C o m m a c k C o u r i e r 9

Excitement Abounds in New Middle School Enrichment Classes

The weather outside has gotten chilly, but Sawmill students cozied up to spread some snuggly happiness to children in need. The Mandracchia-Sawmill Student Council held a Pa-jama Jammie Jam to provide new pajamas and books to children across the United States. Sadly, many youngsters do not know the comforts of being tucked in at night with warm pajamas and a bedtime story. So on November 25,

everyone was encouraged to donate a pair of new pajamas, a new book, or a make a fi nancial donation, and wear their own pajamas to school. As always, the Sawmill community came through, and collected 135 pairs of pajamas, 291 books, and $570! Thank you to all for their generous contributions and great show of spirit! If youd like more information on the Pajama Program, please visit www.pajamaprogram.org.

Six new enrichment classes at the middle school are changing the traditional format of lecture and note-taking with innovative topics and curriculums. Pictured above are students in a Digital Media class. We are very excited about this class. We are just starting our sec-ond project, a reenactment of a scene from a movie, which was modeled after a project done at the high school. Students dis-sect a particular scene and re-create it on their own. Planning, fi lming, and analyzing their videos is a remarkable learning process, said Ed Cuff, one of the teachers involved. Upcom-ing projects include a public service announcement, a movie trailer, an advertisement, a how to video, and a music video.

In the photo on the right, seventh and eighth grade stu-dents in the STEM enrichment class (STEM stands for Sci-ence, Technology, Engineering and Math) are challenged to implement the design cycle to build a device that lets them grab different objects and drop them into a container thats at least two feet away from them. They participate in a series of activities revolving around the ideas of biomedical engineering, adaptations, team work, while using STEM concepts. There are a total of ten elective enrichment classes offered this year, including math, science, coding, theater, writing, fo-rensics, and other creative topics, with selections driven by student interest.

Wood Park Primary School held its third annual Family Scarecrow contest. Parents and students were invited to work as a family to turn their scarecrows into interesting and entertaining characters. This year, the students were very creative! The main lobby was fi lled with a Scarecrowasaurus Rex, a Lego Farmer, and even a scarecrow of Wood Parks Principal, Mrs. Collison, and Security Guard, Mr. Artie! In photo above, Artie Sainsbury with his scare-crow twin, Mrs. Collison and her look-a-like, and stu-dents Ryan, John, and Mia.

A New Twist on Scarecrows Sawmill: PJs and a Good Bedtime Story

10 T h e C o m m a c k C o u r i e r

Commack Middle Schools seventh grade students showed their appreciation for the U.S. military by participat-ing in an interdisciplinary activity in their social studies and English classes. Students wrote thank you letters to sol-diers, veterans, and a group known as the Blue Star Moms. The Blue Star Moms is an organization of mothers whose sons and/or daughters are currently serving, or have

served, in any branch of the U.S. military. Their mission is to support each other, their children and their families. The middle school students are also collecting items to fi ll care packages for the Blue Star Moms to send to their children serving overseas. In photos, Keith Reylings seventh grade class along with project organizer Christine Mankes.

The Long Island Cares Food Bank was able to cart away twelve huge contain-ers fi lled with food donated by the students at Sawmill Intermediate School. The students in Mi-chelle Goldsteins third grade class donated 1,083 food items! My students rocked it! she exclaimed. We learned about giving, helping, being charitable, and what it really means to be hungry. One of the les-sons the class participated in asked the children which foods they would eliminate from their daily life if they had to. First, they chose one snack and then one meal that they would have to

forsake if they did not have food. It made them realize the abundance of food that they are blessed with each day and that unfortunately, others on Long Island are very needy. A contest ensued within the class to see which boy and girl could bring in the largest quantity of food items to help feed the needy on Long Island. I am beyond blown away by their kindness, gener-osity, and determination to help others!

Thanks to these students and all of the students and families at Sawmill!

Diane Gandolfi s kindergarten class at Rolling Hills Primary School col-lected items for our troops and also prepared letters (very short!) with cute pictures for our servicemen and women, titled, You Are My Hero.

Sawmills Food Drive - A HUGE SuccessSawmills Food Drive - A HUGE Success

An abundance of food was collected by the students and staff at Rolling

Hills for distribution by Island Harvest to local families in need.

Little Children Bring Little Children Bring BIG Joy to OthersBIG Joy to Others

Care Packages forCare Packages for Blue StarBlue Star MomsMoms

T h e C o m m a c k C o u r i e r 11

Students from Allison Razzanos Advanced Ceram-ics class had the rewarding opportunity to teach ceramics to their peers. Students from Jennifer Flemings class came to the ceramics studio ready to em-bark on their fi rst experience on the potters wheel. Prior to visiting the ce-ramic studio, Mrs. Flemings students studied Japanese tea bowls and the different

components that make up this wonderful type of pot-tery. Students were paired up for one-to-one instruction and learned how to throw Japanese tea bowls on the potters wheel. The class was taught how to center clay on the wheel, how to shape the walls of the vessel, and how to add a foot to the bowl. It was an amazing culminating experience for both groups of students.

Ceramics Students Become Teachers at CHS

ATHLETIC ATHLETIC TRIUMPHS TRIUMPHS

FALL FALL 20152015

Girls Varsity GymnasticsSuffolk County Champions

Girls Varsity Tennis League 1 Champions

Girls Varsity Soccer League 1 Champions

hamChh

Diane DAllesandros third grade class at Burr Intermedi-ate School learned the true meaning of giving this holiday season. Rather than having a tra-ditional Thanksgiving celebra-tion, the students, with the help of parents and grandparents, created handmade needlepoint bookmarks to donate to Stony Brook Childrens Hospital just in time for the holidays.

The students wrapped new books along with their book-marks and special messages to bring joy and the gift of reading to many children. A beautiful basket of 24 indi-vidually wrapped books was do-nated to cheer their peers who are ill or recovering at Stony Brook.

Handmade Gifts from the Heart

POSTAL PATRONCommack Union Free School DistrictCommack, New York, 11725

NON-PROFITCARRIER ROUTE

PRE-SORTUS POSTAGE PAID

PERMIT NO. 8Commack, NY 11725

His words were clear. This is the last thing I want to give to you, the postman said as he handed Tom Lombardi, 18, his draft notice in the driveway of the Lombardi home in Huntington, New York. The letter was titled Greetings, but the accompanying words were much more ominous. Tom scanned the letter, walked into his home, and handed it to his parents. One month later, he was a soldier fi ght-ing in a war he opposed. On Tuesday, November 17, al-most 50 years after his year-long tour in Vietnam, Specialist Fourth Class Thomas Lombardi came to speak to Mrs. Revera and Mrs. Palazzos juniors as a culminating activity for the novel The Things They Carried, by Tim OBrien. Days earlier, the 11th graders were asked to create questions concerning virtually anything they wanted to know about Mr. Lombardis time in the service. The inqui-ries were then presented to Mr. Lombardi, who along with his daughter, Laura Revera, scoured through hundreds of photographs

and created a comprehensive and riveting Powerpoint slideshow that supplemented Mr. Lombardis presentation. The students watched and listened in awe as Mr. Lom-bardi shared the raw fear of being drafted, the blistering emotional toll it took on his family, the insanity of some of his fellow sol-diers, the terror of combat, and the relief of

returning home. Following the presentation, students fi led to the front of the room to shake Mr. Lombardis hand and thank him for his service and sacrifi ce. Principal Catherine Nolan, and As-sistant Principals Mathew Keltos, Susan Shapiro, and Leslie Boritz were in atten-dance. Mrs. Nolan noted, We were all enriched today by Mr. Lombardis words, experiences, and very presence. Were quite sure that the students will remem-ber this special presentation for years to come.

To learn about the his-tory of Veterans Day, Ni-cole Spatz and Michelle Quinns fi fth grade class-es at Burr Intermediate School immersed them-selves in stories about vet-erans. They wanted to do something for the veterans to show their gratitude and decided to write letters to local veterans at the North-port VA Medical Center and at St. Albans Hospital. The children were so excited to know that their letters would be given to their lo-

cal heroes and they are eager to get letters from the veterans in return! This activity has brought new meaning to this very im-portant holiday.

COMMACK SALUTES OUR VETERANS

Members of the History Honor Society raised $515 for the Wounded Warrior Project by selling patriotic ribbons and pins during lunch periods. In photo, Commack High School senior, Ashley, collects donations near the sign in area. For more info: www.wound-edwarriorproject.org/.

English Teacher Courtney Palazzo, Principal Catherine No-lan, Assistant Principals Leslie Boritz and Susan Shapiro, Special Education Teacher Laura Revera, and Thomas Lom-bardi.

Thank you!Thank you!

www.commackschools.org

Commack Board of Education:

Steven Hartman - PresidentJanine DiGirolamo - Vice President

Trustees: Jarrett Behar, MaryJo Masciello, James Tampellini

Superintendent of Schools: Dr. Donald A. James

wwwwwwwww cccooommmmmmaaaccckkksssccchhhoooooolllsss ooorrrggg