comparative analysis of homo sapiens and mus musculus cyclin-dependent kinase (cdk) inhibitor genes...
TRANSCRIPT
J Mol Evol (1995) 41:795-802 jou.. o MOLEEULAR
IEVOLUTIflN © Springe~Verlag New York Inc. 1995
Comparative Analysis of Homo sapiens and Mus musculus Cyclin-Dependent Kinase (CDK) Inhibitor Genes P16 (MTS1) and P15 (MTS2)
Ping Jiang, 1 Steven Stone, l Roger Wagner, z Susan Wang, z Priya Dayananth, 1 Christine A. Kozak, 3 Barbara Wold, z Alexander Kamb 1
' Myriad Genetics, Inc., 390 Wakara Way, Salt Lake City, UT 84108, USA 2 Biology Department, California Institute of Technology, Pasadena, CA 91125, USA 3 National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892-0460
Received: 30 June 1995 / Accepted: 27 July 1995
Abstract. Cyclin-dependent kinase inhibitors are a growing family of molecules that regulate important transitions in the cell cycle. At least one of these mole- cules, p16, has been implicated in human tumorigenesis while its close homolog, p15, is induced by cell contact and transforming growth factor-[3 (TGF-[3). To investi- gate the evolutionary and functional features of p15 and p16, we have isolated mouse (Mus musculus) homologs of each gene. Comparative analysis of these sequences provides evidence that the genes have similar functions in mouse and human. In addition, the comparison sug- gests that a gene conversion event is part of the evolution of the human p15 and p16 genes.
Key words: P16 - - P15 - - MTS1 - - MTS2 - - CDK inhibitor - - Gene conversion - - Mouse - - Human
Introduction
The basic cell-cycle apparatus involving cyclin-de- pendent kinases (CDKs) and cyclins is present in all eukaryotes that have been studied. Recently, it has be- come clear that CDK inhibitors, first described in yeast, are also present in mammals (see Peter and Herskowitz 1994, for review). Indeed, mammalian CDK inhibitors
Correspondence to: A. Kamb
appear to be a large group of molecules that fall into distinct families based on sequence homology. These families include p21, p27, and p57 (Gu et al. 1993; Harper et al. 1993; Xiong et al. 1993; E1-Diery et al. 1993; Polyak et al. 1994b; Toyoshima and Hunter 1994; Lee et al. 1995; Matsuoka et al. 1995), and p15, p16, p18 and p19 (Serrano et al. 1993; Harmon and Beach 1994; Chan et al. 1995; Guan et al. 1995; Hirai et al. 1995). All CDK inhibitors identified so far in mammals are thought to regulate specific transitions in the cell cycle, such as the G1/S checkpoint prior to DNA replication.
CDK inhibitors are important not only because of their role in the basic process of cell division, but also because of their potential role as tumor suppressors in cancer. For instance, p15 and p27 are induced by trans- forming growth factor-~ (TGF-~) and by cell contact (Polyak et al. 1994a; Toyoshima and Hunter 1994; Han- non and Beach 1994); p21 participates in at least some forms of programmed cell death and its expression is induced by the wide-ranging tumor suppressor p53 (E1- Diery et al. 1993; Harper et al. 1993); and p16 is inac- tivated in a large fraction of human cancers (see Kamb 1995, for review). Germline mutations in the p16 gene (P16/MTS1/pI6rNK4/CDKN2) also predispose to mela- noma and possibly other cancers (Kamb et al. 1994b; Hussussian et al. 1994). Thus, P16 in particular appears to be a key participant in tumorigenesis.
P16 lies adjacent to the p15 gene (P15/MTS2) in human chromosomal region 9p21 (Kamb et al. 1994b). Three exons (EI~, E2, E3) comprise the coding se- quence of human P16, compared to two (El, E2) for
796
A.
h u m a n p l 5 A T G C . . . . . . . . . I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I . . . . . . . . .
. . . . p 1 6 A T C ~ A G T C[~}G C T I ~ c A I ~ c C A i ~ A i C T G G C C i i i ~ 1 C ] IGI I h u m a n p 1 6 A T G G A G C C G G C G G C G G G G A G C A G C A T A G C C T T C G C T CT IGIGICT G G C C A C
. . . . p15 A T G T T G G G G CA G I l A G T A C G GIGICIC T G G C C A C humanp]5 G C G A G G A G A A C A A G G G C A T GC C C A G T G G GLG~G C G G A G C GLGJA TIG AIG G T C T G G C C
. . . . . . . . . I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I . . . . . . . . .
.... p,6 C C T G GCA O,C,GOAAOCCGG,GOTT,ClICCAAC i , . . ~ . p,61 c G G G IC IC G G G GI T l o p GI G • ~ G ~ GI G ~ G G T G C G GIG C ~1 c T I GI c T a a A IEIG C IEIG GI G [G C--]G C • a C C C A ~ C . . . . pl5 Ic G G ClGIC G G G GiGICIA AIGT G a A GIA C~G GT a C GGgJC A Ale TIC C r a G A A G C C G ~lc ~l~c~ A ~ A T c c c A A c humanpl5 ICG G C]GIC G G G GIAIC~T AIG T G G A GIAtA G G T G C GIA C A G CLC.~c c T G G A A G C C G G C G G A C C A A C
. . . . . . . . . ] . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . i . . . . . . . . .
. . . . p16 ~ C ~ C I - G ' - ' ~ A ~ T ~ T T T C G G T C I ~ A C , 2 ~ C C G A T ~ A T G A T G A T G G G C A A T T A C ~ h.~.p,6 ~ A ~ O I G A A F A E T T N O GGT C[~ ~ l A l ~ C C G A T C C A ~:i,e:!!T C A T G A T G A T Q GG C A ~ G A
o o , , c . . . . p,5 ~ C ~ T ~ A A ~ C I G [ ] T T C G G G C C N A T C C A ~ i ~ I i l i T C ~ G A T ~ G G G C A ~ C G C C C ~ G hu~npl5 AGTCIAAC~C~TTTC AIGGICIGCGCGATCCA!i~iiiiI~iliTCATGATGAT6GGCA GC
. . . . . . . . . I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I
. . . . p16 ~']A ~ C T T C A A ~ T ~ A F ~ T T ~ A A C T GC G A L ~ G I - G ' - ~ C ~ C ~ h u n ~ n p l 6 G I _ _ _ _ . G C T C G G A A C T G C G O I C l G A C O C I C I G O C A C I T I c ' r c c A c c c J . . . . p ~ I C t A I G * G C T G C ~ G C T G e T C C ~ C G G I A p C l A I G A I ~ I C O C A ~ C T G C a C l C l a , C C C l T I G C e ~ C l C l C T E _ I ~ C C ~ h.mo. PlSlClGIGAGCT G C T G C T G C T C C A C G G l e l G C l G l e A I G I C C C A A C T ( 3 C G C I A I G A C C C I T I G C C A C I T I C T C A C C C l
. . . . . . . . . I . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . I . . . . . . . . .
. . . .
humanp16 C G T G C A C G A C G C T C G G G C T mousep l5 T G T G C A C G A C G C A T A G G C T humanpl5 G G T G C AF~G AF~G C TIG ClClC G G G AIG a a C T
. . . . . . . . . I . . . . . . . . . . . . . . . . . .
C C T G G A C A O G C T G G T G G T G C T G G A C G L g E G - - ~ C C T G G A C A C G C T G G T G G T G C T G C A C C G G G C C T G G A C A C G C T ~ G T ~ G T G C T G C A C C G G G CCTGGACACGCTGGTGGTGCTGCACiiii I
.... p6 A OOGCTGAIITGOOGAOOCTGOGO O G OGAOTTGGOOO A , . ~ . p~6 Ic lc IG G G G o G C G G e T G G A C a T G C G C G A T G e c T G G G G I c I c OI T I c T a C C IC I G T I a p A C IEIT a a C I T I G A I GIGI . . . . p15 ICIAIG G G G C G C G G C T G G A T G T GI~GI~]G Ar~G C C T G G G G CIC GlOlC T G C CIGIG TIAIG A C T T G G C TiC AIAIG I h u m a n p I 5 1 C I C I G G G G C G C G G C T G G A T G C G C G A T G C C T G G G G T I C G I T I C T G C C I C 1 G T I G G A C T T G G C C I G A I G I G I
. . . . . . . . . I . . . . . . . . . . . . . . . . . . . . . . . . . . . I . . . . . . . . . I . . . . . . . . .
ho~oN6 IA G ClTIG G G e e AITIC G[CIG A TLTGITIOIG ClA C C G G T G F'Gr~'GGIG['G']G C A C C A GLGJA G G A
. . . . p15 IAG CIAIG G G C C AICIC GITIG A ClAITITIG ClG AIGGT AITIC T G GIAICIGICITIG C]C Ale TLTJG GIAIGIA T FfIG A humanp,5 IA G ClGIG G G C C AIClC GICIG A CIGIT FIG ClA GIG G T AICIC T G C G CIA IClAIG ClC A ICGG GI IG I G AC TLT.. JGA
. . . . . . . . . i . . . . . . . . . . . . . . . . . I . . . . . . . . . I . . . . . . . . . ~ . . . . . . . . .
humanpl6G A A C C A T G C C C G C A T A G A I - I G C I C G L g . J C I G i G I A I A I G I G T C T C A ~ : ~ A T C C C G I A T I T G A I . . . . . . . . . I . . . . . . . . . I . . . . . . . . . I . . . . . . . . . I . . . . . . . . . I . . . . . . . . .
m o u ~ p 1 6 C A A G C A C G C C C A G i G G C C C T G G A A C T T C G C G G C C A A T C C C A A G A G C A G A G C T A A
Fig. 1. Alignments of primary sequences of M. musculus and human P15 and P16. The boxes indicate residue identities. A DNA sequence alignment of human and mouse P16 and P15 coding sequences begin- ning with their predicted initiation codons. Splice sites are indicated by shading of the two nucleotides that flank the junction. The region involved in the presumptive gene conversion event is shown by a thick underline. Note that this converted region extends beyond the splice
P15. Both proteins, p15 and p16, inhibit CDK4 and CDK6 in vitro (Serrano et al. 1993; Harmon and Beach 1994; Parry et al. 1995), and overexpression of either protein in vivo inhibits cell growth (Guan et al. 1995; Serrano et al. 1995; Stone et al. 1995a). The primary sequences of the proteins reflect this functional similar- ity. Human P 1 6 encodes a protein of 156 amino acids that is roughly 77% identical to the 137 amino acids of p15 (Harmon and Beach 1994). Both molecules contain tandemly repeated ankyrin-l ike domains. Four such 32- residue domains form p16, while p15 has three complete ankyrin repeats and an incomplete fourth domain.
site at the 5' end of P16 E2, roughly 50 bases into the intron (Kamb et al. 1994a). B Alignment of predicted peptide sequences. The asterisks (*) indicate termination codons. Shading defines the four segments of ankyrin homology. CDNA sequence alignment of mouse and human Ell3 (Elb) sequences. The shaded nucleotides comprise the stop codons in the inferred (from E2) p16 reading frame.
We have investigated the evolutionary relationship between P 1 5 and P 1 6 by isolating M. m u s c u l u s ho- mologs of both. Comparisons among the two mouse and two human genes provide clues about the evolutionary history of the P 1 6 inhibitor family. In addition, the com- parisons enable functional and structural inferences to be drawn for this pair of interesting regulatory molecules.
Materials and Methods
Isolation of Genomic Clones. Degenerate PCR primers were designed based on the human p16 peptide sequence from amino acids 61-67
B .
7 9 7
mouse p16 human p16 mouse p15 human p15
mouse p16 human p16 mouse p15 human p15
mouse p16 human p16 mouse p15 human p15
mouse p16 human p16 mouse p15 human p15
mouse p16 human p16 m o u s e p15 human p15
mouse p16 human p16
m o u s e p15 human p15
mouse p16 human p16 mouse p15 human p15
mouse p16 human p16
mouse p16
C .
M E S i ~ i i i ~ i i i i i ~ i l i i i i i ~ i i ~ i i i R ~
M ~ . A A ~ ~ ~ ,, ~ . N ~ I ~ I ~ I ~ ! I
M R E E N K G M P S G G G ~ i i ~ i i i i i i ~ i i i i i i ~ i i ~ ! i ~ . . . . . . . . . . I . . . . . . . . . . I
[~-~1 ~ t~@l~!
798
cDNA such that it was anchored at its 5' end with a unique sequence oligo (RP.2). The cDNA was amplified with a reverse oligo common to both P15 E2 and P16 E2 (AGC GTG TCC AGG AAG CCT TC) and a nested version of RP.2 (RP.B). The resultant products were gel pu- rified and then captured by solution hybridization with a P16-specific biotinylated oligo (ACT GCG AGG ACC CCA CTA CCT TCT CC) or a P15-specific biotinylated oligo (AAC TGC GCC GAC CCT GCC ACC CTT ACC). After capture the products were amplified with a P16-specific reverse oligo (GAA CGT TGC CCA TCA TCA TC) or with a P15-specific reverse oligo (TGG GCG CTG CCC ATC ATC AT). The products were cloned and sequenced on an ABI 373A using the PRISM Ready Dye-Deoxy Terminator Cycle Sequencing Kit (Ap- plied Biosystems).
cDNA clones containing E3 of PI6 were isolated by conventional 3' RACE techniques (Samhrook et al. 1989) with one modification. Mouse oligo-dT primed cDNA was synthesized from total RNA de- rived from thymus tissue. The cDNA was synthesized such that it contained a unique sequence oligo incorporated at its 3' end (XPCR). The cDNA was amplified with a biotinylated P16-specific forward oligo, mMl.1 (GGG CTC GGC TGG ATG TCC), and a reverse oligo complementary to the XPCR sequence. The products were captured with strepavidin-coated magnetic particals (Dynal) and then amplified with raM1.2 (CAA GAG CGG GGA CAT CAA). mMl.2 is 33 bp 3' of raM1.1. The products were cloned and sequenced as above.
Linkage Analysis. Mouse P16 (officially Cdkn2) was mapped by Southern blot analysis of the progeny of the cross (NFS/N or C58/J Mus musculus musculus) x M. m. musculus (Kozak et al. 1990). South- erns were probed with a DNA fragment containing most of mouse P16 El. Progeny of this cross have been typed for over 600 markers in- cluding the chromosome 4 marker interferon alpha as described pre- viously (Sato et al. 1993). Data from this cross are stored and analyzed using the program LOCUS developed by C.E. Buckler (NIAID, Be- tbesda, MD).
Southern Blot Analysis. Genomic DNA was purchased from Promega or Clontech. The genomic DNAs (5 gg) were digested with EcoRI and the resultant fragments were resolved on a 0.65% agarose gel. After electrophoresis, the DNA was transferred to Zeta Probe (Bio-Rad) nylon membrane and probed with a fragment containing the entire coding sequence of the human P16 gene (Sambrook et al. 1989). Hybridizations at 65°C were carried out overnight in 7% polyethylene glycol, 10% sodium dodecyl sulfate, and 5x salt, sodium phosphate, EDTA buffer (SSPE). The filters were washed at 58°C in 5 × SSPE and 0.1% SDS. Dried filters were exposed to film for 5 days.
Sequence Alignment. The Smith-Waterman algorithm was used to compare protein and DNA sequences (Smith and Waterman 1981). Percent identities were calculated based on the alignment using in most cases the shortest of the two segments being compared as the denom- inator.
R e s u l t s a n d D i s c u s s i o n
Genomic Structure and Sequence o f M. m u s c u l u s P15
and P16
T w o types o f m o u s e g e n o m i c c lones were i so la ted by
l ow-s t r i ngency h y b r i d i z a t i o n u s ing a p r o b e de r i ved f r o m
m o u s e g e n o m i c D N A (see M a t e r i a l s a n d M e t h o d s ) .
T h e s e c lones i n c l u d e d d is t inc t sequences , b o t h w i th con-
s ide rab le h o m o l o g y to the h u m a n P15/P16 genes . Re-
p e a t e d effor ts u s ing l o w - s t r i n g e n c y h y b r i d i z a t i o n screens
Table 1A. Pairwise comparison between mouse and human Els at the DNA level
Human Mouse
Ela Elb E1 Ela Elb E1
0.59 0.72 - 0.60 Ela - - 0 . 6 1 b - Elb 1 0.62 a - 0.80 E1
1 - 0.60 Ela 1 - Elb
1 E 1
Human
Mouse
a Alignment includes one 2-bp gap 15 bp from mouse translational start b Alignment includes four 1-bp gaps
Table lB. Pairwise comparison between mouse and human E2s at the DNAlevel
Human Mouse
P15 E2 P16 E2 P15 E2 P16 E2
0.92 0.84 0.73 P15 E2
1 0.82 0.66 P16 E2
1 0.74 P15 E2
1 P16 E2
Human
Mouse
o f g e n o m i c l ibrar ies or P C R wi th degene ra t e o l igonuc le -
o t ide p r imer s fa i led to u n c o v e r add i t iona l s equence ho-
m o l o g s in the m o u s e ( K a m b et al. 1989). Fo r r easons
de ta i led be low, we c o n c l u d e d tha t one gene was the ho-
m o l o g o f h u m a n P16 and the s econd gene the h o m o l o g
o f h u m a n P15.
M o u s e c D N A clones c o r r e s p o n d i n g to the two ge-
n o m i c sequences were i so la ted b y h y b r i d cap ture R A C E
(see Mate r i a l s and Me thods ) . O n e o f the g e n o m i c se-
quences y ie lded two fo rms of c D N A , a f o r m s imi la r to
the c~ f o r m of the h u m a n P16 t r anscr ip t and a f o r m s im-
i lar to the [3 f o r m (S tone et al. 1995b; M a o et al. 1995).
C o m p o s i t e fu l l - l eng th c D N A sequences for each m o u s e
gene were cons t ruc t ed us ing H C R clones , R A C E clones ,
and g e n o m i c sequence .
C o m p a r i s o n o f the n u c l e o t i d e s e q u e n c e s o f t he se
m o u s e c D N A s wi th each o ther and w i th h u m a n P15 and
P16 r evea l ed a h i g h degree o f s imi lar i ty tha t e x t e n d e d
t h r o u g h m o s t o f the c o d i n g sequence of all four genes
(Fig. 1A). M o u s e P16 was the m o s t d i f fe ren t f r o m the
others . It was 7 4 % ident ica l to m o u s e P15 c o m p a r e d
wi th h u m a n P15 and P16 cod ing sequences tha t are 86%
ident ica l ove r 372 b p o f c o d i n g D N A . M o u s e P15 was
84% ident ica l to h u m a n P15 ove r 387 b p o f cod ing se-
q u e n c e ( h u m a n P15 has 411 bp of cod ing sequence) .
No tab ly , c o m p a r i s o n s of E1 D N A sequences s h o w e d that
the in t raspec ies d i f fe rences were g rea te r than the inter-
species d i f fe rences (Tab le 1). M o u s e and h u m a n P15 E l s
were 80% ident ica l ; m o u s e and h u m a n P16 E l s were
7 2 % ident ica l . In contras t , the two m o u s e E l s (Elc~ and
799
single ancestral gene
EI~ E2
gene duplication] recruitment of alternative E1
B u m W"I W"I |
EI~ m~
, / \ human]mouse divergence
I I""-I I""'-I I |
human (gene conversion) mouse
E1 E2 EI~ E10~ E2 E3
W ...... P15 P16 P15 PI6
Fig. 2. Cartoon showing the evolutionary steps from a hypothetical ancestral P16-1ike gene to the human P15 and PI6 genes. The transcript splicing patterns and the genomic structure of P15 and P16 are shown at the bottom. Note that we have drawn the figure illustrating the possibility that the P16 E1~3 exon arose post gene duplication; it is equally likely based on our data that the P15 version of EI~ was lost after an initial duplication event, or that the ElI3 exon was not duplicated.
P15 E l ) were only 60% identical and the two human E l s only 59% identical (Table 1A). The overall GC content of the two mouse genes was also similar to the human genes, about 65% vs 70%.
The genomic organization of the two mouse genes was determined by a series of experiments involving PCR and hybridization. The mouse genes were shown to lie within one P l ' s length ( -80 kb) of each other. Mouse P16 was mapped by hybridization of a mouse P16 E1 probe to Southern blots prepared from a panel of back- crossed mouse DNA (see Materials and Methods). At a 95% confidence level, mouse P16 was local ized to within 3.9 cM of interferon alpha (Ifa). In humans, P16
is located roughly 1-2 cM from the (z-interferon gene cluster. The introns between E1 and E2 in the mouse genes were located at the same positions as in the human P15 and P16 genes. The E l - E 2 intron sizes were deter- mined to be 5.5 kb and 3.5 kb for mouse PI6 and P15, respectively. By comparison, E 1 / E l a - E 2 intron sizes are 3.0 kb for human P16 and 2.5 kb for human P15 (Stone et al. 1995a,b). The mouse P16 E2/E3 junction was lo- cated 34 nucleotides downstream of the equivalent hu- man splice site.
To summarize, the assignments of mouse P15 and P16 were based on the following observations: (1) sub- stantial homology to the human inhibitors; particularly, similarity of one mouse cDNA to human P15; (2) phys- ical proximity of the two mouse genes; (3) l inkage of the mouse genes to the o~-interferon locus; (4) homology of one mouse cDNA variant with a version of human P16 mRNA that includes the Ell3 exon; and, (5) exordintron
structures of the mouse genes which are similar to their human counterparts.
Gene Conversion of P16 by P15
Comparison of human P15 and PI6 revealed an odd feature. A region of the second coding exon of both genes extending about 50 bp into the first intron was 92% identical at the nucleotide level (Fig. 1A) (Kamb et al. 1994a). There was an abrupt divergence at both ends of the shared region and the E1 sequences were only 59% identical. In addition, the intronic region immediately upstream of mouse P15 and P16 E2s was completely divergent (data not shown). The E2 region of the mouse P15 and P16 genes was only 74% identical, and human P16 E2 was more similar to mouse P15 E2 (82% iden- tity) than to mouse P16 E2 (66% identity) (Table 1B). Whereas pairwise exon sequence comparisons of the two human genes revealed considerable disparity in the per- cent ident i t ies of El(P15) and El(P16) re la t ive to E2(P15) and E2(P16) (59% vs 92%), the two mouse E1 and E2 exons were less different (60% vs 74%) (Table 1). Collectively, these observations suggest that gene conversion between P15 and P16 occurred in a human ancestor following its divergence from mice. This event involved roughly 310 bp of genomic DNA including most of E2 (Fig. 2).
Gene conversion was first observed in fungi as devi- ations from the expected 2:2 allelic segregation in spores (see Radding 1978, for review). More recently, se-
800
quences bearing the vestiges of past gene conversion events have been identified in mammalian germlines, Such sequences have been seen in loci of the major his- tocompatibility complex (MHC), the immunoglobulin complex, the globin gene cluster, and others (Mellor et al. 1983; Baltimore 1981; Slightom et al. 1980). Typi- cally, these presumptive gene conversion events involve related, closely linked loci. Direct evidence for gene con- version during meiosis has been gleaned by testing M. musculus sperm for newly converted MHC sequences in a highly sensitive PCR assay (Hoegstrand and Boehme 1994). Thus, there is ample precedent for conversion events of the type hypothesized to have occurred be- tween P15 and P16.
Using the presumptive unconverted coding sequence to set a molecular divergence clock, the time of the con- version event can be estimated assuming: (1) a constant rate of nucleotide sequence divergence in human and mouse at this locus; (2) the absence of gene conversion in the mouse lineage after divergence from humans; and (3) equivalent selective pressure on the peptide se- quences encoded by P16 E2 compared with P16 El, P15 El, and/or P15 E2. The first assumption is supported by the observation that human Elo~ and El(P15) DNA se- quences display roughly the same percent identity (59%) compared to mouse Elc~-El(P15) identity (60%). The second assumption is strengthened by inspection of the alignment between the mouse sequences which contains no clear signs of conversion. However, the latter assump- tion is weakened by the observation that the percent identity between the mouse and human P16 E1 protein sequence is 73%; between mouse and human P15 E1 protein sequence, 80%; and between mouse and human P15 E2, 92%. Thus, the divergence rates of the E2 and E1 portions of the proteins differ slightly, perhaps sug- gesting different degrees of selection. Nonetheless, the percent identities are not grossly different and can be used to estimate the conversion event time (equals the fractional sequence difference between human P15 E2 and human P16 E2 divided by the fractional sequence difference between mouse and human P16 El, P15 El, or P15 E2 (at the DNA level), multiplied by the time of divergence of mice and humans (65 million years before present, BP). This calculation yields a time for the con- version of 19, 26, or 33 million years BP, respectively. Using the average of the three numbers, and under the assumptions listed above, we predict that ancestors of the human line who lived earlier than about 26 million years BP (late Oligocene: about the time when apes first ap- peared) would have the M. musculus pattern for these two genes. Because divergence rates are likely to be greater in mouse due to its shorter generation time, this method of dating the conversion event is more likely to underestimate the age than to overestimate it.
Such a conversion event has implications for the func- tions of P15 and P16. It is possible that both genes served in a common, partly redundant capacity in the
mouse. Thus, the inferred gene conversion had little phe- notypic effect since the biochemical roles of the two proteins were substantially similar. This scenario is con- sistent with the biochemical behavior of human p15 and p16 in vitro. Both proteins are potent inhibitors of CDK4 and CDK6, but not of CDK2 (Serrano et al. 1993; Han- non et al. 1994; Parry et al. 1995). An alternative possi- bility is that the two ancestral proteins had different biological roles, yet the conversion event did not disrupt these different functions. This in turn implies that the biochemical difference between the two genes does not lie in the converted region, a region that includes nearly two-thirds of the coding sequence. The distinct biochem- ical behavior of the two proteins might reside in N-ter- minal residues, C-terminal residues, or in regulatory se- quences. Interestingly, the regulation of human P15 and P16 expression is different. PI5 is induced by TGF-[3, while P16 may be regulated in part by the retinoblastoma protein Rb (Li et al. 1994; Serrano et al. 1995; Parry et al. 1995; Stone et al. 1995b). Examination of protein sequence alignments suggests that the N- and C-termini are not subject to the same selective pressure as interior peptide sequences (Fig. 1B); the protein termini are more divergent. However, several examples of amino acids conserved specifically between human and mouse p16 (e.g., N-terminus: MESAAD) or human and mouse p15 (e.g., N-terminus: MLGGSSDAG; C-terminus: TGD) in- dicate that certain residues near the ends of the p15 and p16 proteins may be important for unique (and so far undefined) biochemical properties of each protein.
Based on their extensive sequence similarity, bio- chemical behavior, and tandem chromosomal location, it is likely that P15 and P16 arose from a single common ancestor by gene duplication and divergence. It is not clear when during evolution this ancestral gene arose. A multiple species blot probed with the P16 cDNA sug- gests the presence of P16-1ike sequences in mammals, but perhaps not in Drosophila, Schizosachoromyces, or Sacharomyces (Fig. 3). Confirmation of this result awaits either isolation and analysis of fragments from fly and yeast libraries that hybridize weakly to PI6 probes or further progress in sequencing the genomes of these or- ganisms.
Conservation of P16 EI~
The El~3 exon was identified first in humans and its function has been the subject of speculation (Stone et al. 1995b; Mao et al. 1995). It appears to be transcribed from a promotor that is distinct from the pl6-encoding o~ transcript promotor. It is induced more than tenfold as human G0-arrested T cells enter the cell cycle and it is regulated in a tissue-specific manner. Its presence in mouse further suggests an important function. The mouse and human ElI3 sequences are 61% identical in
801
23 kb
~, ~
E
!i)[
fourth domain of p15. The conservation is confined to the ankyrin homology domains, implying that the regions outside these repeats may be dispensable. The repeats are much more similar in both the mouse and human p15 and p16 sequences than would be expected based on ankyrin conservation alone. Ankyrin repeats are highly degener- ate in primary sequence (e.g., see Serrano et al. 1993). Indeed, another CDK inhibitor related to p15 and p16 called p 18 possesses the generic ankyrin repeat structure, but is only about 40% identical to human p16. The ex- treme sequence conservation of pl 5 and pl 6, both mouse and human, suggests that these proteins may make many surface contacts with their binding partners.
9.4 kb
6.5 kb Conclusion
4.3 kb
2.3 kb
Fig. 3. Multiple species blot probed with P16 cDNA. Genomic DNAs are labeled above. The blot was probed with complete P16
coding sequence labeled by random hexamer priming and P32-c~- dATP.
the 133-bp region upstream of the El/E2 splice junction. This value is only slightly lower than the Elm conserva- tion (72% over 126 bp). It is similar to the percent iden- tity between mouse P15 E1 and human or mouse Elc~ (60%), although the Ell3 figure includes four gaps. As in the human, the mouse p16 reading frame is closed in Ell3 immediately upstream of E2 (Fig. 1C). Also as in the human, a second long open reading frame (441 bp in mouse; 540 bp in human) exists in Ell3 which extends through much of E2. However, comparison of the protein translations of the different reading frames suggests that this alternative reading frame is not under selection at the protein level, and therefore does not encode a polypep- tide. Thus, it seems more likely that the l~ transcript encodes a truncated version of p16 that initiates at the 5' end of E2, if it encodes a protein at all.
Conservation of Ankyrin Repeat Structure
The basic structures of the ankyrin repeats are conserved in the mouse, including the truncation position in the
Comparisons between the mouse and human CDK in- hibitor genes P15 and P16 suggest that they are under strong evolutionary selection. This in turn implies that they have similar functions in mice and humans. The central core of the proteins including much of the second coding exon may be under stricter selection than the N- and C-termini. Indeed, gene conversion appears to have increased the similarity of the central core region in hu- man P15 and P16 during an event that may have oc- curred about the time apes originated. This leaves open the question of whether different important functions of the two genes fall outside this central core, or whether the genes comprise a functionally "redundant" pair. Studies of the regulatory behavior of the mouse genes (e.g., responsiveness to Rb and TGF-~) and of mouse gene knockout mutants will likely be of great value.
Noted Added in Proof
D. E. Quelle et al. have recently reported the identifica- tion of mouse homologs of p15 and p16 (Quelle et al. 1995).
References
Baltimore D (1981) Gene conversion: some implications for immuno- globulin genes. Cell 24:592-594
Chan FK, Zhang J, Cheng L, Shapiro DN, Winto A (1995) Identifica- tion of human and mouse p19, a novel CDK4 and CDK6 inhibitor with homology to p16 INK4. Mol Cell Biol 15:2682-2688
El-Deiry WF, Tokino T, Velculescu VE, Levy DB, Parsons R, Trent JM, Lin D, Mercer WE, Kinzler KW, Vogelstein B (1993) WAF1, a potential mediator of p53 tumor suppression. Cell 75:817-825
Gu W, Turck CW, Morgan DO (1993) Inhibition of CDK2 activity in vivo by an associated 20K regulatory subunit. Nature 366:707-710
Guan K-L, Jenkins CW, Li Y, Nichols MA, Wu X, O'Keefe CL, Matera AG, Xiong Y (1995) Growth suppression by p18, a p 16 INK4/MTs 1 and p 14 INK4B/MTs2-retated CDK6 inhibitor, correlates with wild-type pRb function. Genes Dev 8:2939-2952
802
Hannon GJ, Beach D (1994) p15 INK4B is a potential effector of TFG- 13-induced cell cycle arrest. Nature 371:257-260
Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge KK (1993) The p21 Cdk-interacting protein Cipl is a potent inhibitor of G1 cyclin- dependent kinases. Cell 75:805-816
Hirai H, Roussel MF, Kato JY, Ashmun RA, Sherr CJ (1995) Novel INK4 proteins, p19 and p18, are specific inhibitors of the cyclin D-dependent kinases CDK4 and CDK6. Mol Cell Biol 15:2672- 2681
Hogstrand K, Bohme J (1994) A determination of the frequency of gene conversion in unmanipulated mouse sperm. Proc Natl Acad Sci USA 91:9921-9925
Hussussian CJ, Struewing JP, Goldstein AM, Higgins PAT, Ally DS, Sheahan MD, Clark WHJ, Tucker MA, Dracopoli NC (1994) Germline pl6 mutations in familial melanoma. Nature Genet 8:15- 21
Kamb A, Weir, M, Rudy B, Varmus H, Kenyon C (1989) Identification of genes from pattern formation, tyrosine kinase, and potassium channel families by DNA amplification. Proc Nail Acad Sci USA 86:4372-4376
Kamb A, Gruis NA, Weaver-Feldlaaus J, Liu Q, Harshman K, Tavtigian SV, Stockert E, Day RS III, Johnson BE, Skolnick MH (1994a) A cell cycle regulator potentially involved in genesis of many tumor types. Science 264:436440
Kamb A, Shattuck-Eidens S, Eeles R, Liu Q, Gruis NA, Ding W, Hussey C, Tran T, Miki Y, Weaver-Feldhaus J, McClure M, Aitken JF, Anderson DE, Bergman W, Frants R, Goldgar DE, Green A, MacLennan R, Martin NG, Meyer LJ, Youl P, Zone JJ, Skolnick MH, Cannon-Albright LA (1994b) Analysis of CDKN2 (MTS 1) as a candidate for the chromosome 9p melanoma susceptibility locus (MLM). Nature Genet 8:22-26
Kamb A (1995) Cell-cycle regulators and cancer. Trends Genet 11: 136-140
Kozak CA, Pyser M, Krall M, Mariano TM, Kumar CS, Pestka S, Mock BA (1990) Molecular genetic markers spanning mouse chro- mosome 10. Genomics 8:519-524
Lee M-H, Reynisdottir I, Massague J (1995) Cloning of p57 Kin2, a cyclin-dependent kinase inhibitor with unique domain structure and tissue distribution. Genes Dev 9:639-649
Li Y, Nichols MA, Shay JW, Xiong Y (1994) Transcriptional repres- sion of the D-type cyclin-dependent kinase inhibitor pl6 by the retinoblastoma susceptibility gene product pRb. Cancer Res 54: 6078-6082
Mao L, Merlo A, Bedi G, Shapiro GI, Edwards CD, Rollins B J, Sidran- sky DA (1995) novel pl6 INK4a transcript. Cancer Res 55:2995- 2997
Matsuoka S, Edwards MC, Bai C, Parker S, Shang P, Baldini A, Warper JW, Elledge SJ (1995) p57 K~P2, a structurally distinct mem- ber of the p21 c~m Cdk inhibitor family, is a candidate tumor sup- pressor gene. Genes Dev 9:650~662
Mellor AL, Weiss EH, Ramachandran K, Flavell RA (1983) A poten-
tial donor gene for the bml gene conversion event in the C57BL mouse. Nature 306:792-795
Parry D, Bates S, Mann DJ, Peters G (1995) Lack of cyclin D-Cdk complexes in Rb-negative cells correlates with high levels of pl6 INK4/MTsl tumour suppressor gene product. EMBO J 14:503- 511
Peter M, Herskowitz I (1994) Joining the complex: cyclin-dependent kinase inhibitory proteins and the cell cycle. Cell 79:181-184
Polyak K, Kato J-Y, Solomon MJ, Sherr CJ, Massague J, Roberts JM, Koff A (1994a) p27 rap1, a cyclin-CDK inhibitor, links transforming growth factor 13 and contact inhibition to cell cycle arrest. Genes Dev 8:9-22
Polyak K, Lee M-H, Bromage HE, Koff A, Roberts JM, Tempst P, Massague J (1994b) Cloning of p27 ~:ipl, a cyclin-dependent kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 78:59-66
Quelle DE, Ashman RA, Harmon GJ, Rehberger PA, Trono D, Richter KH, Walker C, Beach D, Sherr CJ, Serrano M (1995) Cloning and characterization of murine p 16INK4a and p 15INK4b genes. Onco- gene 11:635-645
Radding C (1978) Genetic recombination: Strand transfer and mis- match repair. Annu Rev Biochem 47:847-880
Sambrook J, Fritsch EF, Maniatis T, (1989) Molecular cloning: a lab- oratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
Sato TN, Qin Y, Kozak CA, Adus KL (1993) tie-1 and tie-2 define another class of putative receptor tyrosine kinase genes expressed in early embryonic vascular systems. Proc Natl Acad Sci USA 90:9355-9358
Serrano M, Gomez-Lahoz E, DePinho RA, Beach D, Bar-Sagi D (1995) Inhibition of ras-induced proliferation and cellular transfor- mation by pl6 INK4. Science 267:249-252
Serrano M, Harmon GJ, Beach D (1993) A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4. Nature 366:704-707
Slightom JL, Blechl AE, Smithies O (1980) Human fetal ~/- and ay_ globin genes: complete nucleotide sequences suggest that DNA can be exchanged between these duplicated genes. Cell 21:627-638
Smith TF, Waterman MS (1981) Identification of common molecular subsequences. J Mol Biol 147:195-197
Stone S, Dayananth P, Jiang P, Weaver-Feldhaus JM, Tavtigian SV, Cannon-Albright L, Kamb A (1995a) Genomic structure, expres- sion and mutational analysis of the P15 (MTS 2) gene. Oncogene 11:987-991
Stone S, Jiang P, Dayananth P, Tavtigian SV, Katcher H, Parry D, Peters G, Kamb A (1995b) Complex structure and regulation of the P16 (MTS1) locus. Cancer Res 55:2988-2994
Toyoshima H, Hunter T (1994) p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell 78:67-74
Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D (1993) p21 is a universal inhibitor of cyclin kinases. Nature 366: 701-704