Comparison of eae, tir, espA and espB genes of bovineand human attaching and e¡acing Escherichia coli

by multiplex polymerase chain reaction

Bernard China *, Frederic Go¡aux, Vinciane Pirson, Jacques MainilLaboratory of Bacteriology, Faculty of Veterinary Medicine, University of Lie©ge, Sart Tilman B43a, B-4000 Lie©ge, Belgium

Received 21 May 1999; received in revised form 13 July 1999; accepted 14 July 1999

Abstract

Attaching and effacing Escherichia coli (AEEC) virulence genes include the eae, the tir, the espA and the espB genes. Thesegenes have been sequenced from several AEEC strains. The sequences alignments revealed the presence of constant andvariable regions. Multiplex polymerase chain reactions were developed, in order to determine the subtype of each gene presentin a particular isolate. AEEC strains isolated from calves dead of diarrhea, from healthy calves and from infected humans werecompared. The same pathotypes were found in sick and healthy calves but in inverted proportion. These pathotypes were alsofound in human AEEC. Although, the human EHEC strains from serotype O157 possessed their own pathotype. ß 1999Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.

Keywords: Virulence gene; Polymerase chain reaction; Attaching and e¡acing Escherichia coli

1. Introduction

Attaching and e¡acing Escherichia coli (AEEC)have been implicated in diarrhea and dysentery inman and various animals including 2^8-week oldcalves [1,2]. Attaching and e¡acing is the term usedto describe an intestinal lesion produced by these E.coli : attaching indicates the intimate attachment ofbacteria to the enterocyte, e¡acing relates to the lo-calized e¡acement of brush border microvilli. AEECgroups together enteropathogenic E. coli (EPEC)and enterohemorrhagic E. coli (EHEC) [3]. Humans

infections by EHEC can be of bovine origin andbovine meat is considered as a major source of con-tamination [3].

The genes responsible for the development of thislesion are clustered on the chromosome forming apathogenicity island called LEE for locus of enter-ocyte e¡acement [4,5]. The LEE human EPEC strainE2348/69 O127H6 was the ¢rst one to be cloned andsequenced [6]. This 35-kb long DNA fragment in-cludes genes encoding a type III secretion system,genes encoding type III secreted proteins (espA,espB, espD and tir) and the eae gene encoding intim-in, an outer membrane protein involved in the inti-mate attachment. A human EHEC strain from sero-type O157H7 [4,7] and a rabbit EPEC strain RDEC-1 from serotype O15 [8] and several bovine AEEC

0378-1097 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 3 5 2 - 3

* Corresponding author. Tel. : +32 (4) 366 40 52;Fax: +32 (4) 366 40 55; E-mail: bchina@ulg.ac.be

FEMSLE 8942 11-8-99

FEMS Microbiology Letters 178 (1999) 177^182

strains [9] all possess a LEE related to theone ofthe human EPEC strain E2348/69 although di¡er-ences in length, insertion site and gene sequenceshave been reported. Variants of the eae, tir and espgenes have been cloned and sequenced from humanEPEC and EHEC and from rabbit EPEC strains[6,7,10^12].

In addition, eae from a dog EPEC [13] and a bo-vine EHEC [14] have likewise been cloned and se-quenced. The eae gene variants of human strainshave been recently classi¢ed as K, L, Q and O ([15],Oswald, personal communication). They can be dis-tinguished by PCR or gene probes [15]. The eaegenes of rabbit and bovine origin are of the L typeand the canine eae gene is of the N type. The aim ofthis study was to develop a multiplex PCR speci¢cfor variants of the eae, tir, espA and espB genes al-ready described to compare bovine and humanAEEC strains with respect to those virulence-associ-ated genes.

2. Materials and methods

2.1. Strains

The AEEC strains belonged to three populations.37 AEEC isolated from the intestinal contents of 24di¡erent 2^8-week old calves which died of diarrhea,34 AEEC isolated from the intestinal contents offour di¡erent 24^48-week old cows from the slaugh-terhouse and 26 AEEC strains isolated independ-ently from stools of humans with diarrhea, dysenteryor hemolytic uremic syndrome. The strains were clas-si¢ed as AEEC because of a positive hybridizationwith the probe for the eae gene [16]. Several of thesestrains have already been tested for their capacity toinduce an AE lesion in the rabbit ileal loop assay [9].The 97 strains were serotyped using the followingantisera: O5, O8, O20, O26, O111, O118 and O157[17]. The human EPEC strain E2348/69 of serotypeO127H6 representing the K group of genes, the rab-

Table 1Primers used in this study

Genes andsubtypes

Strain(accession number)

Sequences of the deduced primers Optimala annealingtemperature (³C)

Amplicon size(bp)

eae E2348/69 B73: TACTGAGATTAAGGCTGATAA 50.4 452Type K (EMBL X60439) B138: GACCAGAAGAAGATCCAeae EDL933 B73: TACTGAGATTAAGGCTGATAA 50.2 778Type Q (EMBL Z11541) B74: AGGAAGAGGGTTTTGTGTTeae 193 B73: TACTGAGATTAAGGCTGATAA 50.8 520Type L (GenBank AF043226) B137: TGTATGTCGCACTCTGATTtir E2348/69 B139: CRCCKCCAYTACCTTCACA 54.2 342Type K (GenBank AF022236) B152: CGCTAACCTCCAAACCATTtir EDL933 B139: CRCCKCCAYTACCTTCACA 54.7 781Yype Q (GenBank AF07134) B141: GTCGGCAGTTTCAGTTTCACtir 95ZG1 B139: CRCCKCCAYTACCTTCACA 53.4 560Type L (GenBank AF070068) B140: GATTTTTCCCTCGCCACTAespA E2348/69 B163: TGAGGCATCTAARGMGTC 48.9 269Yype K (GenBank Z54352) B165: GCTGGCTATTATTGACCGespA EDL933 B163: TGAGGCATCTAARGMGTC 47.9 172Type Q (GenBank Y13068) B164: ATCACGAATACCAGTTACCAespA RDEC-1 B163: TGAGGCATCTAARGMGTC 46.4 101Type L (GenBank U80908) B166: TGCCTTTCTTATTCTTGTCAespB E2348/69 B148: GCCGTTTTTGAGAGCCA 50.6 94Type K (GenBank AF022236) B151: TCCCCAGGACAGATGAGATespB EDL933 B148: GCCGTTTTTGAGAGCCA 53.1 188Type Q (GenBank Y13068) B150: GCACCAGCAGCCTTTGAespB RDEC-1 B148: GCCGTTTTTGAGAGCCA 50.9 233Type L (GenBank U80796) B149: CTTTCCGTTGCCTTAGT

R = A+G, K = T+G, Y = C+T, M = A+C.aAs calculated by the oligo software.

FEMSLE 8942 11-8-99

B. China et al. / FEMS Microbiology Letters 178 (1999) 177^182178

bit EPEC strain RDEC-1 of serotype O15 represent-ing the L group of genes and the human EHECstrain ATCC43888 of serotype O157H7 representingthe Q group of genes have been used as positive con-trols.

2.2. Primers and ampli¢cations

The primers used in this study are listed in Table1. The DNA was prepared as previously described[18]. The PCR mixture was: 5 Wl of template DNA,5 Wl of 2 mM dNTP, 5 Wl of 10Ubu¡er (100 mMTris-HCl, 15 mM MgCl2, 500 mM KCl, pH 8.3),0.5 Wl of each primer, 1 U of Taq DNA polymerase(Boehringer Mannheim, Germany) and sterile dis-tilled water till 50 Wl. The ampli¢cation was per-formed in a Gene Cycler (Bio-Rad). For espA, thefollowing cycles were used: 1U94³C for 5 min and30U(94³C for 30 s, 48³C for 30 s, 72³C for 30 s). ForespB, eae and tir, the following cycles were used:94³C for 5 min and 30U(94³C for 30 s, 50³C for30 s, 72³C for 30 s). The PCR products were ana-lyzed by gel electrophoresis in 2^2.5% agarose. Inorder to be sure that the amplicon was obtainedfrom the appropriate genes, amplicons were digestedwith restriction endonucleases (Table 2).

3. Results

3.1. Selection and speci¢city of primers

The available sequences of the eae, tir, espA and

espB genes of the K, L and Q groups were aligned andfrom each sequence alignment, an upper primer wasselected into a constant part and a lower primer wasselected into a variable region of each gene subtypeto obtain one cocktail of four primers for each gene.The primers corresponding to one gene were selectedin order to have the same annealing temperature foreach couple and to obtain an amplicon of di¡erentsize. First, the speci¢city of the primers was tested oncontrol strains (Fig. 1). For the eae gene, an ampli-con of 778 bp for the ampli¢cation of the eaeQ geneby primers B73 and B74, an amplicon of 452 bp forthe ampli¢cation of the eaeK gene by primers B73and B138 and an amplicon of 520 bp for the ampli-¢cation of the eaeL gene by primers B73 and B137were expected. For the tir gene, an amplicon of 342bp for the ampli¢cation of the tirK gene by primersB139 and B152, an amplicon of 781 bp for the am-pli¢cation of the tirQ gene by primers B139 and B141and an amplicon of 560 bp for the ampli¢cation ofthe tirL gene by primers B139 and B140 were ex-pected.

For the espB gene, we expected an amplicon of 94bp for the ampli¢cation of the espBK gene by primersB148 and B151, an amplicon of 188 bp for the am-pli¢cation of the espBQ gene by primers B148 andB150 and an amplicon of 233 bp for the ampli¢ca-tion of the espBL gene by primers B148 and B149were expected. For the espA gene, 269-, 172- and101-bp amplicons for espAK, espAQ and espAL ampli-¢cations were expected, respectively. In each case, anamplicon of the expected size was observed (Fig. 1and Table 1). Moreover, all the amplicons gave re-

Table 2Restriction analysis of amplicons

Gene Primers Strain Amplicon size (bp) Enzyme Restriction fragment length (bp)

eaeK B73-B138 E2348/69 452 SspI 298^154eaeL B73-B137 RDEC-1 520 RsaI 220^200^80eaeQ B73-B74 ATCC43888 778 SspI 435^343tirK B139-B152 E2348/69 342 PstI 215^127tirL B139-B140 RDEC-1 560 XhoI 320^240tirQ B139-141 ATCC43888 781 EcoRV 460^321espAK B163-B165 E2348/69 269 HaeII 189^80espAL B163-B166 RDEC-1 101 FokI 61^50espAQ B163-B164 ATCC43888 172 MnlI 108^64espBK B148-B151 E2348/69 94 HpaII 50^44espBL B148-B149 RDEC-1 233 Sau3A 133^100espBQ B148-B150 ATCC43888 188 Sau3A 94^94

FEMSLE 8942 11-8-99

B. China et al. / FEMS Microbiology Letters 178 (1999) 177^182 179

striction fragments of the expected size (Table 2,data not shown). No ampli¢cation product was ob-tained from E. coli K12 JM109.

3.2. Typing of bovine AEEC strains

The four primer cocktails were used to amplifyeae, tir, espA and espB genes from bovine AEECisolated either from the intestinal content of 2^8-week old calves dead of diarrhea or from the intes-tinal content of 24^48-week old healthy calves at theslaughterhouse (Table 3). In calves with diarrhea, theeae gene mainly (67.5%) observed is the eaeL genewhile the other strains possessed an eaeQ gene. Inhealthy calves, the image was inverted since 82% ofthe strains possessed an eaeQ gene and only 18% aneaeL gene. Interestingly, the eaeK gene was not recov-ered from either sick or healthy calves. For the tir

gene, in calves with diarrhea, the tirL was dominantand in healthy calves, the tirK was dominant. The tirQwas never ampli¢ed from either sick or healthycalves. For the espB gene, in calves with diarrhea,the espBL was dominant (67.5%) and in healthycalves, the espBK was dominant (82%). The espBQ

was not ampli¢ed from both calf populations.The same results were obtained for the espA gene.

In general, only two gene combinations were foundin both calf populations: eaeL tirL espAL espBL andeaeQ tirK espAK espBK. Moreover, in AEEC strainsisolated from calves with diarrhea, the pathotypeeaeL tirL espAL espBL was dominant (67.5%) andthe pathotype eaeQ tirK espAK espBK was present asa minority. In contrast, in AEEC isolated fromhealthy calves, the pathotype eaeQ tirK espAK espBK

was dominant (82%) and the pathotype eaeL tirL esp-AL espBL was present as a minority (18%). The per-

Fig. 1. Analysis of PCR ampli¢cations. The eae, tir, espA and espB genes were ampli¢ed by multiplex PCR. Ampli¢cation products wereanalyzed by electrophoresis on a 3% agarose gel. Lane 1: eae gene from O127 human EPEC strain E2348/69 ampli¢ed with primers B73,B74, B137 and B138; lane 2: eae gene from O15 rabbit EPEC strain RDEC-1 ampli¢ed with primers B73, B74, B137 and B138; lane 3:eae gene from O157H7 human EPEC strain ATCC43888 ampli¢ed with primers B73, B74, B137 and B138; lane 4: DNA from E. colistrain JM109 ampli¢ed with primers B73, B74, B137 and B138; lane 5: tir gene from strain E2348/69 ampli¢ed with primers B139, B140,B141 and B152; lane 6: tir gene from strain RDEC-1 ampli¢ed with primers B139, B140, B141 and B152; lane 7: tir gene from strainATCC43888 ampli¢ed with primers B139, B140, B141 and B152; lane 8: DNA from E. coli strain JM109 ampli¢ed with primers B139,B140, B141 and B152; lane 9: espA gene from strain E2348/69 ampli¢ed with primers B163, B164, B165 and B166; lane 10: espA genefrom strain RDEC-1 ampli¢ed with primers B163, B164, B165 and B166; lane 11: espA gene from ATCC43888 ampli¢ed with primersB163, B164, B165 and B166; lane 12: DNA from E. coli strain JM109 ampli¢ed with primers B163, B164, B165 and B166; lane 13: espBgene from strain E2348/69 ampli¢ed with primers B148, B149, B150 and B151; lane 14: espB gene from strain RDEC-1 ampli¢ed withprimers B148, B149, B150 and B151; lane 15: espB gene from strain ATCC43888 ampli¢ed with primers B148, B149, B150 and B151;lane 16: DNA from E. coli strain JM109 ampli¢ed with primers B148, B149, B150 and B151. Molecular mass ladder is in bp.

FEMSLE 8942 11-8-99

B. China et al. / FEMS Microbiology Letters 178 (1999) 177^182180

centage was extremely di¡erent (P6 0.001) from onepopulation to the other as calculated by the Fisherexact test.

Pathotype eaeL tirL espAL espBL was associatedwith serogroups O5 (1/31), O20 (1/31) and O26 (5/31) and pathotype eaeQ tirK espAK espBK was associ-ated with serogroups O5 (3/36), O20 (1/36), O111 (6/36) and O118 (4/36) but the majority of bovineAEEC strains were untypable using our antisera(49/71).

3.3. Typing of human AEEC strains

Since bovine meat is considered as a major sourceof human contamination, we investigated if the com-bination eaeQ tirK espAK espBK could be recoveredfrom human AEE. Seven O111 human EHECstrains, eight human O26 EHEC and 11 humanO157 EHEC strains were isolated from patientswith diarrhea, dysentery or haemolytic uremic syn-drome. The results indicated that the seven O111EHEC were eaeQ tirK espAK espBK, the eight O26EHEC were eaeL tirL espAL espBL and the 11 O157EHEC were eaeQ tirQ espAQ espBQ (Table 3).

4. Discussion

AEEC cause diarrhea and dysentery in 2^8-weekold calves and are recovered from healthy adults[2,19] but also in humans where bovine product isthe major contamination source [3]. The subdivisionbased on the serotype is less and less clearly de¢nedas the range of serotypes isolated from both cattleand humans widens continuously. The multiplex

PCR seems to be a good alternative. We constructedmultiplex PCR for variants of the eae, tir, espA andespB genes. The nomenclature used by Adu-Bobie etal. [15] for the eae gene was extended to the othergenes. First, we studied bovine AEEC isolated eitherfrom calves dead of diarrhea or from healthy calves.Only two pathotypes (out of 81 combinations) werefound with di¡erent frequencies in bacteria from twocalf populations. Although both pathotypes (eaeLtirL espAL espBL and eaeQ tirK espAK espBK) werepresent in healthy and diseased calves, the pathotypeeaeL tirL espAL espBL seems to be more frequentlyassociated with virulence. Second, we addressed thequestion of the correlation between pathotype andserogroup and of the comparison with humanAEEC belonging to three serogroups also found incattle : O26 and O111 causing diarrhea in calves andisolated from healthy cattle and O157 isolated fromhealthy cattle [3,20]. All the tested O26 strainspossessed the pathotype eaeL tirL espAL espBL andall the tested O111 strains possessed the pathotypeeaeQ tirK espAK espBK. For O157 strains, a newpathotype appeared (eaeQ tirQ espAQ espBQ ). On theother hand, the pathotype detected was not corre-lated to other serogroups, such as O5, O20 orO118 (Table 3).

Acknowledgements

This work was supported by Grant 5740A fromthe `Ministe©re des Classes moyennes et de l'Agricul-ture, DGVI, Recherche et Developpement'. Wethank Dr Denis Pierard of the `AZ-VUB' for provid-ing the human EHEC strains.

Table 3Pathotype of tested AEEC

Source Number ofstrains

Pathotype Number ofpositive

Serogroup (number of strains)

Calves with diarrhea 37 eaeL tirL espAL espBL 25 O5 (1), 026 (2), O118 (1), NT (21)eaeQ tirK espAK espBK 12 O111 (1), NT (11)

Healthy calves 34 eaeL tirL espAL espBL 6 O20 (1), O26 (3), NT (2)eaeQ tirK espAK espBK 28 O5 (3), O20 (1), O111 (5), O118 (4), NT (15).

Human 26 eaeL tirL espAL espBL 8 O26 (8)eaeQ tirK espAK espBK 7 O111 (8)eaeQ tirQ espAQ espBQ 11 0157 (11)

NT: non-typable using our antisera.

FEMSLE 8942 11-8-99

B. China et al. / FEMS Microbiology Letters 178 (1999) 177^182 181

References

[1] Mainil, J.G., Jacquemin, E., Kaeckenbeeck, A. and Pohl, P.(1993) Association between the e¡acing gene (eae) and theShiga-like toxin-encoding genes in Escherichia coli isolatesfrom cattle. Am. J. Vet. Res. 54, 1064^1068.

[2] China, B., Pirson, V. and Mainil, J. (1998) Prevalence andmolecular typing of attaching and e¡acing Escherichia coliamong calf populations in Belgium. Vet. Microbiol. 63, 249^259.

[3] Nataro, J.P. and Kaper, J.B. (1998) Diarrheagenic Escherichiacoli. Clin. Microbiol. Rev. 11, 142^201.

[4] McDaniel, T.K., Jarvis, G., Donnenberg, M.S. and Kaper,J.B. (1995) A genetic locus of enterocyte e¡acement conservedamong diverse enterobacterial pathogens. Proc. Natl. Acad.Sci. USA 92, 1664^1668.

[5] McDaniel, T.K. and Kaper, J.B. (1997) A cloned pathogenesisisland from enteropathogenic Escherichia coli confers the at-taching and e¡acing phenotype on E. coli K12. Mol. Micro-biol. 23, 399^407.

[6] Elliott, S.J., Wainwright, L.A., McDaniel, T.K., Jarvis, K.G.,Deng, Y.K., Lai, L.C., McNamara, B.P., Donnenberg, M.S.and Kaper, J.B. (1998) The complete sequence of the locus ofenteroycte e¡acement (LEE) from enteropathogenic Escheri-chia coli E2348/69. Mol. Microbiol. 28, 1^4.

[7] Perna, N., Mayhew, G.F., Posfai, G., Elliot, S., Donnenberg,M.S., Kaper, J.B. and Blattner, F.R. (1998) Molecular evolu-tion of a pathogenicity island from enterohemorrhagic Esche-richia coli O157:H7. Infect. Immun. 66, 3810^3817.

[8] Karaolis, D.K.R., McDaniel, T.K., Kaper, J.B. and Boedeker,E.C. (1997) Cloning of the RDEC-1 locus of enterocyte e¡ace-ment (LEE) and functional analysis of the phenotype on Hep-2 cells. In: Mechanisms in the Pathogenesis of Enteric Dis-eases (Paul, P.S., Francis, D.H. and Ben¢eld, D.A., Eds.),Adv. Exp. Med. Biol. 412, pp. 241^245. Plenum, New York.

[9] Go¡aux, F., Mainil, J., Pirson, V., Charlier, G., Pohl, P.,Jacquemin, E. and China, B. (1997) Bovine attaching ande¡acing Escherichia coli possess a pathogenesis island relatedto the LEE of the human enteropathogenic E. coli strainE2348/69. FEMS Microbiol. Lett. 154, 415^421.

[10] Agin, T.S., Cantey, J.R., Boedeker, E.C. and Wolf, M.K.(1996) Characterization of the eaeA gene from rabbit enter-

opathogenic Escherichia coli RDEC-1 and comparison to oth-er eaeA genes from bacteria that cause attaching-afacing le-sions. FEMS Microbiol. Lett. 14, 249^258.

[11] Abe, A., Kenny, B., Stein, M. and Finlay, B.B. (1997) Char-acterization of two virulence proteins secreted by rabbit enter-opathogenic Escherichia coli, EspA and EspB, whose maximalexpression is sensitive to host body temperature. Infect. Im-mun. 65, 3547^3555.

[12] Paton, A.W., Mannig, P.A., Woodrow, M.C. and Paton, J.C.(1998) Translocated intimin receptor (Tir) of Shiga-toxigenicEscherichia coli isolates belonging to serogroups, O26, O111,and O157 react with sera from patients with hemolytic-Uremicsyndrome and exhibit marked sequence heterogeneity. Infect.Immun. 66, 5580^5586.

[13] An, H., Fairbrother, J.M., Dubreuil, D. and Harel, J. (1997)Cloning and characterization of the eae gene from a dog at-taching and e¡acing Escherichia coli strain 4221. FEMS Mi-crobiol. Lett. 148, 239^245.

[14] China, B., Devrin, A.C., Jacquemin, E., Pirson, V. and Main-il, J. (1999) Heterogeneity of the eae genes in attaching/e¡ac-ing Escherichia coli from cattle : comparison with humanstrains. Res. Microbiol. 150, 323^332.

[15] Adu-Bobie, J., Frankel, G., Bain, C., Gonzales, A.G., Trabul-si, L.R., Douce, G., Knutton, S. and Dougan, G. (1998) De-tection of intimins K, L, Q, and N four intimin derivates ex-pressed by attaching and e¡acing microbial pathogens. J. Clin.Microbiol. 36, 662^668.

[16] Jerse, A.E., Yu, J., Tall, B.D. and Kaper, J.B. (1990) A ge-netic locus of enteropathogenic Escherichia coli necessary forthe production of attaching and e¡acing lesions on tissue cul-ture cells. Proc. Natl. Acad. Sci. USA 87, 7839^7843.

[17] Orskov, F. and Orskov, I. (1984) Serotyping of Escherichiacoli. Method. Microbiol. 14, 43^112.

[18] China, B., Pirson, V. and Mainil, J. (1996) Typing of bovineattaching and e¡acing Escherichia coli by multiplex in vitroampli¢cation of virulence-associated genes. Appl. Environ.Microbiol. 62, 3462^3465.

[19] Blanco, M., Blanco, J.E., Blanco, J., Moro, A., Prado, C.,Alonso, M.P., Mourino, M., Madrid, C., Balsalobre, C. andJuarez, A. (1997) Distribution and characterization of faecalverotoxin-producing Escherichia coli (VTEC) isolated fromhealthy cattle. Vet. Microbiol. 54, 309^319.

FEMSLE 8942 11-8-99

B. China et al. / FEMS Microbiology Letters 178 (1999) 177^182182