Contributions of Epstein-Barr Nuclear Antigen 1 (EBNA1) and the Family of Repeats (FR) Region to oriP-Mediated

Replication and Segregation Functions in Nasopharyngeal Carcinoma

by

Natalia Thawe

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Molecular Genetics University of Toronto

© Copyright by Natalia Thawe 2012

ii

Contributions of Epstein-Barr Nuclear Antigen 1 (EBNA1) and the

Family of Repeats (FR) Region to oriP-Mediated Replication and

Segregation Functions in Nasopharyngeal Carcinoma

Natalia Thawe

Master of Science

Department of Molecular Genetics

University of Toronto

2012

Abstract

The Epstein-Barr virus (EBV) EBNA1 protein mediates the replication and mitotic

segregation of the EBV genomes via interactions with the viral oriP sequences. C666-1 is the

only known nasopharyngeal carcinoma (NPC) cell line that stably maintains EBV in culture and

I investigated whether this is due to differences in oriP-mediated functions in replication and

segregation. I found that both C666-1 and EBV-negative NPC cell lines can replicate and

maintain oriP plasmids for extended periods but that high EBNA1 levels interfered with plasmid

segregation. The segregation element within oriP was recently shown to contain 29 repeated

sequences instead of the 20 repeats in initial oriP isolates. I compared the functions of oriP with

20 or 29 repeats and found that the higher number of repeats decreased plasmid replication but

increased plasmid maintenance, consistent with a segregation effect. Finally, I identified a

potential role for promyelocytic leukemia nuclear bodies in oriP plasmid replication.

iii

ACKNOWLEDGEMENTS

First and foremost, I would like to thank God for giving me strength and leading me on

this journey. I would like to express my sincere gratitude to my supervisor, Dr. Lori Frappier, for

giving me the opportunity to pursue my MSc degree in her lab. Her passion for EBNA1 and

EBV first inspired me to join her lab as a fourth year project student after listening to her lecture

during the third year of my undergraduate degree. I am thankful for her guidance and support

over the years as well as during the process of writing this thesis. I would also like to thank my

committee members, Dr. Brigitte Lavoie and Dr. Laurence Pelletier, for their support, great

ideas, and constructive critiques. They have always given me great suggestions and input, and

helped me be more attentive when I approach scientific problems and experiments.

I am also so grateful to all the members of the Frappier Lab, both past and present, for

their support, help, guidance, and friendship. I want to thank Niro Sivachandran, Shan Wang,

Teresa Sanchez, Kathy Shire, Jennifer Yinuo Cao, and Natasha Malik for their amazing

friendships, honesty, and all our great laughs and conversations all the time. You guys were not

only a pillar of support, but a sisterhood that I will always treasure. The lab would not have been

nearly as enjoyable without you. I especially want to thank Kathy Shire for all her wisdom,

patience, kindness, and of course, all her baked goods! I will definitely need the recipe for that

carrot cake! Thank you for some great memories, Frappier Lab!

I want to dedicate this thesis to my family: my father, my mother, and my brother. This

has all been possible because of your constant love and support all these years. Thank you for

listening to all my complaints, understanding me, celebrating with me when my experiments

work, and for picking me back up when I feel low. You are the best part of my life and you mean

so much to me. I am especially grateful to my parents. Mom and Dad, thank you for everything

that you have done for me and for all the opportunities that you have given me. I thank God

everyday for being born into this family and for having you as parents. I hope that I have made

you proud and that I will continue to do so in the future. Matthew, you are the best brother that I

could ever ask for. Thank you for giving me a shoulder to lean on, keeping me calm, toughening

me up, and making me laugh. Mom, Dad, Matt, I love you and thank you!

iv

TABLE OF CONTENTS

ABSTRACT ii

ACKNOWLEDGEMENTS iii

TABLE OF CONTENTS iv

LIST OF TABLES vi

LIST OF FIGURES vii

LIST OF ABBREVIATIONS viii

CHAPTER I. INTRODUCTION 1

I.1 The Epstein-Barr Virus 1

I.1.1 Brief Overview 1

I.1.2 Primary Infection 2

I.1.3 Latent EBV Infection 2

I.1.4 EBV-associated Diseases 5

I.1.4.1 Nasopharyngeal Carcinoma 5

I.1.4.2 Gastric Carcinoma 6

I.2 EBV Latent Origin of Replication, oriP 7

I.2.1 Dyad Symmetry (DS) Element 7

I.2.2 Family of Repeats (FR) Element 9

I.2.3 Cellular Proteins Recruited to oriP 11

I.3 Epstein-Barr Nuclear Antigen 1 (EBNA1) 14

I.3.1 Overview of Domain Structures 14

I.3.2 EBNA1 Functions 17

I.3.2.1 DNA Replication 17

I.3.2.2 DNA Segregation 20

I.3.2.2.1 EBNA1 Domains Contributing to Plasmid 20

Segregation

I.3.2.2.2 Involvement of EBP2 in EBNA1-Mediated 21

Plasmid Segregation

I.3.2.2.3 The Mitotic Tethering or “Piggybacking” 22

Model

I.3.2.2.4 Equal Partitioning of EBV Episomes to 23

Daughter Cells Following Mitosis

I.3.2.3 Transcriptional Regulation 24

I.3.2.4 Roles in Cell Transformation and Immortalization 26

I.4 Roles of Promyelocytic Leukemia (PML) bodies in Viral Replication 28

I.5 EBV Genome Maintenance in Nasopharyngeal Carcinoma 30

I.6 Thesis Rationale 31

v

CHAPTER II. MATERIALS AND METHODS 33

II.1 Cell Culture 33

II.2 Plasmid Constructs 33

II.3 Immunofluorescence Microscopy 35

II.4 Plasmid Replication and Maintenance Assays 35

II.5 Plasmid Labelling 37

II.6 Southern Blotting 37

II.7 Cell Proliferation Assay 38

II.8 Antibodies and Western Blotting 38

II.9 Monitoring Episomal Maintenance 39

CHAPTER III. RESULTS 40

III.1 pBFRGC6-Based Plasmids Do Not Autonomously Replicate in the 40

NPC Cell Line, CNE2Z

III.2 Higher EBNA1 Expression Can Inhibit Plasmid Maintenance Without 44

Inhibiting Plasmid Replication Efficiency in NPC Cells

III.3 Higher EBNA1 Expression Does Not Reduce EBV Copy Number 49

in C666-1 or AGS/EBV Cell Lines

III.4 Additional 9 Repeats within the FR Element Decrease Plasmid 51

Replication Efficiency but Improve Plasmid Segregation

III.5 Silencing of PML Protein Leads to a Reduction in Replication Efficiency 55

in NPC cells

CHAPTER IV. DISCUSSION 57

IV.1 FR-Bound EBNA1 May Enable Expression of GAL4-Cdc6 Fusion Protein 57

and Facilitate Replication of pBFRGC6-Based Plasmids

IV.2 Higher Levels of EBNA1 do not Inhibit Plasmid Replication and are not 58

Cytotoxic to CNE2Z Cells.

IV.3 Additional 9 Repeats within the FR Element May Confer an Advantage 60

in EBV Maintenance

IV.4 Possible Role of PML in Plasmid DNA Replication? 63

IV.5 Future Directions 64

CHAPTER V. REFERENCES 66

vi

LIST OF TABLES

Table 1 Epstein-Barr virus latency and expression profiles 5

vii

LIST OF FIGURES

Figure 1 The Epstein-Barr virus genome 4

Figure 2 Organization of the EBV latent origin of replication, oriP 8

Figure 3 EBNA1 functional domains 15

Figure 4 Plasmids used in this study 34

Figure 5 Schematic representation of protocol for plasmid replication and 42

maintenance assays

Figure 6 The pBFRGC6 plasmid does not autonomously replicate 43

Figure 7 Plasmid maintenance assays in CNE2Z and C666-1 cells 45

Figure 8 Higher levels of EBNA1 do not affect plasmid replication in 46

CNE2ZE cells

Figure 9 Higher levels of EBNA1 increase plasmid replication in C666-1 47

Figure 10 Higher levels of EBNA1 do not affect the copy number of EBV 50

episomes in C666-1 or AGS/EBV cell lines

Figure 11 The extra 9 repeats reduce plasmid replication efficiency 53

Figure 12 The extra 9 FR repeats improve plasmid segregation 54

Figure 13 PML silencing reduces the plasmid replication efficiency in 56

CNE2Z cells

viii

LIST OF ABBREVIATIONS

2D Two-dimensional

aa Amino acid

AT Adenine-thymine

BARF 1 BamHI rightward frame I

BART BamHI rightward transcript

BL Burkitt’s lymphoma

bp Base pairs

Brd4 Bromodomain protein 4

BrdU Bromodeoxyuridine

BSA Bovine serum albumin

BZLF1 BamHI Z leftward frame 1

BPV Bovine papillomavirus

CAT Chloramphenicol acetyltransferase

CEN Centromeric

ChIP Chromatin immunoprecipitation

CK2 Casein kinase 2

CMV Cytomegalovirus

Co-IP Co-immunoprecipitation

CTD C-terminal domain

DAPI 4’-6-Diamidino-2-phenylindole

DNA Deoxyribonucleic acid

dNTPs Deoxynucleotide triphosphate

dCTP Dyad symmetry

DTT Dithiothreitol

EBER Epstein-Barr expressed ribonucleic acid

EBNA1 Epstein-Barr nuclear antigen 1

EBNA1-LP Epstein-Barr nuclear antigen leader protein

EBP2 EBNA1-binding protein 2

EBV Epstein-Barr virus

ECL Enhanced chemiluminescence

ix

EDTA Ethylenediaminetetraacetic acid

FISH Fluorescence in-situ hybridization

FR Family of repeats

FBS Fetal bovine serum

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

GC Gastric carcinoma

GFP Green fluorescent protein

Gly-Ala Glycine-alanine

Gly-Arg Glycine-arginine

USP7 Ubiquitin specific protease 7

HMG-1 High mobility group 1

IE Immediate-early

IM Infectious mononucleosis

Kb Kilobase

kD Kilodalton

KSHV Kaposi’s sarcoma-associated herpes virus

LANA1 Latency-associated nuclear antigen 1

LCLs Lymphoblastoid cell lines

LMP Latent membrane protein

MCM Minichromosome maintenance

MHC Major histocompatibility complex

miRNA microRNA

NAP1 Nucleosome assembly protein 1

NLS Nuclear localization signal

NPC Nasopharyngeal carcinoma

ORC Origin recognition complex

oriP Origin of plasmid replication

PAR Poly-ADP-ribosylation

PARP Poly-ADP-ribose polymerase

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PML Promyelocytic leukemia

x

PML NBs Promyelocytic leukemia nuclear bodies

RARα Retinoic acid receptor α

RPA Replication protein A

SDS Sodium dodecyl suphate

SDS-PAGE SDS polyacrylamide gel electrophoresis

siRNA Small interfering RNA

shRNA Short hairpin RNA

SSC Saline sodium citrate

SV40 Simian virus 40

TAF1β Template activatin factor 1β

TR Terminal repeat

TRF Telomeric repeat binding factor

WHO World Health Organization

1

CHAPTER I. INTRODUCTION

I.1 Epstein-Barr Virus

I.1.1 Brief Overview

Epstein-Barr virus (EBV) is a well-studied member of the herpesvirus family which

encompasses over one hundred diverse enveloped viruses that are divided into three

classifications termed alpha, beta, and gamma. These classifications are mainly assigned

according to distinguishing characteristics of a herpesvirus such as their genome sequence and

biological cycle, and host specificity. Despite the different classes, all herpesviruses share a

common architecture composed of a linear double-stranded DNA genome core encased within an

icosahedral capsid structure. The capsid is coated by a proteinaceous layer referred to as

tegument, and an outer lipid bilayer membrane or envelope, which together form a virion. The

biological cycle of herpesviruses involves two stages: a latent (or nonproductive) infection, or a

lytic (productive) infection. Herpesviruses are capable of infecting a broad range of vertebrate

host species; however, as yet, only eight herpesviruses specific to humans have been identified

and have been characterized for their pathogenicity and associated diseases.

Anthony Epstein and Yvonne Barr first discovered EBV viral particles from cancer tissue

biopsies in 1964 while analyzing electron micrographs of Burkitt’s lymphoma cells (Epstein et

al. 1964). EBV was the first herpesvirus genome to be entirely sequenced (Lear et al. 1992) and

is very wide-spread, as greater than 95% of the adult population worldwide is infected with this

virus. EBV, also known as human herpesvirus 4, is classified as a member of the gamma

herpesvirus family that also includes Kaposi’s sarcoma associated herpesvirus (KSHV). These

are the only two gamma herpesviruses known to infect humans. An EBV virion consists of a 172

Kb linear genome surrounded by a nucleocapsid composed of 162 capsomeres, which in turn is

enclosed by tegument and a typical herpesvirus envelope containing viral-derived glycoproteins.

Upon internalization by a host cell, the linear EBV genome is taken up into the nucleus of the

cell and circularizes by ligating its two termini. The termini vary in length and encode a series of

500 bp direct repeats; hence, a characteristic number of terminal repeats is associated with each

EBV infection. The size of the terminal repeats remains constant with each clonal infection event

such that when an infected cell divides the resulting daughter cells will continue to maintain

identical number of terminal repeats. The extrachromosomal circular EBV genome associates

2

with core histone proteins and is packaged into nucleosomes, similar to cellular chromatin (Shaw

et al. 1979).

I.1.2 Primary Infection

Primary infection with EBV usually occurs during early childhood and is typically

asymptomatic. The infected individual remains as a carrier of EBV for their lifetime. Known as

the “kissing disease” due to its transmission via saliva, EBV initially enters the body and infects

the mucosal epithelial cells of the oropharynx wherein the virus replicates and infectious virions

are produced. During this transient phase of lytic replication, approximately 80 viral proteins

involved in viral replication and virion production are expressed. The virions subsequently

encounter infiltrating B-lymphocytes at the submucosal layer and establish latent infection (Kieff

1996; Rickinson and Kieff 1996). In order to infect and be taken up by circulating B-cells, the

main viral envelope glycoprotein gp350/220 binds to its receptor CD21 on the host cell surface

(Fingeroth et al. 1984). Studies have shown that the entry of EBV into host cell is facilitated by

the viral envelope glycoprotein gp42, which associates with the major histocompatibility

complex (MHC) class II protein (Li et al. 1997). Once the virion enters the cytoplasm of the cell,

it is transported to a nuclear pore through which the EBV genome is released into the host

nucleus and circularizes, which is necessary for latent infection.

If exposure to EBV is delayed until adolescence or adulthood, primary infection can

result in a self-limiting lymphoproliferative disorder called infectious mononucleosis (IM)

following a one month incubation stage (Gerber et al. 1972). Clinical features of IM include sore

throat, fever, lethargy, pharyngitis, and lymphadenopathy (Gerber et al. 1972; Kutok and Wang

2006). Once this acute lytic phase of infection subsides, EBV persists latently in a pool of

circulating B-cells within the host for their lifetime. Importantly, the lytic phase of the EBV life

cycle can be reinitiated upon expression of either of two immediate-early (IE) viral genes

encoding, BZLF1 and BRLF1 which are two regulators that transactivate genes involved in lytic

replication (Miller et al. 2007).

I.1.3 Latent EBV Infection

EBV is predominantly found in a latent state within resting or proliferative cells, in which

multiple copies of the virus are maintained as circular episomes which express restricted sets of

3

viral genes. B-cells are typically not the favoured location for EBV lytic infection, instead the

virus establishes a latent infection within this reservoir (Young and Murray 2003). Viral latency

is distinguished by infection without the production of virions. EBV latency has been classified

into four programs (latency 0, I, II, and III), each of which has a characteristic gene expression

profile and infects specific cell lineages (Rickinson and Kieff 1996). During latent infection, at

least 12 different viral genes can be expressed including the six nuclear antigen proteins or

EBNAs (EBNA1, EBNA2, EBNA3A, EBNA3B, EBNA3C, and EBNA leader protein (LP)),

three latent membrane proteins (LMP1, LMP2A, LMP2B), two small, non-coding RNAs

(EBER1 and EBER2), and the secreted BARF1 protein (Rickinson and Kieff 1996). In addition,

numerous micro RNAs are expressed from the EBV genome from the BHRF1 and BART

regions of the genome. Subsets of these latency genes are expressed for each latency state of

EBV infection, however, EBERs are expressed throughout all latency programs (see Table 1 and

Figure 1).

In the resting B-lymphocytes of the majority of the EBV-infected population, EBV is

predominantly kept in latency 0, a quiescent state in which only EBER1, EBER 2 and BART

RNAs are expressed. No viral proteins are usually expressed in the latency 0 program, although

LMP2A expression is infrequently observed (Thorley-Lawson et al. 1996; Thorley-Lawson

2001). In healthy adults, the restricted gene expression profile of latency 0 allows EBV to remain

silent and efficiently evade the host immune system (Klein et al. 2007).

Latency I is typically associated with both EBV-positive Burkitt’s lymphoma (BL) and

gastric carcinoma (GC) (Rickinson and Kieff 1996); however, latency I infection of memory B

cells is a common form of EBV infection in healthy individuals (Thorley-Lawson and Allday

2008). In addition to expression of EBV miRNAs, BARTs, and EBERs, the only viral protein

expressed during latency I is EBNA1, which is necessary for latent EBV genome persistence

(Rickinson and Kieff 2001). Latency II is similar to latency I in that EBNA1 is the only nuclear

antigen expressed, and its expression occurs from the Qp promoter (Rickinson and Kieff 1996).

In addition to EBNA1, all the LMPs are expressed as well as BARTs, miRNAs, and EBERs. The

latency II program was first recognized in EBV-positive nasopharyngeal carcinoma and

Hodgkin’s lymphoma tissue specimens and has not been observed in healthy individuals

(Fahraeus et al. 1988; Deacon et al. 1993).

4

Figure 1. The Epstein-Barr virus genome. Diagram showing the position and transcription of

the latent EBV genes on the double-stranded viral DNA episome. The latent origin of replication

(oriP) is depicted in orange. The large green solid arrow heads represent exons encoding the six

nuclear antigens (EBNAs 1, 2, 3A, 3B and 3C, and EBNA-LP) and the three latent membrane

proteins (LMPs 1, 2A and 2B), the direction of gene transcription is also indicated by the arrow.

Transcription of the gene encoding EBNA-LP occurs from an inconsistent number of repetitive

exons. LMP2A and LMP2B genes are composed of multiple exons, which are positioned on

either side of the terminal repeat (TR) region. The small blue arrows at the top represent the

genes encoding the two non-polyadenylated RNAs EBER1 and EBER2, which are consistently

expressed during all EBV latencies The long, thin outer green arrow represents EBV

transcription during latency III, in which all six EBNAs are transcribed from either the Cp or Wp

promoter. Differential splicing of the same long primary RNA transcript generates the individual

mRNAs for the different EBNAs. The inner, shorter red arrow represents the Qp promoter-

derived EBNA1 transcript during Latencies I and II. The BamHIA region at the top encodes

BARF0 and BARF1 and many microRNAs. (Modified from Yang, LS & Rickinson, AB, Nat

Rev Cancer, 2004)

172 kb

5

Finally, latency III, also referred to as the “growth program”, involves the expression of all six

EBNAs, the three LMPs, and the aforementioned viral RNA transcripts. Expression of the

six EBNAs occurs from either the Cp or Wp promoters which generate a precursor mRNA

transcript that is differentially spliced to give rise to individual transcripts for each EBNA

(Rickinson and Kieff 1996). Due to the fact that the five EBNAs other than EBNA1 are highly

immunogenic, latency III is not commonly observed in healthy individuals. Conversely, the

latency III program is associated with lymphoblastoid cell lines (LCLs), acute infectious

mononucleosis, and lymphoproliferative disorders. LCLs are generated in vitro when EBV-

infected resting B-cells are immortalized and transformed (Rickinson and Kieff 2001).

Table 1. Epstein-Barr virus latency and expression profiles

Note: Latency programs (I-III) all express EBERs

Latency Program EBNA proteins LMP proteins Associated Disease(s)

0 --- --- ---

I EBNA1

(Qp promoter) --- Burkitt’s lymphoma

II EBNA1

(Qp promoter) LMP1, LMP2A

NPC, GC, Hodgkin’s

diseases

III All 6 EBNAs

(Cp or Wp promoters)

LMP1, LMP2A,

LMP2B

IM, lymphoproliferative

disorders

I.1.4 EBV-associated Diseases

EBV is causally associated with infectious mononucleosis and the development and

progression of several human malignancies of lymphocyte or epithelial origin. EBV infection has

been linked with various types of cancers including Burkitt’s lymphoma, Hodgkin’s diseases,

gastric carcinoma, and nasopharyngeal carcinoma. Furthermore, EBV infection causes several

lymphoproliferative disorders upon immunosuppression including oral hairy leukoplakia

amongst AIDs and organ transplant patients (Delecluse et al. 2007). In the interest of my thesis I

will discuss two EBV-associated epithelial tumours: nasopharyngeal carcinoma and gastric

carcinoma, with more emphasis on the first disease.

I.1.4.1 Nasopharyngeal Carcinoma

Nasopharyngeal carcinoma or NPC is an epithelial tumour that occurs within the

nasopharynx and is marked by the development of a growth or swelling in the neck, hearing loss,

and/or blockage of the nasal pathway. NPC is endemic in South-East Asia, Indonesia, and some

6

regions of Northern Africa, where it is responsible for nearly 20% of all cancers amongst adults

(Shah and Young 2009). There is high incidence for the development of NPC observed amongst

Chinese descendents, which suggests that there may be genetic factors that contribute to the

onset of this disease. In addition to genetic predisposition, some environment carcinogenic

agents are suspected to contribute to NPC development including some dietary components and

preservatives (e.g. salted fish and nitrosamines) (Huang et al. 1978; Yu et al. 1986).

The World Health Organization (WHO) has previously categorized NPC into two

different histological types: keratinizing (WHO type I) and non-keratinizing (WHO types 2 and

3) squamous cell carcinomas (Shah and Young 2009). Non-keratinizing squamous carcinomas

can be further subdivided based on their cell differentiation state; namely carcinomas composed

of differentiated or undifferentiated cells are referred to as WHO2 or WHO3, respectively

(Shanmugaratnam 1978). Undifferentiated NPC, which account for approximately 80% of all

NPC cases, have been consistently linked with latent EBV infection since the mid-1960s (Young

and Murray 2003; Shah and Young 2009). In fact, most NPC arise from the monoclonal

proliferation of latent EBV-infected epithelial cells, as determined by analysis of EBV terminal

repeat length. Early serological studies and in situ hybridization were the first to confirm an

association between the EBV virus and NPC (zur Hausen et al. 1970; Henle and Henle 1976). It

is believed that a single EBV-infected progenitor cell continuously divides, undergoing clonal

expansion and develops into a tumour (Raab-Traub and Flynn 1986; Raab-Traub 2002). The

EBV latency II program is associated with NPC such that EBNA1, LMP2A, EBERs, miRNA,

and possibly LMP1 and/or the secreted BARF1 protein are expressed (Brooks et al. 1992; Seto et

al. 2005). However, the individual contribution of each of these factors to NPC development and

progression is not fully known.

I.1.4.2 Gastric Carcinoma

EBV latent infection is associated with approximately ten percent of all gastric carcinoma

cases. Gastric cancer is the fourth most common cancer worldwide and it is indiscriminate of

regional and ethnic differences (Uozaki and Fukayama 2008). The remaining ~90% of GC is

commonly linked to the presence of the pathogen Helicobacter pylori. EBV-infected GC cells

are typically located in the upper middle area of the stomach, whereas H.pylori-associated GC is

usually found in the lower section of the stomach. EBV-associated GC share some common

7

similarities with NPC. First, the gene expression correlating to the EBV latency II program is

typically exhibited in GC-associated tumours such that EBNA1, LMP2A, BARF1, miRNA and

EBERs are all expressed, but unlike in NPC, LMP1 is not expressed (Fukayama et al. 2008;

Fukayama 2010). Second, GC is believed to develop from the monoclonal proliferation of an

EBV-infected gastric epithelial cell.

I.2 EBV Latent Origin of DNA Replication, oriP

In latent infection, EBV genomes replicate once per cell cycle during cellular S phase

using the cellular DNA replication machinery (Yates and Guan 1991; Chaudhuri et al. 2001).

The viral episomes then evenly segregate to the daughter cells during cell division using an ill-

defined mechanism that involves tethering to mitotic host chromosomes, thereby enabling the

maintenance of constant viral genome copy number. One viral protein, EBNA1 (Epstein-Barr

nuclear antigen 1) and the viral DNA sequence, oriP, are the two factors necessary to maintain

EBV genomes at a stable copy number (Yates et al. 1985).

It will soon be approaching three decades since the discovery of oriP, the EBV latent

origin of DNA replication. OriP, a 1.8kbp viral DNA sequence, was identified from a screen of

multiple EBV genome fragments that were tested for their ability to support autonomous

replication and stable maintenance of plasmids in latent EBV-infected human cells (Yates et al.

1984). Provided that EBNA1 is present, plasmids containing the oriP sequence were shown to be

stably maintained in human cells without selection at a loss rate of ~2-5% per cell division

(Yates et al. 1984; Sugden et al. 1985; Yates et al. 1985). Mutational studies on oriP found that

the sequence is composed of two cis-acting elements; the dyad symmetry (DS) element and

family of repeats (FR), each with distinct functions in bidirectional replication initiation, and

episomal maintenance and transactivation, respectively (Reisman et al. 1985; Reisman and

Sugden 1986; Gahn and Schildkraut 1989).

I.2.1 Dyad Symmetry (DS) Element

The DS element, whose name originates from the 65 bp sequence with a dyad symmetry

within it, is a 120 bp sequence that is located nearly 1Kb from the FR and consists of two sets of

two closely paired EBNA1-binding sites (Rawlins et al. 1985; Reisman et al. 1985). In addition

to the DS and FR regions, oriP contains three copies of a 9 bp sequence, known as nonamers,

8

Figure 2. Organization of the EBV latent origin of replication, oriP. OriP is composed of a

family of repeats (FR) element and a dyad symmetry (DS) element, the positions of which are

shown. The FR and DS elements are separated by 960 bp of intervening DNA. The FR element

contains a tandem array of EBNA1 binding sites, indicated by the large black rectangle. The DS

element contains 4 EBNA binding sites (sites 1 to 4 are indicated in black) and three copies of a

nonamer sequence (sites a, b, and c are indicated in grey). The 65 bp dyad is composed of sites 3

and 4, and is indicated by the arrows. (Modified from Frappier 2010)

9

two of which flank either side of the DS element and the third is found within it, between

EBNA1 sites 2 and 3 (Niller et al. 1995). The sequences of these nonamers bear a resemblance to

telomeric repeats and were identified as binding sites for telomeric repeat binding factors 1 and 2

(TRF1 and TRF2, respectively), which are recruited in a cell cycle-dependent manner (Deng et

al. 2002; Deng et al. 2003).The four EBNA1-binding sites are each made up of an imperfect18-

bp palindromic sequence that is constitutively bound by EBNA1 dimers throughout the cell cycle

(Hsieh et al. 1993). Although each pair of EBNA1-binding sites (combination of sites 1+2 or

sites 3+4) within the DS can serve as a minimal plasmid replicator, as determined through

mutational studies, efficient replication from the DS is only attained with both pairs of EBNA1-

binding sites and their flanking nonamer repeats (Yates et al. 2000; Koons et al. 2001). The

spatial organization of the two EBNA1-binding sites within each pair is also critical for origin

function such that even altering the 3 bp that separates sites 1 and 2 or sites 3 and 4 abrogates

DS-mediated replication initiation (Harrison et al. 1994; Bashaw and Yates 2001).

Replication initiation occurs at or near the DS region on oriP-containing plasmids, which are

dependent on the DS, not only for their replication but also for their stable maintenance in human

cells in the presence of EBNA1 (Gahn and Schildkraut 1989; Wysokenski and Yates 1989;

Harrison et al. 1994; Little and Schildkraut 1995; Yates et al. 2000). Unlike oriP plasmids,

replication of the EBV genome does not rely solely on the DS element. In fact, several lines of

evidence using 2D gel electrophoresis and small molecule analysis of replicated DNA (SMARD)

have demonstrated the presence of extensive replication initiation zones that exist outside of oriP

which are used to various degrees in different EBV-positive cancer cell lines (Gahn and

Schildkraut 1989; Little and Schildkraut 1995; Norio and Schildkraut 2001; Norio and

Schildkraut 2004). A typical example is EBV replication within Raji cells where only a small

percentage (>10%) of initiation events take place at or close by the DS (Little and Schildkraut

1995; Norio and Schildkraut 2001; Chau and Lieberman 2004; Norio and Schildkraut 2004).

I.2.2 Family of Repeats (FR) Element

The FR element is comprised of an array of imperfect tandem repeats of a 30 bp DNA

sequence, each of which contains a 12 bp AT-rich sequence as well as the 18 bp palindromic

sequence to which EBNA1 dimers bind (Rawlins et al. 1985; Reisman et al. 1985; Frappier and

O'Donnell 1991). The affinity with which EBNA1 binds to its recognition sites within the DS

10

and FR differ due to minor variations in their respective 18 bp palindromic sequences (Jones et

al. 1989; Ambinder et al. 1990). In fact, EBNA1 exhibits a stronger binding affinity to its

recognition sites within the FR compared to those found in the DS element, even when the

sequences between the sites in the FR are mutated (Jones et al. 1989; Ambinder et al. 1990;

Frappier and O'Donnell 1991).

Despite the fact that the DS and FR elements both contain EBNA1 binding sites, they

play separate roles during EBV latency. Upon EBNA1-binding, the FR directs the segregation of

EBV genomes or oriP plasmids during mitosis and serves as a transcriptional enhancer even in

the absence of the DS (Reisman and Sugden 1986; Kanda et al. 2001; Kapoor et al. 2001). In a

recent study, the FR, and not the DS, was shown to be involved in primary EBV infection,

contributing to EBV establishment and human B-cell transformation (Deutsch et al. 2010). Both

EBNA1 as well as EBV genomes have been shown to associate with cellular metaphase

chromosomes (Harris et al. 1985; Petti et al. 1990). The binding of EBNA1 to the FR element

allows for tethering of viral episomes and FR-containing plasmids to condensed human

chromosomes (often referred to as “piggybacking”) as they both segregate during mitosis

(Krysan et al. 1989; Wu et al. 2000; Kanda et al. 2001; Sears et al. 2004). This function is critical

for the faithful segregation and maintenance of the virus in proliferating cells. Furthermore, in

the presence of EBNA1, the FR facilitates nuclear uptake of oriP plasmids and enables their

stable retention, thereby preventing plasmid loss during cell division (Langle-Rouault et al. 1998;

Sears et al. 2003). Although the FR was initially believed to enhance DS-mediated DNA

replication initiation (Wysokenski and Yates 1989), several studies suggest that it is more

probable that the observed increase in replication efficiency in the presence of the FR is as a

result of better retention of oriP plasmids. Finally, additional 2D gel electrophoresis studies have

shown that EBNA1-binding to the FR creates a significant replication fork impediment and can

serve as a replication termination site, which has recently been implicated in EBV genome

maintenance (Gahn and Schildkraut 1989; Ermakova et al. 1996; Dheekollu et al. 2007).

A decade ago, careful analysis of the length of the FR region found in EBV strains

derived from several lymphoblastoid cell lines and B-lymphocytes using PCR amplification

revealed that the number of 30 bp repeats within the FR varies between EBV strains (Fruscalzo

et al. 2001). Importantly, the characteristic number of repeats found in each strain is strictly

maintained during long-term cell passaging, which suggests that maintenance for the FR repeat

11

length may be crucial for the persistence of each strain of EBV (Fruscalzo et al. 2001). Recent

studies by Ali and his colleagues demonstrated that varying the number of EBNA1 binding sites

via FR repeat number affects FR-associated functions (Ali et al. 2009). The extensively studied

B95-8 EBV strain was found to contain 29 repeats within its FR region. This FR region was

previously thought to contain 20 repeats, as this is the number of repeats present in the oriP

DNA sequence which was originally cloned from the B95-8 strain (Baer et al. 1984; Fruscalzo et

al. 2001). The extra 9 repeats, which are believed to have been deleted during the sub-cloning of

EBV genome fragments into plasmids, contribute 252 bp to the 3’ end of the B95-8 FR region

and potentially form a stem-loop DNA structure (Yates et al. 1984; Fruscalzo et al. 2001).

Relative to the FR containing 20 repeats, the full-length FR (29 repeats) was shown to improve

B-cell transformation, but reduced the FR transactivation function and had no effect on plasmid

replication (Ali et al. 2009). Together, these findings are particularly remarkable given that seven

to nine copies of the 30 bp repeat are sufficient to constitute a fully functional FR element

(Wysokenski and Yates 1989).

I.2.3. Cellular Proteins Recruited to oriP

During latent infection, EBNA1 is the only viral protein that functions in EBV genome

replication. However, EBNA1 is an atypical DNA virus origin-binding protein that lacks DNA

helicase activity and is incapable of unwinding and activating viral origin sequences (Frappier

and O'Donnell 1991). Consequently, EBV is dependent on host cellular replication proteins to

replicate its genomes. Indeed, a collection of studies have found subunits from the cellular origin

recognition complex (ORC) and minichromosome maintenance (MCM) complex to be recruited

to the DS element within oriP and function in a cell cycle-dependent manner (Chaudhuri et al.

2001; Dhar et al. 2001; Schepers et al. 2001).

ORC is an evolutionarily well-conserved complex of six subunits that binds to replication

origins in an ATP-dependent manner and initiates the assembly of replication machinery (Bell

and Dutta 2002). Using chromatin immunoprecipitation (ChIP) assays, human ORC subunits

were detected in regions at or near the DS element in vivo (Chaudhuri et al. 2001; Schepers et al.

2001). However, footprinting assays found no direct interaction between ORC and DNA at oriP

(Nieduszynski 2001). Nevertheless, the requirement for ORC in oriP-mediated replication was

demonstrated using oriP plasmids which failed to replicate in cells carrying a hypomorphic

12

mutation in the ORC2 gene (Dhar et al. 2001). Subsequently, EBNA1 and its association with

oriP were found to be factors necessary for efficient ORC recruitment to the DS element (Julien

et al. 2004). There is in vivo evidence that suggests that ORC recruitment to the DS might be

facilitated by the interaction of EBNA1 with the ORC2 subunit (Dhar et al. 2001). However,

previous findings showed that EBNA1 may not directly interact with ORC2, but may interact

indirectly through G-quartet RNA (Norseen et al. 2008).

The first step in the replication initiation cascade is the association of the ORC complex with

replication origins during the cellular G1 phase, followed by the recruitment of Cdt1, Cdc6, and

the MCM complex to form what is known as the pre-replicative complex (pre-RC) (Bell and

Dutta 2002). The MCM complex is the cellular replicative helicase consisting of six subunits that

function together in unwinding the DNA at a replication fork, enabling subsequent DNA

synthesis (Ishimi 1997; Labib et al. 2001). The MCM complex moves along the DNA just ahead

of the replication fork after initiation and to maintain fork progression (Arias and Walter 2007).

Once dissociated, the Cdt1 interacting protein, Geminin, prevents the MCM complex from being

reloaded at replication origins until the end of mitosis (Arias and Walter 2007). Based on the

following observations, it is also highly likely that the MCM complex serves as the helicase for

EBV genome replication during latency. First, both MCM2 and MCM3 subunits are recruited to

oriP in a cell cycle-regulated manner. Similar to cellular replication origins, these subunits

associate with DNA during G1 and dissociate during S phase (Chaudhuri et al. 2001; Zhou et al.

2005). Second, ectopic expression of Geminin was shown to reduce oriP-mediated replication

and oriP replication function was rescued by Cdt1 overexpression (Dhar et al. 2001). Therefore,

in order to replicate its genome during latency, EBV appears to utilize host cellular replication

machinery through recruitment of the pre-RC complex to its replication origin, oriP, via EBNA1.

To date, there has been a series of findings that demonstrate the involvement of several

cellular factors, in addition to the members of the pre-RC, in oriP-based replication and

segregation. First, the nonamers juxtaposed to the DS element in oriP were shown to increase

oriP replication efficiency through EBNA1-dependent binding of TRF2, which was found to

facilitate the recruitment of the ORC complex to oriP (Atanasiu et al. 2006). TRF2 was recently

found to interact with the DNA damage checkpoint protein and member of the ATM (ataxia-

telangiectasia-mutated) pathway, Chk2. Chk2 is capable of phosphorylating TRF2, which in turn

is necessary for the direct interaction between the ORC1 subunit and TRF2 (Zhou et al. 2010).

13

Using oriP-containing plasmids, Chk2 was shown to be involved in regulating oriP replication

as well as plasmid maintenance, and it was proposed that Chk2 phosphorylation of TRF2 was

important for these functions, (Zhou et al. 2010). Although both TRF1 and TRF2 bind the oriP

nonamer sequences, they have opposing functions. Unlike TRF2, which interacts with ORC and

stimulates replication initiation at the DS element, TRF1 does not interact with ORC and appears

to antagonize TRF2 function, thereby disrupting DS-mediated replication (Deng et al. 2003).

Studies on the temporal regulation of EBV genome replication have shown that replication at

oriP initiates at mid-to-late S phase, which is important for stable maintenance of EBV episomes

(Zhou et al. 2009). This group also demonstrated the importance of TRF2 in the timing of

replication initiation at oriP, such that TRF2 depletion led to both earlier oriP replication and the

instability of EBV genomes. Ultimately, these results contribute to a model where EBNA1

stimulates the association of TRF2 with its nonamer binding sites within the DS, to which ORC

is subsequently recruited, thereby promoting replication initiation at oriP.

EBNA1, which constitutively binds its recognition sites within oriP, is able to hinder the

progression of replication forks through the FR region (Dhar and Schildkraut 1991; Hsieh et al.

1993; Aiyar et al. 2009). It has been suggested that impeding replication fork migration through

the FR is functionally linked to EBV episomal maintenance and copy number (Dhar and

Schildkraut 1991; Aiyar et al. 2009). The evolutionarily conserved human proteins, Timeless

(Tim) and Tipin (Timeless-interacting protein) are involved in preserving the stability of

replication forks once they reach barriers such as repetitive DNA sequences or secondary

structure (Gotter et al. 2007). There have also been studies that suggest that yeast homologues of

these two proteins may play a role in sister chromatid cohesion as well as segregation of

metaphase chromosomes (Mayer et al. 2004; Leman et al. 2010). Very recently, Tim and Tipin

have been shown to be recruited to both the FR and DS elements of oriP in S-phase using ChIP

assays in cell lines latently infected with EBV, including Raji. This localization of Tim and Tipin

was dependent on the expression of EBNA1, which was found to weakly bind Tim during late S-

phase (Dheekollu and Lieberman 2011). Dheekollu and Lieberman found that transient or stable

depletion of Tim from cells, using siRNA and shRNA methods, respectively, resulted in reduced

oriP DNA replication as well as loss of EBV episomes. This study suggested that Tim plays a

role in the EBV life cycle, contributing to stability of replication forks at the EBNA1-bound FR

barrier as well as the EBV episomal maintenance.

14

I.3 Epstein-Barr Nuclear Antigen 1 (EBNA1)

The viral protein EBNA1, as derived from the well-studied B95-8 EBV strain, is

composed of 641 amino acids (aa) (Rickinson and Kieff 2001). Since being identified in 1973,

EBNA1 has been shown to be critical for latent EBV infection. Consistent with this is the fact

that EBNA1 is the sole trans-acting viral protein that is essential for oriP replication and

segregation functions, and it is the only viral factor that is expressed in nearly all forms of EBV

latency and its associated diseases (Yates et al. 1985; Kieff 1996). In addition to the requirement

of EBNA1 for EBV episomal maintenance, it is important for the transcriptional activation of

some of the EBV latency genes (Rickinson and Kieff 2001).

I.3.1 Overview of Domain Structures

EBNA1 is composed of several distinct regions that contribute to its various functions

(Figure 3). The N-terminus of EBNA1 contains the first glycine-arginine (Gly-Arg) rich region

from amino acids 33-53, after which a central glycine-glycine-alanine (Gly-Ala) rich repeat

region is found (aa 90-325). The second Gly-Arg rich region is within the core of EBNA1

between aa 325-376. Lastly, the C-terminus of EBNA1 encodes a nuclear localization signal or

NLS (aa 379-386) as well as its DNA-binding and dimerization domain (aa 459-607).

The precise number of amino acids found in EBNA1 is dependent on the size of its N-

terminal Gly-Ala repeat sequence, which varies amongst different strains of EBV (Baer et al.

1984). This large Gly-Ala repeat has been associated with evasion of host immune response.

These repeats inhibit efficient presentation of EBNA1-derived peptides on MHC Class I proteins

and as a result, circulating cytotoxic T cells cannot detect and target EBNA1 (Blake et al. 1997).

Another mechanism involves inhibiting the generation of defective ribosomal products or DRiPs

of EBNA1. DRiPs are protein fragments produced as a result of incomplete translation and they

are now recognized to be the source of EBNA1 peptides presented on MHC Class I molecules as

opposed to proteasomal degradation products (Yin et al. 2003; Fahraeus 2005; Tellam et al.

2007). Importantly, the deletion of this Gly-Ala region has no effects on EBNA1 replication,

15

Figure 3. EBNA1 functional domains. A schematic representation of the domain structure of

wild-type EBNA1 as well as EBNA1ΔG/A (lacking the large Gly-Ala repeat region), which is

used in the studies discussed in this thesis. The functional elements of interest are indicated. The

regions of EBNA1 that are known to be required (black boxes) or contribute but are not essential

(grey boxes) for its replication, segregation, or transactivation functions are shown here.

(Modified from Frappier 2010).

16

segregation, or transcriptional regulatory functions (Yates et al. 1985; Yates and Camiolo 1988).

Consequently, many laboratories, including ours, use an EBNA1 with the Gly-Ala repeat region

deleted, which maintains all of wild-type EBNA1 functions.

EBNA1 stably binds as a homodimer to its recognition sites within the DS and FR via its

C-terminus between amino acids 459 to 607, constituting its DNA-binding and dimerization

domain (Ambinder et al. 1991; Frappier and O'Donnell 1991; Shah et al. 1992). This DNA-

binding and dimerization domain is responsible for recognizing the 18 bp palindromic sequences

found within the DS and FR elements (Summers et al. 1996). Analysis of crystal structures of

this region of EBNA1 bound and unbound to one of its 18 bp palindromic recognition sequences

reveals the presence of two domains: a core eight-stranded antiparallel β-barrel (aa 504-604) and

a flanking domain (aa 461-503) that is comprised of an α-helix oriented perpendicularly to DNA

(Bochkarev et al. 1995; Bochkarev et al. 1996; Bochkarev et al. 1998). The core β-barrel domain

is not only responsible for EBNA1 homodimerization which is necessary for DNA-binding, but

it also contains four α-helices (one pair per EBNA1 monomer) (Bochkarev et al. 1996). Two

helices, one from each monomer pair, together make sequence-specific contacts and serve to

recognize EBNA1 binding sites; hence, they are referred to as recognition helices (Cruickshank

et al. 2000). The core β-barrel and flanking domains of EBNA1 function together to allow stable

interaction with DNA recognition sequences, such that the core domain makes contacts with the

major groove of the DNA, while the flanking domain simultaneously inserts into the minor

groove (Cruickshank et al. 2000). Not surprisingly, this C-terminal region is fundamental for all

EBNA1-associated functions at oriP. For example, studies by Kirchmaier and Sugden showed

that the EBNA1 C-terminal fragment can out-compete full-length EBNA1 for binding to oriP

plasmids, thus functioning as a dominant-negative inhibitor of EBNA1 (Kirchmaier and Sugden

1997). Interestingly, the EBNA1 DNA-binding and dimerization region was found to be

structurally homologous to the DNA-binding domain of the papillomavirus E2 protein,

regardless of the fact that the two viral protein have little or no sequence homology (Hegde et al.

1992; Edwards et al. 1998). The DNA-binding domain of E2 also contains a recognition helix

that, similar to that of EBNA1, facilitates all of the sequence-specific interactions inherently

associated with the domain (Hegde et al. 1992). Therefore, together the core β-barrel and

flanking domain allow EBNA1 to stably bind and recognize its target sites within oriP.

17

Although the DNA-binding and dimerization domain of EBNA1 is necessary for its

replication function, additional regions of EBNA1 contribute significantly to this activity.

EBNA1 contains two stretches of Gly-Arg repeats (amino acids 33-53 and amino acids 325-376),

found at the N-terminus and in the middle of EBNA1, respectively. To date, the role of the N-

terminal Gly-Arg repeat (aa33-53), which is found between the 8-to-67 region, remains elusive.

However, using an EBNA1 deletion mutant, the 8-to-67 region was found to contribute to

EBNA1-mediated transactivation, segregation, and mitotic attachment functions (Avolio-Hunter

and Frappier 1998; Wu et al. 2002). Amino acids 33-89, which encompass the N-terminal Gly-

Arg repeat, were shown to function cooperatively with the central Gly-Arg repeat (aa325-376) to

bring the DS and FR elements together upon binding by EBNA1, a phenomenon referred to as

DNA looping or linking (Middleton and Sugden 1992; Mackey et al. 1995; Avolio-Hunter and

Frappier 1998). Moreover, both regions 33-89 and 325-376 are necessary for facilitating ORC

recruitment to the DS element (Norseen et al. 2008). Previous mutational studies have shown

that the Gly-Arg-rich region between amino acids 325-376 of EBNA1 is also required for mitotic

chromosome attachment and its segregation function, but this region is dispensable for plasmid

replication (Shire et al. 1999; Wu et al. 2002).

I.3.2 EBNA1 Functions

I.3.2.1 EBNA1 DNA Replication Function

Despite its apparent lack of intrinsic enzymatic activity, EBNA1 facilitates the initiation

of DNA replication at the DS element of oriP. Similar to host cellular chromatin, EBV circular

genomes associate with histones and are assembled into nucleosomal structures (Shaw et al.

1979). Studies from ten years ago elucidated the mechanism by which EBNA1 gains access to its

DNA recognition sequence at oriP by destabilizing the nucleosome structure and effectively

displacing the core histones from the DNA (Avolio-Hunter et al. 2001).

EBNA1 homodimers assemble in a cooperative fashion on neighbouring recognition sites

at the DS such that the nearby dimers interact via their DNA binding and dimerization domains

(Summers et al. 1996). It is thought that cooperative binding of EBNA1 dimers to their

recognition sites in the DS causes unwinding and alterations to the DNA structure (Bochkarev et

al. 1996). Notably, the interaction between an individual recognition site with the DNA binding

and dimerization domain of EBNA1 not only causes local distortion and DNA unwinding, but

18

induces a smooth bend in the DNA, which are also characteristic of an origin-binding protein

(Bochkarev et al. 1996). Consistent with these observations, previous studies have confirmed the

presence of local distortions in DNA upon interaction between EBNA1 with its recognition sites

at the DS using potassium permanganate (KMnO4) sensitivity (Frappier and O'Donnell 1992).

Potassium permanganate oxidizes pyrimidine bases in both single-stranded DNA or distorted

double-stranded DNA (Bui et al. 2003). Essentially, the EBNA1-DS interaction leads to changes

in the DNA structure such that two thymine residues, each from a single EBNA1 binding site,

become exposed and susceptible to permanganate oxidation (Frappier and O'Donnell 1992;

Hsieh et al. 1993; Summers et al. 1997). These studies also predict that similar twisting of the

DNA occurs when EBNA1 binds to its other recognition sites that do not possess a thymine

residue and will therefore, not display sensitivity to potassium permanganate.

Studies by Frappier and O’Donnell (Frappier and O'Donnell 1991) made use of electron

microscopy to visualize EBNA1-oriP interactions and demonstrated the formation of looped

DNA structures upon binding of EBNA1 to the oriP sequence. Importantly, the FR and DS

elements were specifically brought into close proximity through interactions between EBNA1

complexes at both sites. If more than one oriP molecule is present, the respective EBNA1

complexes can interact and create a bridge between the DNA molecules, whereas interactions

between EBNA1 complexes at the DS and FR elements on one oriP molecule can effectively

loop out the intervening DNA (Frappier and O'Donnell 1991; Su et al. 1991; Middleton and

Sugden 1992). Both modes of interactions have been shown to be mediated by residues 327-377

and 40-89 of EBNA1 and together they stabilize binding of EBNA1 at oriP, which allows for

assembly of host replication machinery at the DS element (Su et al. 1991; Frappier et al. 1994;

Avolio-Hunter and Frappier 1998). Due to the fact that these two regions are associated with

EBNA1 DNA replication, segregation, and transcriptional activation functions, it is possible that

the looping out and cross-linking of DNA by EBNA1 may be functionally important (Mackey

and Sugden 1999; Shire et al. 1999).

It is believed that a combination of both nucleosome disruption and distortion of DNA at

oriP by EBNA1 enables it to facilitate replication initiation by the cellular machinery. Consistent

with this hypothesis, replication protein A (RPA), which binds, coats, and stabilizes single-

stranded DNA, has been shown to interact with EBNA1 and be recruited by EBNA1 to oriP,

which suggests an early role for RPA in replication initiation at the DS (Zhang et al. 1998).

19

Moreover, modifications of EBNA1 appear to play a role in modulating its DNA replication

function. Poly(ADP-ribose) polymerase 1(PARP1) is a highly abundant, NAD-dependent

enzyme that is involved with a variety of cellular processes including DNA repair and apoptosis

(Krishnakumar and Kraus 2010). PARP1 is a chromatin-associated enzyme that catalyzes the

covalent attachment of ADP-ribose polymers (PAR) to protein substrates which can modulate

their respective functions and activities (Krishnakumar and Kraus 2010). Other member of the

PARP family is the telomere-associated poly(ADP-ribose) polymerase 1 and 2 (TNKS1 and

TNKS2), which have not only been shown to associate with telomere repeat sequences, but also

EBNA1 and both the DS and FR elements of oriP (Deng et al. 2002; Deng et al. 2005).

Recruitment of PARP1 and TNKS1 to the oriP region was shown to be dependent on EBNA1

(Deng et al. 2002; Deng et al. 2005; Tempera et al. 2010). EBNA1 has been shown to be a

substrate of PARP1 and TNKS1 and is subject to PARylation by both proteins, which negatively

regulates EBNA1 replication function (Deng et al. 2005; Tempera et al. 2010). An enhancement

of oriP-mediated replication activity was observed upon small hairpin RNA (shRNA) targeted

depletion of either TNKS1 or PARP1, which suggests that both proteins serve to inhibit oriP

replication in a PARylation (of EBNA1) -dependent manner (Deng et al. 2005; Tempera et al.

2010). Moreover, an increase in association of ORC2, EBNA1, MCM3 at oriP was observed

when PARP1 was silenced by targeted shRNA or functionally inhibited using pharmacological

agents (Tempera et al. 2010). Finally, these studies suggest that there may be DNA structural

changes at the DS element which are caused by PARylation of EBNA1 and decrease its binding

affinity for its recognition sites and reduce ORC recruitment to oriP (Deng et al. 2005; Tempera

et al. 2010).

TAFIβ, part of the NAP family of nucleosome assembly proteins, was found to interact

with EBNA1 through affinity chromatography and to localize to both the DS and FR elements of

oriP in an EBNA1-dependent manner by ChIP analysis (Holowaty et al. 2003; Wang and

Frappier 2009). Wang and Frappier not only showed that TAFIβ was important for EBNA1

transactivation function, but demonstrated a role for TAFIβ in suppressing EBNA1-mediated

DNA replication from the DS element of oriP (Wang and Frappier 2009). Therefore, these

studies indicate that the interaction of TAFIβ with EBNA1 on DS negatively regulates

replication from the DS.

20

I.3.2.2 EBNA1 DNA Segregation Function

Maintaining latent EBV infection in proliferating cells is due to EBNA1-facilitated

replication of the viral genome and its ability to efficiently segregate the viral episome to each

daughter cell during cell division in order to maintain a stable copy number of EBV episomes.

The EBV genome does not contain a centromeric sequence; therefore, segregation of the viral

episome is unlike the mechanism used by host chromosomes. Segregation of EBV genomes

requires only two viral factors: the trans-acting EBNA1 protein and the cis-acting FR element of

oriP (Lupton and Levine 1985; Krysan et al. 1989). Consistent with this, the introduction of the

FR element into plasmids that contain heterologous replication origin sequences ensures their

stability, although not indefinitely, in human or yeast cells expressing EBNA1 (Krysan et al.

1989; Simpson et al. 1996; Kapoor et al. 2001).

I.3.2.2.1 EBNA1 Domains Contributing to Plasmid Segregation

The most widely-accepted model to explain EBV faithful transmittance in host cells is

the mitotic tethering model. This model proposes that FR-bound EBNA1 tethers EBV episomes

to condensed cellular chromosomes to allow their equal partitioning when sister chromatids

separate to daughter cells at the end of mitosis. Whereas, binding of EBNA1 dimers to the FR

element within the EBV episome is mediated through its C-terminal DNA-binding and

dimerization domain, attachment of EBNA1 to mitotic chromosomes involves sequences in the

central and N-terminal regions. By fusing N-terminal EBNA1 peptides to green fluorescent

protein (GFP), three regions of EBNA1 (aa 8-54, 72-84, 328-368) were found that can

independently interact with metaphase chromosomes (Marechal et al. 1999). Similarly, using

GFP-tagged EBNA1 fragments, another group found that amino acids 1-89 and 323-386 of

EBNA1 each demonstrated a weak association with mitotic chromosomes, but, collectively, a

more robust interaction was observed with an EBNA1 peptide encompassing both regions (Hung

et al. 2001). Subsequent studies using deletions of the aforementioned regions in the context of

full-length EBNA1 showed that amino acids 325-376 have a key role in EBNA1’s segregation

function by contributing significantly to its chromosomal attachment (Wu et al. 2000; Nayyar et

al. 2009). This was demonstrated by analyzing the oriP plasmid maintenance ability in human

and yeast cells and mitotic chromosomal attachment of the EBNA1Δ325-376 mutant which was

defect in both capacities but still retained its DNA replication activity (Shire et al. 1999; Wu et

21

al. 2000; Wu et al. 2002). These studies provided clear evidence that the replication and

segregation functions of EBNA1 are distinctive and separable.

Comparing the oriP plasmid maintenance ability of wild-type EBNA1 and its deletion

mutant EBNA1Δ8-67 showed that this region (aa 8-67) may contribute to the binding of EBNA1

to cellular mitotic chromosomes. The EBNA1Δ8-67 mutant was shown to interact with

metaphase chromosomes less well than wild-type as shown by immunofluorescence staining, and

a four-fold decrease in the maintenance of the oriP plasmid was observed with the mutant (Wu et

al. 2002). The specific residues between amino acids 8-67 that are involved in EBNA1’s

chromosomal attachment and segregation function have not yet been defined, although deletion

of the Gly-Arg repeat found between amino acids 33-53 did not affect plasmid maintenance,

therefore, this sequence is not important for chromosome attachment or segregation (Wu et al.

2002).

I.3.2.2.2 Involvement of EBP2 in EBNA1-Mediated Plasmid Segregation

A yeast two-hybrid screen previously identified the EBNA1-interactor, human EBNA1-

binding protein 2 (hEBP2), which was shown through a reconstituted Saccharomyces cervisiae

system to support EBNA1-mediated plasmid partitioning and attachment of EBNA1 to mitotic

chromosomes (Shire et al. 1999; Kapoor et al. 2001; Kapoor and Frappier 2003). Importantly,

the hEBP2-EBNA1 interaction involves the region between amino acids 325-376 and 8-67 of

EBNA1 and abrogation of this interaction in the yeast system led to decreases in EBNA1 mitotic

attachment and partitioning of oriP plasmids (Shire et al. 1999; Nayyar et al. 2009). Our

laboratory has also demonstrated that EBNA1 is subject to serine phosphorylation in vivo

between amino acids 325-376. Using serine-to-alanine substitutions and aspartic acid residues

that mimic phosphorylation, phosphorylation of serine residues within this region was shown to

influence EBNA1-hEBP2 interactions in yeast to affect the segregation function of EBNA1 in

both yeast and mammalian cells (Shire et al. 2006). In addition, the importance of EBP2 for

EBNA1 attachments to mitotic chromosomes was confirmed in human cells. Specifically, EBP2

silencing in human cell lines led to release of both EBNA1 and oriP plasmids from metaphase

chromosomes into the soluble cell fraction (Kapoor et al. 2005)

By immunofluorescence microscopy, EBNA1 associates with metaphase chromosomes

ahead of EBP2 and their subsequent interaction occurs within the second half of mitosis (Nayyar

22

et al. 2009). This may tie in with the observations of Sears et al. which suggest that EBNA1 can

associate with metaphase chromosomes independent of EBP2 (Sears et al. 2004). This group

focused on the Gly-Arg repeats between 33-53 and 325-376 and drew a parallel between these

repeats and the AT-hooks found in cellular proteins and associate with AT-rich DNA sequences.

They demonstrated that the EBNA1 Gly-Arg repeats are capable of binding AT-rich DNA in

vitro (Sears et al. 2004). Interestingly, when the N-terminus of EBNA1 is substituted with the

cellular protein HMG1a, this fusion protein still maintains plasmid replication and segregation

abilities with efficiencies that are comparable to that of wild-type EBNA1 (Hung et al. 2001;

Sears et al. 2003). Moreover, the HMG1a protein utilizes its Gly-Arg repeats, which are also

referred to as AT-hooks, to associate with cellular chromosomes (Aravind and Landsman 1998).

Therefore, although EBP2 is required for stability of the attachment of EBNA1 at mitotic

chromosomes, EBNA1 may also possess its own chromosome-binding activity which contributes

to the strength of the interaction.

I.3.2.2.3 The Mitotic Tethering or “Piggybacking” Model

Grogan et al. were the first group whose findings alluded to the ability of EBV episomes

to piggyback onto host cellular chromosomes during mitosis, ensuring their stable transmission

to both daughter cells during cell division (Grogan et al. 1983). Their immunofluorescence

microscopy studies in EBV-positive Raji cells illustrated the localization of EBNA1 to

condensed mitotic chromosomes (Grogan et al. 1983). Additional fluorescence in situ

hybridization (FISH) experiments demonstrated the association of EBV episomes with cellular

metaphase chromosomes in Burkitt’s lymphoma cell lines (Harris et al. 1985). Moreover, this

association of EBV episomes was shown to be dependent on EBNA1, as it is the only latent viral

protein with this mitotic chromosome-binding activity (Petti et al. 1990).

Soon after, EBV-based plasmids such as the oriP plasmid were used to help elucidate the

mechanism by which the EBV episome-metaphase chromosome interaction occurs. Similar to

EBV episomes, oriP plasmids were shown to localize to host chromosomes and this association

was dependent on EBNA1 expression as well as interactions between EBNA1 and oriP

(Simpson et al. 1996; Kanda et al. 2001). Specifically, the FR element of oriP (on a plasmid) is

sufficient to mediate its chromosomal attachment and stable segregation during cell division

(Krysan et al. 1989; Kanda et al. 2001). Moreover, the interaction between EBNA1 and

23

condensed mitotic chromosomes is indispensable for oriP plasmid segregation, as the

EBNA1Δ325-376 mutant, which is nuclear but unable to bind mitotic chromosomes, could not

partition oriP plasmids (Shire et al. 1999; Wu et al. 2000; Hung et al. 2001). Finally, by

substituting the this region of EBNA1 with the chromosome-binding sequences of high-mobility-

group-I (HMG-1) or histone H1, Hung et al. demonstrated that region 325-376 of EBNA1 was

sufficient and essential for EBNA1 mitotic chromosomal attachment and EBNA1-mediated oriP

plasmid maintenance (Hung et al. 2001). The stable maintenance of oriP-containing plasmids

requires a combination of both their replication and segregation during cell division.

The mitotic tethering or “piggybacking” model may be a common mechanism utilized by

other double-stranded DNA viruses that exist in low copy numbers in infected cells. For

example, only other identified human gamma herpesvirus, Kaposis sarcoma associated

herpesvirus (KSHV) as well as bovine papillomavirus (BPV) also appear to use the same

partitioning mechanism whereby their extrachromosomal, circular genomes attach to cellular

chromosomes and are evenly segregated to daughter cells. LANA1 and E2, which are trans-

acting viral origin binding proteins structurally homologous to EBNA1 for KSHV and BPV,

respectively, have also been shown to tether viral genomes to host mitotic chromosomes

(Lehman and Botchan 1998; Ballestas et al. 1999; Cotter and Robertson 1999; Ilves et al. 1999;

Barbera et al. 2004; Silla et al. 2005). Similar to EBNA1, both LANA and E2 tethering activities

have been shown to be facilitated by interactions with cellular proteins (Cotter and Robertson

1999; You et al. 2004; Barbera et al. 2006; You et al. 2006).

I.3.2.2.4 Equal Partitioning of EBV Episomes to Daughter Cells Following Mitosis

EBV episomes, ranging from 5 to 200 in number, persist stably at a constant copy

number in several latent EBV-infected cell lines (Sternas et al. 1990; Kieff 1996). Maintaining a

constant copy number of EBV episomes and oriP plasmids throughout several cell divisions

requires a system that ensures their equal distribution between daughter cells during cell division.

Utilizing a random mechanism for EBV genome partitioning in infected cells would likely be

inefficient for the virus, which is stably maintained throughout the lifetime of its human host.

Past observations by Harris et al. using FISH demonstrated a stochastic association of oriP

plasmids with cellular mitotic chromosomes, such that the plasmids did not localize to specific

areas on the chromosomes (e.g. centromeric or telomeric regions) (Harris et al. 1985). Although

24

oriP plasmids and EBV episomes do not appear to be targeted to any identifiable chromosomal

regions, FISH studies in Burkitt’s lymphoma cells have shown that signals corresponding to

EBV episomes were symmetrically localized on sister chromatids (Delecluse et al. 1993).

Consistent with this finding, by combining FISH and immunofluorescence techniques Kanda et

al. showed that EBNA1 localized with oriP plasmids and both, together, were found

symmetrically distributed on the surfaces of sister chromatids during mitosis (Kanda et al. 2007).

Close examination revealed paired EBNA1 dots in G2 phase that appear as a result of

concatenated oriP plasmids, which are formed upon replication of circular DNA molecules and

are eventually disconnected by topoisomerase II, as confirmed using a targeted inhibitor (Kanda

et al. 2007). Accordingly, this group proposed an association between the utilization of

catenation as a means to pair replicated plasmids and their equal partitioning during cell division.

I.3.2.3 EBNA1 Transcriptional Regulation Function

In addition to its functions in DNA replication and segregation, EBNA1 can activate the

transcription of some EBV latency genes and autoregulate its own expression. Early studies

demonstrated that in the presence of EBNA1, the FR element increased the expression of

reporter genes when placed upstream or downstream of the promoter, which suggested that the

FR element can serve as an enhancer element (Lupton and Levine 1985; Reisman and Sugden

1986). Studies performed by Wysokenski and Yates subsequently showed that only 6-7 EBNA1

recognition sites within the FR region were necessary for the transcriptional enhancer function of

the FR element (Wysokenski and Yates 1989).

When bound to the FR element of oriP, EBNA1 can activate transcription from the EBV

Cp and Wp promoters, from which all viral nuclear antigen (EBNA) genes, including the

EBNA1 gene, are transcribed (Sugden and Warren 1989; Gahn and Sugden 1995). EBNA1 was

also found to activate transcription from latent promoters that regulate expression of the viral

LMP1 protein, which is essential for EBV-mediated B cell transformation (Gahn and Sugden

1995; Kieff 1996). Besides its C-terminal DNA-binding and dimerization domain, two other

regions of EBNA1, amino acids 61-83 and 325-376, have been shown to be responsible for its

transcriptional activation function (Mackey and Sugden 1999; Ceccarelli and Frappier 2000; Wu

et al. 2002; Kennedy and Sugden 2003). While the EBNA1Δ61-83 mutant was found to be

defective in transcription regulation, it still maintained the DNA replication and segregation

25

functions, showing that EBNA1-mediated transcription is distinct from its other functions (Wu et

al. 2002). Further analysis for the 325-376 transcriptional activation region showed that four

serine-to-aspartate substitutions abolished the transcriptional activation function of EBNA1. This

mutational analysis not only provided evidence that sequences other than the Gly-Arg stretches

in this region were important for EBNA1-mediated transcription, but also showed the potential

for regulation of this function by phosphorylation of the four serine residues (Shire et al. 2006).

Not only does EBNA1 regulate expression of the other five EBNA proteins, it also

regulates its own expression. During latency III phase of EBV infection, expression of all six

EBNAs is dependent on regulation at the Cp promoter (Rogers et al. 1990; Woisetschlaeger et al.

1990; Altmann et al. 2006), however, the Qp promoter is solely responsible for EBNA1

expression throughout latencies I and II, during which the other five EBNAs are not expressed

(Schaefer et al. 1995). This repression is mediated by binding of EBNA1 to its two recognition

sites downstream of the Qp promoter for which EBNA1 has a lower affinity compared to the

sites found in the DS and FR elements of oriP (Ambinder et al. 1990; Sample et al. 1992). It is

possible that this may serve as an autoregulatory mechanism such that when EBNA1 levels

exceed a threshold and the EBNA1-binding sites within DS and FR elements are saturated,

EBNA1 will then bind its recognition sites near the Qp promoter to inhibit its own expression in

latencies I and II. Recent findings by Yoshioka et al. (Yoshioka et al. 2008) have suggested that

EBNA1-mediated repression at the Qp promoter does not occur by direct inhibition as formerly

understood, but rather by post- or co-transcriptionally inhibiting processing of pre-mRNA

transcripts.

Several cellular proteins might contribute to the transcriptional activation function of

EBNA1. Many cellular proteins including the mitochondrial protein P32/TAP, NAP1, and

TAF1β, have been shown to interact with the 325-376 transcriptional activation region of

EBNA1 (Holowaty et al. 2003). P32/TAP possesses a C-terminal transcriptional activation

domain which not only associates with the transcription factor TFIIB, but also mediates its

interactions with EBNA1 (Yu et al. 1995; Wang et al. 1997). P32/TAP is known to interact with

residues 40-60 and 325-376 of EBNA1 (Wang et al. 1997), and also has been shown to localize

to the EBV oriP region in vivo (Van Scoy et al. 2000). Therefore, P32/TAP has been implicated

in playing a role in EBNA1-mediated transcriptional activation and latent replication of the EBV

genome. NAP1 is a highly conserved nucleosome assembly protein that is well-known for its

26

involvement in viral transcription, specifically for the bovine papillomavirus and more recently,

for EBV. Previous studies have shown that binding of NAP1 to the bovine papillomavirus

protein E2, which is a functional homologue of EBNA1, increases its transcriptional activity

(Rehtanz et al. 2004). More recently, NAP1 has been shown using reporter assays and RNA

interference, as well as ChIP to be important for EBNA1-mediated transactivation and to localize

to the FR element of oriP, respectively (Wang and Frappier 2009). Bromodomain protein 4

(Brd4) has been previously implicated in E2-mediated transcriptional activation of bovine

papillomavirus (BPV) (You et al. 2004; McPhillips et al. 2006). Our laboratory has previously

found that Brd4 can interact with region 61-83 of EBNA1, which is responsible for the

transcriptional activation function of EBNA1 (Lin et al. 2008). Brd4 was also shown to be

preferentially localized to the FR transcriptional enhancer element in EBV genomes (Lin et al.

2008). In addition, both depletion and overexpression of Brd4 was shown to inhibit the

transcriptional activation activity of EBNA1 via the FR enhancer element (Lin et al. 2008). This

is thought to be a result of disrupting ternary complex formation, and it also demonstrates a role

for Brd4 in EBNA1-mediated transcriptional activation (Lin et al. 2008).

I.3.2.4 EBNA1: Roles in Cell Transformation and Immortalization

During latent infection, the controlled expression of a limited set of latent viral genes

enables EBV to immortalize its host cell, which in turn can initiate the development of lymphoid

and epithelial tumours (Rickinson and Kieff 1996). Multiple lines of evidence have led to the

hypothesis that EBNA1 is an important factor involved in the transformation and

immortalization EBV-infected cell. However, uncovering whether EBNA1 contributes directly

to these events has proven to be challenging due to its required expression for EBV genome

maintenance in proliferating cells.

EBNA1 is the sole viral protein that is expressed in all EBV-associated tumours and all

EBV latency states in proliferating cells (Kieff and Rickinson 2001; Frappier 2010), raising the

possibility that it is involved in the proliferation of EBV-infected cells. Wilson et al. provided

supporting evidence by showing that expression of EBNA1 in the B-cells of transgenic mice

lines stimulates cell proliferation and increases the incidence of developing B-cell lymphomas

(Wilson et al. 1996). However, this finding was questioned by Kang et al. in three studies where

they showed that EBNA1 expression in B-cells of transgenic mice did not increased tumour

27

incidence and cell survival (Kang et al. 2001; Kang et al. 2005; Kang et al. 2008). Years later,

another study showed that expression of a dominant negative version of EBNA1 in a Burkitt’s

lymphoma cell line increased apoptosis (Kennedy et al. 2003). Consistent with a potential

oncogenic role for EBNA1, a reduction in cell proliferation was observed in Raji Burkitt’s

lymphoma and nasopharyngeal carcinoma cells when EBNA1 expression was diminished using

RNA interference (Hong et al. 2006; Yin and Flemington 2006). Moreover, determining the

precise role of EBV infection and the contribution to the expressed latent genes including

EBNA1 to the pathogenesis of gastric carcinoma (GC) and nasopharyngeal carcinoma (NPC) has

yet to be fully resolved. However, studies in our laboratory have recently provided some insight

into this by examining the role of EBNA1 in the development of GC by comparing the EBV- and

EBNA1-negative parental GC cell line with its two derivatives that are either EBV-positive or

EBNA1-positive. In the both the EBNA1- and EBV-positive GC cell lines, EBNA1 was found to

disrupt promyelocytic leukemia (PML) nuclear bodies, which are known to have functions in

p53 activation, tumour suppression, and apoptosis (Sivachandran et al. 2011). As a result, a

decrease in p53 activation and DNA damage-induced apoptosis were observed in the presence of

EBNA1, which provided evidence for its role in promoting cell survival and contributing to GC

development (Sivachandran et al. 2011). Importantly, the contribution of EBNA1 to PML loss

was confirmed in GC, where EBV-positive GC biopsies were shown to have less PML staining

than EBV-negative biopsies (Sivachandran et al. 2011).

Other EBNA1-mediated changes to the cellular environment which may be conducive for

increased cell proliferation and survival have also been reported. Studies in our laboratory have

demonstrated specific interactions between EBNA1 and ubiquitin specific protease 7 (USP7), as

well as casein kinase 2 (CK2) (Holowaty et al. 2003; Holowaty et al. 2003), mediated by amino

acids 395-450 and 387-394 of EBNA1, respectively (Holowaty et al. 2003; Sivachandran et al.

2010). USP7 is well-known for its key role in regulating apoptosis upon cellular stress through

binding, deubiquitinating, and as a result, stabilizing the tumour suppressor protein p53, whose

levels accumulate and induce cellular apoptosis and cell cycle arrest (Li et al. 2002; Cummins et

al. 2004; Cummins and Vogelstein 2004; Li et al. 2004). Saridakis et al. found that EBNA1

encourages cell survival through its ability to tightly associate with USP7 with an affinity ten-

fold greater than that of p53, thereby effectively out-competing p53 for binding to USP7, which

in turn results in destabilization and proteasomal degradation of p53 (Saridakis et al. 2005).

28

Consequently, with the p53-dependent apoptosis inhibited through destabilization of the protein,

increased cell survival and decreased sensitivity to DNA damage were observed in cells

expressing EBNA1 (Saridakis et al. 2005; Sivachandran et al. 2008). EBNA1 has been shown to

localize to promyelocytic leukemia (PML) nuclear bodies (NBs) during native EBV latent

infection in both NPC and GC cell lines and disrupt the foci by facilitating the proteasomal

degradation of PML protein (Sivachandran et al. 2010; Sivachandran et al. 2011). This activity is

dependent on both USP7 and CK2, which have been shown to negatively regulate PML nuclear

bodies. Previous studies have demonstrated localization of CK2 to PML nuclear bodies, where it

phosphorylates PML protein, targeting it for degradation, an activity that is taken advantage of

by EBNA1 (Scaglioni et al. 2006; Sivachandran et al. 2010). As discussed above, EBNA1-

mediated disruption of PML nuclear bodies negatively affects PML-associated functions

including p53 activation and apoptosis, which promotes cell survival following treatment with a

DNA damaging agent (Sivachandran et al. 2011).

Another mechanism employed by EBNA1 to alter the cellular environment involves

increasing the expression of STAT1 and decreasing TGFβ-mediated transcription (Wood et al.

2007). STAT1 responds to interferon-γ (IFN-γ) stimulation and activates transcription of sets of

genes involved in several cellular processes including immune regulation (Najjar and Fagard

2010). Associations have been made between constitutive activation of STAT pathway family

members and hematopoietic diseases (Najjar and Fagard 2010). Furthermore, activation of the

TGFβ signalling cascade is important for determining the fate of a cell, by playing a role in the

control of cell growth and differentiation (Inman 2011). Therefore, EBNA1 may affect the

function of key players in major cellular processes to promote an environment that is favourable

for persistent latent EBV infection.

I.4 Roles of Promyelocytic Leukemia (PML) Bodies in Viral Replication

Promyelocytic leukemia (PML) protein is recognized as a cellular tumour suppressor that

forms PML nuclear bodies (NBs). Consequently, the depletion of PML protein leads to

disruption and dispersal of the nuclear bodies as well as other cellular factors that associate with

these structures or foci. PML nuclear bodies are involved in diverse and important cellular

processes including apoptosis, antiviral response, transcription, and DNA damage repair (Everett

2001; Dellaire and Bazett-Jones 2004; Everett et al. 2006; Bernardi and Pandolfi 2007; Everett

29

and Chelbi-Alix 2007). In fact, the loss of PML or PML function is associated with several

cancers including acute promyelocytic leukemia (from which its name originates) where a

chromosomal translocation event generates a fusion protein that combines PML with the retinoic

acid receptor α and does not retain any PML-associated functions (Di Croce 2005). In the

interest of my thesis, I will briefly discuss some previous reports of the involvement of PML in

the replication of viruses.

Upon detection of a viral infection, the host cell elicits an interferon (IFN) response,

whereby IFN-regulated cellular effector proteins, such as PML, are upregulated and mediate

antiviral activities. Studies have provided evidence for a PML role in restricting lytic viral

replication by using PML-knockout mice and PML-depletion using siRNA in human cells

(Djavani et al. 2001; Blondel et al. 2002; Crowder et al. 2005). PML-knockout mouse embryonic

fibroblasts (MEFs) were found to be not only sensitive to infection with rabies virus (Blondel et

al. 2002), but could better support replication of the lymphocytic choriomeningitis virus (LCMV)

as compared to PML-positive fibroblasts (Djavani et al. 2001). In addition, PML suppresses

herpes simplex virus 1 (HSV-1) lytic infection but is overcome by the HSV ICP0 protein,

allowing replication to proceed (Everett et al. 2006). Moreover, using live cell imaging of HSV-1

infection, Everett et al. demonstrated the relocalization of PML NBs toward HSV-1 viral

genomes as they enter the host nucleus (Everett and Murray 2005). In addition, PML NBs have

been shown to associate with and sequester the nucleocapsids of the varicella zoster virus (VZV)

in different cell types (Reichelt et al. 2011).

While PML is usually suppressive for viral replication, there is some evidence that it can

also play a positive role in the replication of some viral DNA. For example, the SV40 virus is

well-known for initiating replication of its genome at sub-nuclear sites within close proximity to

fully functional PML NBs (Ishov and Maul 1996; Tang et al. 2000). Recent studies by Boichuk

et al. have demonstrated that depletion of PML protein by siRNA reduces the in vivo replication

efficiency of SV40 viral genomes in COS-1 monkey kidney cells and human U2OS cells

(Boichuk et al. 2011). Therefore PML can play diverse roles in viral replication.

As mentioned above, our laboratory has shown that EBV EBNA1 protein interacts with

and disrupts PML NBs in latent infection, thereby increasing cell survival and possibly

contributing to tumourigenesis. Consistent with results for other herpesviruses, our laboratory

has recently found that PML has a repressive function in EBV reactivation and lytic DNA

30

replication (Sivachandran et al. 2011 submitted). However, whether or not PML plays a role in

the latent replication of EBV genomes has not yet been explored.

I.5 EBV Genome Maintenance in Nasopharyngeal Carcinoma

The basis for the differential maintenance of the EBV genome within B-lymphocytes and

NPC cell lines has remained elusive for years. Unlike EBV-infected lymphoblastoid cell lines

(LCLs) which experience minimal loss of the virus, undifferentiated NPC cannot stably maintain

the EBV genome in long-term culture (Knox et al 1995, refs). For example, well-used NPC cell

lines such as CNE-1 and CNE-2 (also known as CNE2Z) were initially EBV-positive biopsies

obtained from Chinese patients, however, each of these three cell lines eventually lost the virus

in culture (Sun et al. 1992). Moreover, in the absence of drug selection, the EBV genome is

rapidly lost from epithelial cells infected with the virus in vitro. Until recently, the mechanism by

which the EBV episomes are lost in NPC cell lines has been poorly understood. Dittmer et al.

have shed some light on this topic using the EBV-positive NPC cell line HONE-1 and shown

that loss of the EBV episome occurs in two successive and discrete phases (Dittmer et al. 2008).

The primary phase involves rapid loss of the complete EBV genome from a large subset of cells:

up to 25% of the infected cell population (Dittmer et al. 2008). The reason and mechanism by

which the EBV genome is lost in this initial phase has yet to be deciphered. Subsequently, in the

second phase the EBV genome undergoes various recombination and deletion events that

eventually impair the crucial functions of oriP, EBNA1 and the Qp promoter, thereby disrupting

the maintenance of the EBV genome (Dittmer et al. 2008).

Finally, recent studies have shown that providing a cellular environment that is

permissive to EBV genome amplification may be important for long-term EBV maintenance in

culture (Shannon-Lowe et al. 2009). By comparing B-lymphocytes to NPC and AGS cell lines,

this group demonstrated that the EBV genome could amplify in both B-cells and AGS cells after

infection and EBV-positive cells from both cell lines expressed EBNA1 and stably maintained

the viral genome; however, this was not observed in NPC cells (Shannon-Lowe et al. 2009). The

authors proposed these observations may be attributed to differences in cell lineages as well as

the environmental conditions found within each of the three cell lines (Shannon-Lowe et al.

2009). C666-1 is the only NPC cell line that consistently maintains the EBV virus in tissue

culture without selection (Cheung et al. 1999). It is likely that these cells remain EBV-positive

31

due to inherent differences between all other NPC cell lines with respect to their

microenvironment, expression of cellular factors, and any accumulated chromosomal mutations.

I.6 Thesis Rationale

All undifferentiated NPC biopsies test positive for the presence of the EBV virus, however

with the exception of the C666-1 cell line, these cells cannot maintain the EBV genomes when grown

in tissue culture. Mitotic chromosome attachment and segregation of the EBV episome and oriP-

containing plasmids requires binding of EBNA1 to recognition sites within the FR region of the oriP

sequence. Our laboratory has previously identified which regions of EBNA1 are involved in its

segregation function, but interpreting their roles is complicated by the fact that EBNA1 is also

required for the replication of the oriP plasmids being monitored. Using the autonomously

replicating pBFRGC6 plasmid, I sought to more directly examine the contribution of

EBNA1sequences to segregation. In addition, studies in our laboratory have shown that higher levels

of EBNA1 cause the viral-based plasmid, oriPE, which contains the oriP sequence, to be lost more

rapidly from both CNE2Z (EBV-negative) and C666-1 cells, the latter of which endogenously

expresses low levels of EBNA1. Since plasmid and episomal maintenance requires a combination of

replication and mitotic segregation both of which are mediated by EBNA1, one of the objectives of

my research was to determine whether this reduction in oriP plasmid maintenance was due to effects

on replication, segregation, or cell proliferation/viability. Using plasmid replication assays as well as

cell proliferation assays, I found that higher levels of EBNA1 are not inhibitory to oriP plasmid

replication and do not affect the growth rate of treated cells, suggesting that the higher EBNA1 levels

were negatively impacting segregation. In addition, I investigated whether or not higher EBNA1

levels might also reduce EBV episomal maintenance (as seen with oriP plasmids). I found no

significant changes to the EBV episomal copy number within the EBV-positive epithelial cell lines,

C666-1 and AGS/EBV.

Another objective was to determine whether increasing the number of repeats in the FR

from 20 to 29 affected EBNA1-mediated replication and segregation. Ali et al. (Ali et al. 2009)

has recently cloned the full-length FR region from the EBV-positive cell line, B95-8, which contains

29 repeats in contrast to the 20 repeats encoded in the oriP plasmids commonly used. I found the

extra 9 repeats reduced plasmid replication efficiency, but improved long-term plasmid maintenance.

Finally, our laboratory has found that PML bodies have a repressive function in EBV lytic

replication; however, whether or not PML has a function in latent replication is not known. By

32

comparing PML-positive and –negative cell lines, I have examined whether the presence of PML

has any effect on plasmid replication and found that PML positively contributes to plasmid

replication in the NPC cell line, CNE2Z. Together my findings have helped to improve our

understanding of EBNA1 replication and segregation functions in NPC cells.

33

CHAPTER II: MATERIALS AND METHODS

II.1 Cell Culture

CNE2Z is an EBV-negative nasopharyngeal carcinoma cell line, derived from an NPC

that lost the EBV episome in culture (Sun et al. 1992). CNE2ZE is a stable cell line derived from

CNE2Z cells and contain an integrated EBNA1 expression cassette fused to a hygromycin B-

resistance gene. CNE2ZE cells stably express low levels of EBNAΔG/A (Sivachandran et al.

2008). CNE2Z-shPML is a stable cell line that was depleted of PML protein using a shRNA-

lentivirus (Sarkari et al. 2011). C666-1 is an EBV-positive nasopharyngeal carcinoma cell line

described elsewhere (Cheung et al. 1999). CNE2Z, CNE2ZE, and CNE2Z-shPML cell lines were

all maintained in alpha-minimal essential medium (α-MEM), whereas C666-1 cells were grown

in RPMI 1640 (Sigma). In all cases, the media were supplemented with 10% fetal bovine serum

(FBS) (GIBCO) and 1% L-Glutamine (L-Q) (GIBCO) and cells were incubated at 37°C. For

CNE2E cells, 0.5 mg of hygromycin B was included per mL of medium.

II.2 Plasmid Constructs

The pBFRGC6 plasmid was provided by Anindya Dutta’s laboratory (University of

Virginia). This plasmid is derived from the pBudCE4.1 plasmid (Invitrogen) and contains a

GAL4 DNA-binding region (5 copies of GAL4 recognition sequence), a GAL4-Cdc6 fusion

protein expression cassette (under control of the high expression cytomegalovirus (CMV)

promoter), and the FR element from oriP (see Figure 4A). EBNA1 and the EBNA1 mutants

Δ61-83, Δ325-376, and Δ395-450 were generated by PCR amplification of these EBNA1

sequences from pc3OriPE, pc3OriPEΔ61-83, pc3OriPEΔ325-376, or pc3OriPEΔ395-450 and

insertion between the Not I and Kpn I sites of pBFRGC6 (performed by Niro Sivachandran) and

are under the control of the high expression EF-1α promoter (Figure 4B). I subcloned the

EBNA1Δ8-67 sequence from pc3OripEΔ8-67 into pBFRGC6 as described above. The sequences

of all the pBFRGC6-based plasmids were verified by DNA sequencing.

EBNA1 and EBNA1Δ387-394 were expressed from the CMV promoter in the pc3DNA3

plasmid (Invitrogen) that also contained the EBV oriP viral DNA sequence (see Figure 4C).

These plasmids are referred to as oriPE, oriPEΔ387-394, oriP (does not express EBNA1) (see

34

Figure 4. Plasmids used in this study. Schematic representation of pBFRGC6, pBFRGC6-

EBNA1, pc3OriPE, pc3OriP, FR20, and FR29 plasmids used in this study. The DS and FR

elements of oriP as well as the 5X GAL4 DNA binding sites are indicated by the black boxes.

The pBFRGC6-derived plasmids encoding EBNA1 mutants are the same as the pBFRGC6-

EBNA1 plasmid represented above except that the EBNA1 cDNA is replaced with that of one of

its mutants.

35

Figure 4D), respectively. The construction of these plasmids has been previously described

(Shire et al. 1999; Wu et al. 2002; Sivachandran et al. 2010).

B95-8-derived FR elements containing 20 and 29 copies of the EBNA1 recognition

sequence were subcloned into the low-copy number pMBL19 plasmid between Mlu I and Xcm I

sites (performed by Teru Kanda’s group), generating FR20 and FR29 plasmids, respectively.

Both plasmids contain an EGFP expression cassette between Bam HI and Not I sites as well as

the DS element of oriP between Spe I and Eco RV sites (see Figure 4E and 4F).

II.3 Immunofluorescence Microscopy

Cells adhered to cover slips were fixed with 3.7% formaldehyde (SIGMA) in phosphate-

buffered saline (PBS) solution for 20 minutes followed by two 5 minute washes using PBS. For

cells transfected with FR20 or FR29 plasmids, GFP fluorescence emission from transfected cells

was then visualized (excitation, 480/440 nm, emission 527/30 nm). For cells transfected with any

of the other plasmids, cell membranes were then permeabilized by a 5 minute incubation with

1% Triton X-100 in PBS. Cover slips were washed twice (each 2-10 min) and blocked with 50

μL of 4% bovine serum albumin (BSA) in PBS for 30 minutes to 1 hour. The samples were then

stained with rabbit polyclonal anti-EBNA1 R4 serum (Holowaty et al. 2003) at 1:200 dilution in

4% BSA-PBS for 1 hour, followed by three 10 minute washes in PBS. Fluorescein

isothiocyanate-conjugated goat anti-rabbit secondary antibody (Alexafluor 488; Invitrogen)

(1:500 dilution in 4% BSA-PBS) was applied to the cover slips and incubated in the dark for 45

minutes with three subsequent 10 minute washes. Cells were then stained overnight with

ProLong Gold anti-fade DAPI (Invitrogen) for visualization of cellular nuclei and analysis the

following day. The ratio of transfected to untransfected cells was determined for several fields of

view, allowing for calculation of transfection efficiency. Cells were analysed using the 63x oil

immersion objective lens (NA 1.4) on a Leica DM IRE2 inverted fluorescent microscope.

II.4 Plasmid Replication and Maintenance Assays

For experiments involving the CNE2Z cell line, using Lipofectamine 2000 (Invitrogen) in

a 1:2 ratio (DNA:Lipofectamine), 1 x 106 cells in one 10-cm dish were transfected with 6 μg of

pc3OriP, pc3OriPE, pc3OriPEΔ387-394, pBFRGC6, or EBNA1-expressing derivatives of

36

pBFRGC6. Using the same approximate cell density and the same amount of plasmid DNA, both

CNE2Z-E and C666-1 cells were transfected with PCAN, pc3OriP or pc3OriPE, while CNE2Z-E

cells were also transfected with FR20 or FR29. CNE2ZshPML cells were transfected with

pc3OriP or pc3OriPE. For all replication assays, 24 hours post-transfection, the treated cells were

transferred to a 15-cm dish and subsequently harvested 48 hours later. For all maintenance

assays, 24 hours post-transfection, the treated cells were transferred to 15-cm dish and

subsequently re-plated every 3 cell doublings and samples were harvested weekly for up to 6

weeks or 42 cell doublings. Plasmids were isolated from transfected cells by Hirt’s method (Hirt

1967). Treated cells were harvested by centrifugation at 1100 rpm for 10 min and the cell pellet

(~5 x 106 cells) was resuspended with 350 µL of 1X phosphate buffered saline (PBS) solution.

The cells were then washed with 1X PBS, the supernatant was removed, and resuspended again

with 350 µL of 1X PBS. Subsequently, 350 µL of 2X Hirt’s solution (final concentration 0.6%

SDS, 10 mM EDTA, 10 mM Tris-HCl, pH 7.5) were added and the samples were gently inverted

10 times and incubated at 25ºC for 10 min. Following the incubation, 140 µL of 5 M NaCl were

added to each lysate sample, which were then gently inverted 10 times and incubated overnight

at 4ºC. The following day, the samples were centrifuged for 1 hour at 15,000 rpm at 4ºC. The

supernatants were transferred to fresh 1.5 mL microfuge tubes containing 6 µL of RNase A (10

mg/mL, Fermentas) and incubated at 37ºC for 1 hour. Subsequently, 8 µL of Proteinase K (20

mg/mL, Fermentas) were then added and samples were incubated at 50ºC for at least 2 hours. To

extract DNA from samples, ~700 µL of phenol:chloroform (1:1) were added, after which

samples were vortexed for 30 seconds and then centrifuged at 13,200 rpm for 3 min. The

supernatants were then transferred to a fresh 1.5 mL microfuge tube to which 700 µL of

chloroform was added. The samples were then vortexed for 30 seconds and centrifuged at 13,200

rpm for 3 min. The supernatants were then transferred to a new 1.5 mL microfuge tube and 700

µL of isopropanol were added. The samples were mixed well by inversion and incubated at -

20ºC overnight. The precipitated DNA was then collected by centrifugation at 15,000 rpm for 45

min at 4ºC, washed twice with 70% ethanol, and air dried. Finally, the DNA was resuspended in

a master mix solution (30 µL) containing 1 μL of Kpn I (or Xho I or Mlu I) (New England

Biolabs), 3 μL of 10X NEB Buffer, and 26 μL of a mixture of Tris pH 8.5 and dH2O (in a 14:3

ratio).

37

The isolated plasmids were linearized with 1 µL of Xho I (for pc3DNA3-based plasmids),

Mlu I (for pMBL19-based plasmids), or Kpn I (for pBFRGC6-based plasmids) (New England

Biolabs) for at least 3 hours. 9/10ths of the linearized DNA were then further digested with 1 µL

of Dpn I for at least 3 hours, while the remaining 1/10th

of the linearized DNA was used as an

input control for the efficiency of plasmid recovery. Finally, the plasmid samples were separated

on a 0.8% agarose gel by electrophoresis, transferred to Hybond-XL membranes (Amersham) as

described below, and probed with 32

P-labelled pc3OriP. Bands were visualized by

autoradiography and signals were quantified by PhosphorImager analysis using the ImageQuant

software.

II.5 Plasmid Labelling

1 µL of linearized pc3OriP (300 ng/µL), 4 µL of random hexamer primer (0.5 µg/µL)

(Roche), and 8.3 µL of dH2O were incubated at 95ºC for 5min and then placed on ice for 5 min.

Subsequently, 1.25 µL of 1 mM dNTPs (without dCTP), 2.5 µL of NEB Buffer 2 (10 mM Tris-

HCl, 50 mM NaCl, 10 mM MgCl2, 1 mM DTT pH 7.9), 2.4 µL of dH2O, 0.6 µL of Klenow

DNA polymerase, and 5 µL of 3000 Ci/mmol αP32

-dCTP were added and the sample was

incubated at 37ºC for 1 hour 30 min. The labelled plasmid was then added to an

IllustraTM

MicroSpinTM

G-25 column and centrifuged for 1 min at 3000 rpm. The sample was

then incubated at 95ºC for 5 min and then placed on ice for 5 min.

II.6 Southern Blotting

Linearized plasmid DNA fragments from the digestion described above were separated

on a 0.8% agarose gel at 25V for 18 hours. The agarose gel was soaked in 0.25 M HCl for 10min

to allow for depurination of the DNA. The gel was then rinsed twice with dH2O and the duplex

DNA fragments were denatured by soaking the gel in an alkaline solution (0.4 M NaOH and 0.6

M NaCl) for 1 hour. The DNA fragments were then transferred from the agarose gel to a

Hybond-XL membrane in the aforementioned alkaline solution for 1 hour using a vacuum pump.

Subsequently, a 20X SSC solution (3 M NaCl, 0.3 M sodium citrate, pH 7.0) was added for

another 2 hours, after which the membranes were rinsed in a 2X SSC solution. The membranes

were then incubated with blocking buffer (50% formamide, 5X Denhardts, 0.5% sodium dodecyl

sulphate, 6X SSC, and 0.2 mg/mL sheared salmon sperm DNA) in a hybridization oven for 2

38

hours at 42°C, followed by an overnight incubation at 42°C with 32

P-labelled pc3OriP

(approximately 5 x 106 cpm in 15 mL of blocking buffer). The following day, the membranes

were washed twice with a solution containing 1% SDS and 2% SSC at 25°C for 10 min. The

membranes were washed twice for 30 min at 65°C using the same solution, followed by another

wash in a solution containing 0.1% SDS and 0.2% SSC for 10 min at 25°C. The membranes

were then dried and subjected to autoradiography for 1 hour to 3 days, followed by a

quantification of the radiolabelled bands by PhosphorImager analysis using ImageQuant

software.

II.7 Cell Proliferation Assay

The proliferation rates of CNE2Z, CNE2ZE, and C666-1 cells following plasmid

transfection were monitored. In all cases, one day prior to transfection, approximately 1 x 106

cells were seeded in 10 mL of growth medium without antibiotics on a 10-cm dish. CNE2ZE

cells were transfected with 6 μg of pc3OriP, pc3OriPE, FR20, or FR29 plasmids, whereas both

CNE2Z and C666-1 cells were transfected with 6 μg of pc3OriP or pc3OriPE. Plasmids were

transfected into cells using Lipofectamine 2000 (Invitrogen) in a 1:2 ratio (DNA:Lipofectamine).

Approximately 1 x 105 cells were plated in four 6-cm dishes 24 hours later, at which point a

coverslip was obtained and cells were fixed for IF imaging (as described above) and transfection

efficiency was determined. The 6-cm plates were subsequently harvested and counted 1, 3, 5, or

7 days post-transfection using a haemocytometer. The average cell numbers from at least two

independent experiments were plotted with standard deviations.

II.8 Antibodies and Western Blotting

Cells were lysed in high salt buffer (500 mM NaCl, 10% glycerol, 1% Triton X-100, 50

mM HEPES pH 8.0, 1 mM dithiothreitol (DTT), 1X P8340 protease inhibitor cocktail (Sigma)).

Whole cell lysates (50 μg) were separated on a 12% SDS-PAGE gel and transferred to

nitrocellulose. Membranes were blocked for 20 min using 5% non-fat dry milk in PBS with 0.1%

Tween-20 and subsequently incubated with primary antibodies against EBNA1 (mix of OT1X

monoclonal antibody at 1:5000 and R4 rabbit serum at 1:5000 (Holowaty et al. 2003)), actin

(CALBIOCHEM CP01, 1:10,000), or cdc6 (Santa Cruz, sc-13136, 1:2000). Membranes were

washed three times (15 min each), probed with goat anti-mouse (1:5000) or goat anti-rabbit

39

(1:5000) conjugated to horseradish peroxidase secondary antibodies for 1 hour, and then

developed using the enhanced chemiluminescence (ECL) reagents (Perkin Elmer). Where

necessary, membranes were then stripped to remove the initial antibody using 0.1 M glycine pH

2.9 for 15 min, washed three times (10 min each) with PBS-Tween and incubated with the

subsequent antibody.

II.9 Monitoring Episomal Maintenance

C666-1 and AGS/EBV cells on 10-cm plates were transfected with 6 μg of pc3OriP or

pc3OriPE using Lipofectamine 2000 in a 1:2 ratio (DNA:Lipofectamine). One day post-

transfection, the cells were transferred to a 15-cm dish and samples of treated cells (1 x 106 cells

per sample) were harvested weekly for 5 to 6 weeks. Cells were resuspended in 150 μL of RIPA

buffer (50 mM Tris.Cl pH 8.0, 150 mM NaCl, 1% NP40, 0.1% sodium deoxycholate, 1 mM

PMSF and protease inhibitors (P8340, Sigma)) and incubated on ice for 20 min. The samples

were then sonicated and the clarified lysates were diluted to final volume of 500 μL, to which 3

μL of RNase A (10 mg/mL from Fermentas) was added. The samples were then incubated at 37

ºC for 1 hour and then 8 μL of proteinase K (20 mg/mL from Fermantas) was added. The

samples were then incubated at 50°C for at least 2 hours, after which the DNA was extracted by

phenol:chloroform (1:1) and chloroform, and then precipitated with ethanol. The precipitated

DNA was washed twice with 70% ethanol, dried, and resuspended in Tris (pH 8.5). The DNA

was quantified by real-time PCR using primers for the BZLF1 region of EBV and normalized to

the cellular DNA signal from the GAPDH locus (Yuan et al. 2006) (see below for sequences).

Quantitative real-time PCR was performed using 1/4th (for BZLF1) or 1/20th (for GAPDH) of the

template DNA and SsoFastTM

EvaGreenTM

Mix (Bio-Rad) on a Rotorgene qPCR system (Corbett

Research) for 50 cycles of 10 sec at 95ºC, 15 sec at 60ºC,and 25 sec at 72ºC.

Primers:

BZLF1-Forward: CAGCTGAGGTGCTGCATAAGCTTG

BZLF1- Reverse: ACCTTGCCGGCACCTTTGCTATC

GAPDH-Forward: CTC CAA ACA GCC TTG CTT GCT TCG AGA ACC ATT TGC TTC

CCG CTC AGA CGT CTT GAG TGC TAC AGG AAG CTG GCA

GAPDH-Reverse: GAC CCG ACC CCA AAG GCC AGG CTG TAA ATG TCA CCG GGA

GGA TTG GGT GTC TGG GCG CCT CGG GGA ACC TGC CCT

40

CHAPTER III. RESULTS

III.1 pBFRGC6-Based Plasmids do not Autonomously Replicate in the Nasopharyngeal

Carcinoma Cell Line, CNE2Z

EBNA1 is required for the replication and segregation of oriP-containing plasmids and

therefore these plasmids are often used to study the replication and segregation functions of

EBNA1. However, the ability to examine the segregation function of EBNA1 using oriP

plasmids is complicated by the fact that persistence of oriP plasmids (followed as a measure of

segregation) also is dependent on EBNA1-mediated replication. Therefore we sought an

alternative plasmid system that could be used to measure EBNA1-mediated segregation

independent of replication function.

Previously our laboratory identified regions within EBNA1 that contribute to the

maintenance of oriP plasmids. Some of these regions affect the replication function of EBNA1

therefore leading to decreased maintenance of oriP plasmids. In these cases the effect of the

mutation on segregation could not be assessed since plasmid maintenance is the assay for

segregation. To investigate the contribution of these EBNA1 regions to its plasmid segregation

function, I used the pBFRGC6 plasmid system which we obtained from Anindya Dutta’s

laboratory (University of Virginia). This plasmid contains an artificial origin of replication as in

plasmid pFR_Luc, as described in Takeda et al 2005. More specifically, the pBFRGC6 plasmid

contains five GAL4 DNA binding sites and also encodes a fusion protein consisting of the C-

terminal DNA-binding domain of GAL4 fused to the N-terminal domain of Cdc6, a pre-

replicative complex component. Autonomous replication of pBFRGC6 should involve the

binding of the GAL4-Cdc6 fusion protein to the GAL4 recognition sites within the plasmid and

subsequent recruitment of the origin recognition complex (ORC) by Cdc6 as seen for plasmid

pFR_Luc. For purposes of studying the EBNA1 segregation function, the pBFRGC6 plasmid had

been engineered to also contain the family of repeats (FR) element of oriP, which must be bound

by EBNA1 to mediate mitotic segregation of the plasmid. Furthermore, a series of derivatives of

the pBFRGC6 plasmid were developed: an expression cassette was engineered into pBFRGC6

expressing EBNA1 or four deletion mutants of EBNA1 (Δ8-67, Δ61-83, Δ325-376, and Δ395-

450). Therefore, with its ability to autonomously replicate, it was believed that this pBFRGC6

system would allow me to determine the specific regions of EBNA1 that contribute to its

segregation function independently from potential roles in replication.

41

In EBV-negative and EBNA1-negative cell lines (e.g. CNE2Z), all of the pBFRGC6-

based plasmids should autonomously replicate, as this function requires the GAL4-Cdc6 fusion

protein and is EBNA1-independent. Without EBNA1 expression, the parental pBFRGC6

plasmid should not segregate efficiently or be stably maintained in cells as segregation requires

EBNA1 binding to the FR sequence. To confirm that each of the pBFRGC6-based plasmids were

capable of replication prior to examining their segregation ability, I first performed several

replication assays in the CNE2Z cell line (see Figure 5 for a schematic of the experimental

protocol). CNE2Z cells were transfected with oriP, oriPE, or the pBFRGC6-based plasmids,

which were harvested and lysed 3 cell doublings (equivalent to 3 days) post-transfection. The

oriP and oriPE plasmids were used as negative and positive controls, respectively. The oriP

plasmid cannot replicate in CNE2Z cells in the absence of EBNA1, whereas the oriPE plasmid

can replicate in this cell line, as it encodes an EBNA1 expression cassette and overexpresses

EBNA1. In all cases, the plasmids were isolated by the method of Hirt (Hirt 1967) and

linearized. 9/10ths

of the sample was treated with the Dpn I restriction enzyme to test for

replication, while the remainder of the sample (input) was used as an indication of plasmid yield.

Plasmids that have replicated at least once in transfected cells will be resistant to digestion by

Dpn I, whereas plasmids that did not replicate will be digested by Dpn I. This restriction enzyme

cleaves at its GATC recognition sequence when the DNA is methylated on both strands at this

site, which occurs during the propagation of plasmids in bacteria that express Dam methylase

such as E.coli. Mammalian cells do not express Dam methylase and therefore, after one round of

replication (or one cell doubling) the plasmid will be hemi-methylated and will not be cleaved

efficiently by Dpn I. Southern blot analysis showed that plasmids encoding wild-type EBNA1

and the five deletion mutants were able to replicate; however, the parental pBFRGC6 plasmid

(positive control) did not autonomously replicate (Figure 6A). I monitored transfection efficiency

of the EBNA1-expressing plasmids by western blotting using a polyclonal antibody against

EBNA1, whereas uptake of the parental pBFRGC6 plasmid was confirmed by a signal from the

input samples on the Southern blot (lanes 10-12). In order for the pBFRGC6-based plasmids to

autonomously replicate, the GAL4-Cdc6 fusion protein must be expressed. Therefore, I

subsequently examined these samples for expression of the fusion protein by Western blotting

using an antibody against cdc6. I found that GAL4-Cdc6 was only expressed in samples co-

42

Figure 5. Schematic representation of protocol for plasmid replication and maintenance

assays. A. Cells are transfected with test plasmids and harvested 3 cell doublings or weekly post-

transfection to collect samples for replication and plasmid loss assays, respectively. Cells are

lysed (Hirt method (Hirt 1967)), plasmids are isolated, linearized, and, where indicated, were

also incubated with Dpn I to digest unreplicated plasmids. For samples without Dpn I digestion,

1/10th

of the amount of sample was loaded relative to Dpn I-digested samples and used as an

indication of plasmid yield following the isolation protocol. DNA was separated by agarose gel

electrophoresis, Southern blotted, and probed with a 32

P-labeled linearized plasmid to detect

samples. B. Dpn I recognition site and sequences susceptible to digestion. Dpn I recognizes and

cleaves at the DNA sequence, GATC, containing an N6-methyladenine on both DNA strands,

which occurs in bacteria such as E.coli but not mammalian cells. If a plasmid does not replicate

after transfection in mammalian cells, both DNA strands will maintain their methylation and can

be cleaved by Dpn I. However, if the plasmid replicates at least once it will be resistant to Dpn I-

digestion.

A

B

43

Figure 6. The pBFRGC6 plasmid does not autonomously replicate. CNE2Z cells were

transfected with oriP, oriPE and pBFRGC6 plasmids encoding wild-type and EBNA1 deletion

mutants (ΔG/A, Δ8-67, Δ61-83, Δ325-376, Δ395-450) and cells were harvested after 3 cell

doublings (3 days). A. Southern blot comparing the replication efficiencies of pBFRGC6 and

pBFRGC6-based plasmids encoding wild-type EBNA1 and EBNA1 deletion mutants. 9/10ths of

the treated cells were lysed by the Hirt method and low-molecular-weight DNA (including

plasmids) was isolated as previously described. The remaining tenth of the harvested cells were

kept for analysis of EBNA1 and GAL4-Cdc6 expression. Recovered plasmids were linearized

using Xho I (for oriP and oriPE) and Kpn I (for pBFRGC6-based plasmids) and, where

indicated, were also incubated with Dpn I to digest unreplicated plasmids. For samples without

Dpn I digestion, 1/10th

of the amount of sample was loaded relative to Dpn I-digested samples.

DNA was separated by agarose gel electrophoresis, Southern blotted, and probed with 32

P-

labeled oriPE. The position of the Dpn1-resistant plasmid is indicated by the bracket. 300 pg of

oriPE plasmid was used as a size marker (Lane 1). B. Western blot analysis of GAL4-Cdc6 and

EBNA1 expression from transfected CNE2Z cells. Total cells lysates (30 μg) were separated

using a 12% SDS-PAGE gel and probed with mouse anti-EBNA1 and anti-Cdc6 antibodies (top

panel) and actin (bottom panel). Values at the left are molecular size markers in kilodaltons. The

signals were detected by enhanced chemiluminescence (ECL).

B

A B

44

expressing EBNA1 or EBNA1 deletion mutants Δ8-67, Δ61-83, or Δ395-450 and not in the

pBFRGC6 control samples (Figure 6B), suggesting that EBNA1 was enhancing GAL4-Cdc6

expression possibly through binding to the FR element. Due to the fact that the parental

pBFRGC6 plasmid did not autonomously replicate, this system was no longer useful for my

segregation studies and was not further pursued.

III.2 Higher EBNA1 Expression can Inhibit Plasmid Maintenance without Inhibiting

Plasmid Replication Efficiency in Nasopharyngeal Carcinoma Cells

We were initially interested in directly comparing the abilities of EBV-negative and

EBV-positive NPC cell lines, CNE2Z and C666-1, respectively, to maintain oriP plasmids. Since

the CNE2Z cell line was derived from EBV-positive NPC cells that failed to maintain EBV in

culture, we wondered whether these cells were less able to support EBNA1-mediated replication

and segregation from oriP as compared to C666-1 cells that stably maintain EBV. Replication

and segregation of oriP plasmids requires the expression of EBNA1 protein, hence, an

expression cassette for EBNA1 was integrated into CNE2Z cells to generate the stable cell line,

CNE2ZE, which expresses EBNA1 at similar levels to C666-1 cells. Niro Sivachandran in our

laboratory first compared the maintenance of the same oriP plasmid in CNE2ZE and C666-1

cells and found that both cells lines had similar abilities to maintain this plasmid. Unexpectedly,

in both cell lines, she found that the oriP plasmid was maintained for longer periods of time than

the oriPE plasmid (Figure 7A and 7B), which overexpresses EBNA1 from a cytomegalovirus

(CMV) promoter. Hence, the major difference in the experiments comparing the maintenance of

oriP plasmids and oriPE plasmids is that the EBNA1 levels are considerably higher (at least a

thousand fold) when expressed from oriPE than the levels expressed in CNE2ZE or C666-1

cells, which was confirmed by Western blot analysis (Figures 8B and 9B). Therefore, higher

levels of EBNA1 appear to disrupt the maintenance of the oriP plasmids in these cell lines.

OriP plasmid maintenance requires both replication and segregation of the plasmids.

Therefore, I then performed further studies to determine whether or not the decreased

maintenance of oriPE plasmids was due to differences in DNA replication in the presence of

excess EBNA1. To this end, I performed replication assays using Dpn I-resistance as a measure

to compare replication efficiencies of oriP and oriPE plasmids in C666-1 and CNE2ZE cells.

45

Figure 7. Plasmid maintenance assays in CNE2ZE and C666-1 cells. Cells were transfected

with pCAN (negative control), oriP, or oriPE plasmid as indicated and harvested after 3 to 56 or

42 cell doublings (3 to 56 and 6 to 84 days) for CNE2ZE (A) and C666-1 (B) cells, respectively.

Cells were lysed by the Hirt method and plasmids were isolated, linearized using Xho I and,

where indicated, were also incubated with Dpn I to digest unreplicated plasmids. For samples

without Dpn I digestion, 1/10th

of the amount of sample was loaded relative to Dpn I-digested

samples. DNA was separated by agarose gel electrophoresis, Southern blotted, and probed with 32

P-labeled oriP or pCAN for CNE2ZE and C666-1 samples, respectively. The position of the

Dpn I-resistant plasmid is indicated by the asterisk. The amount of Dpn I-resistant plasmid was

quantified using phosphorimager analysis and plotted relative to the 3-cell doubling amount,

which was set to one (histogram). Average values with standard deviation are shown for

CNE2ZE samples.

A

B

46

Figure 8. Higher levels of EBNA1 do not affect plasmid replication in CNE2ZE cells. A.

Transient-replication assays comparing the bands from oriP and oriPE plasmids after 3 cell

doublings (3 days) before (Input) and after (+Dpn I) Dpn I digestion. The positions of Dpn I-

resistant bands are indicated by the asterisk. The histogram shows quantification of Dpn I-

resistant bands relative to input bands from three experiments. Results are plotted relative to the

signal from the oriP plasmid (set to one). Error bars indicate standard deviations. B. Western blot

confirming the overexpression of EBNA1 in oriPE samples compared to endogenous EBNA1 in

CNE2E. Total cell lysates (30 μg) are shown from CNE2E 3 days post-transfection with pCAN,

oriP, or oriPE plasmid. Blots were probed with antibodies against EBNA1 and actin. C.

CNE2ZE cells were transfected with oriP or oriPE plasmid as for replication assays. Cells

(1x105) were then plated in four 6-cm dishes and harvested and counted 1, 3, 5, or 7 days later.

Average cell numbers from three independent experiments are plotted with standard deviations.

A

B

(kDa)

C

47

Figure 9. Higher levels of EBNA1 increase plasmid replication in C666-1. A. Transient-

replication assays comparing the bands from oriP and oriPE plasmids after 3 cell doublings (6

days) before (Input) and after (+Dpn I) Dpn I digestion. The positions of Dpn I-resistant bands

are indicated by the asterisk. The double bands seen in lanes 5 and 8 are due to incomplete

linearization of oriPE, resulting in both nicked (upper band) and linearized (lower band) forms

of the plasmid. The histogram shows quantification of Dpn I-resistant bands relative to input

bands from three experiments. Results are plotted relative to the signal from the oriP plasmid

(set to one). Error bars indicate standard deviations. B. Western blot confirming the

overexpression of EBNA1 in oriPE samples (EBNA1) compared to endogenous EBNA1 in

C666-1 cells (GA), which is larger due to having a long Gly-Ala repeat region. Total cell lysates

C

A

(kDa)

B

48

(30 μg) are shown from C666-1 cells 6 days post-transfection with pCAN, oriP, or oriPE

plasmid. Blots were probed with antibodies against EBNA1 and actin. C. C666-1 cells were

transfected with oriP or oriPE plasmid as for replication assays. Cells (3x105) were then plated

in four 6-cm dishes and harvested and counted 4, 8, 12, and 14 days later. Average cell numbers

from three independent experiments are plotted, with standard deviations.

49

These two cell lines were transfected with the oriP and oriPE plasmids and subsequently

harvested 3 cell doublings post-transfection (equivalent to 3 days and 6 days, respectively). The

plasmids were extracted from the cells and their replication was assessed following

quantification of signals from Southern blots. Comparison of replication signals from oriP and

oriPE showed that the higher EBNA1 levels did not decrease replication

efficiency in either the

CNE2ZE or C666-1 cell lines (Figure 8A and 9A). In fact, relative to the total plasmid taken up

by the cell (input), the oriPE plasmid replicated approximately two-fold more efficiently than the

oriP plasmid in C666-1 cells (Figure 9A).

I also performed cell proliferation assays to assess whether the high levels of EBNA1

impacted the viability and/or the proliferation rate of transfected cells. CNE2ZE and C666-1

cells were transfected with oriP and oriPE plasmids then seeded at equal cell density one-day

post-transfection. Cells were subsequently harvested and counted every 2 cell doublings for a

total of 8 cell doublings. I found that higher levels of EBNA1 were not cytotoxic to CNE2ZE or

C666-1 cells and the proliferation rates of these two cell lines were not significantly affected by

the presence of oriPE compared to oriP (Figure 8C and 9C). The majority of the cells contained

the plasmids with average transfection efficiencies of 60% and 80% for C666-1 and CNE2ZE,

respectively, as determined by immunofluorescence (IF) microscopy for EBNA1 expressed from

the oriPE plasmid. The considerably higher levels of EBNA1 from the oriPE plasmid compared

to the endogenous EBNA1 expression in C666-1 and CNE2ZE cells allows for easy detection of

transfected cells by IF microscopy. Taken together, the results indicate that higher EBNA1 levels

do not negatively affect plasmid replication or cell viability/growth and are therefore most likely

detrimental to plasmid segregation, resulting in decreased oriP plasmid maintenance.

III.3 Higher EBNA1 Levels do not Reduce EBV Copy Number in C666-1 or AGS/EBV Cell

Lines

Since we found that higher levels of EBNA1 expression reduce plasmid maintenance, I

was interested in investigating the possibility that EBNA1 overexpression might lead to the loss

of the endogenous EBV genome in EBV-positive epithelial cell lines, C666-1 and AGS-EBV,

the latter of which is a gastric carcinoma cell line infected in vitro with recombinant EBV. In the

case of C666-1 and AGS-EBV cells, the EBV genome is not integrated but maintained

extrachromosomally as a circular episome, which allowed me to detect any changes in the virus

50

Figure 10. Higher levels of EBNA1 do not affect the copy number of EBV episomes in

C666-1 or AGS/EBV cell lines. C666-1 (A) and AGS/EBV (B) cells were transfected with oriP

or oriPE plasmid, and cells were propagated for the indicated numbers of cell doublings before

they were lysed in radioimmunoprecipitation assay (RIPA) buffer and total DNA was isolated.

Quantitative RT-PCR on the EBV genomes was performed using a primer set for the BZLF1

gene, and results were normalized to the host GAPDH (glyceraldehyde-3-phosphate

dehydrogenase) gene. The histograms show the average levels of the EBV genomes and standard

deviations from two independent experiments for each cell line, where the signal from the 3-

doubling time point is set to one.

A

B

51

copy number. For instance, if the EBV copy number decreased over time in cells transfected

with the oriPE plasmid, this would suggest that maintenance of the virus is perturbed by higher

levels of EBNA1, which may have an expression threshold for stable EBV persistence. To

address this possibility, I transfected these cell lines with oriP and oriPE plasmids and harvested

weekly samples for 6 weeks. Total DNA, including the EBV episomes, was extracted from these

cells and the EBV genomes were quantified by quantitative real-time PCR (RT-PCR) using

primers directed for the viral BZLF1 region. After normalization to the host GAPDH gene, the

results obtained from both AGS-EBV and C666-1 cell lines showed no obvious decrease in the

EBV copy number at any time up to 20 and 24 cell doublings, respectively (Figure 10A and

10B). Also, although higher levels of EBNA1 increased plasmid replication in the C666-1 cells, I

found no significant difference in EBV copy number between the oriP and oriPE transfected

samples after 3 cell doublings, the same time point where replication of the oriPE plasmid had

approximately doubled. Therefore, the level of EBNA1 alone does not itself determine the

efficiency of EBV episome maintenance in C666-1 and AGS/EBV cells.

III.4 Additional 9 Repeats within the FR Region Decrease Plasmid Replication Efficiency

but Improve Plasmid Segregation

Mitotic chromosome attachment and segregation of the EBV episome and oriP-

containing plasmids requires binding of EBNA1 to recognition sites within the FR region of the

oriP sequence. While the FR region was initially believed to contain only 20 repeats of the

EBNA1 binding site, previous studies have demonstrated that the FR region within the EBV

virus actually contains 29 repeats. It is believed that the extra 9 repeats were deleted while the

oriP sequence was cloned into plasmids which were propagated in E.coli.

Not only is the FR region required for maintaining the virus and oriP-containing

plasmids, it is known to function as a transcriptional enhancer and in B-cell transformation.

Recently, Ali et al. characterized some of the effects of the additional 9 repeats using B-

lymphocytes and found that the extra 9 repeats in the FR region had no effect on plasmid

replication, but reduced the transcriptional enhancer activity inherent to the FR region and

improved the efficiency of EBV transformation of B-cells. Although no effects on plasmid

replication were observed in B-cells, due to the inherent differences in ability to maintain EBV

episomes between B-cells and epithelial cells, I was interested in whether the additional 9 FR

52

repeats had any effect on the plasmid replication and segregation ability in NPC cells. To this

end, I first performed a replication assay to determine if the 9 repeats affected plasmid

replication efficiency. CNE2ZE cells were transfected with oriP plasmids encoding an FR region

that contains 20 repeats or 29 repeats, which will be referred to as FR20 and FR29, respectively.

These cells stably express low levels of EBNA1 which allows for replication and segregation of

the two oriP-containing plasmids. The presence of the extra 9 FR repeats was verified by

plasmid digestion with the restriction enzymes, Xcm I and Mlu I producing the expected band

patterns following agarose gel electrophoresis (data not shown). Three days post-transfection, I

harvested the CNE2ZE cells, isolated plasmids from the cells and assessed the replication

efficiencies of the FR20 and FR29 by Southern blotting. The results showed that the replication

efficiency of the FR29 plasmid was reduced by approximately 40% compared to the FR20

plasmid (Figure 11A), as determined by normalizing the replication signal (Dpn I-resistant band)

to the input signal. To confirm that there were no differences in the viability and/or proliferation

of the cells transfected with either plasmid, I performed a cell proliferation assay. As expected, I

found no difference in cell proliferation rates between cells transfected with either plasmid

(Figure 11B). Together, the results from the replication and proliferation assays suggest that the

extra 9 repeats negatively affect the replication of oriP plasmids.

Since the EBV genome contains 29 repeats within the FR element, there is a possibility

that the additional 9 repeats may play a role in maintenance of the virus during its latency. The

endogenous EBV episome within C666-1 cells includes 29 repeats within the FR region. Thus,

investigating whether the oriP plasmid containing 29 FR repeats (FR29) is better maintained will

further our understanding of persistence of the virus in C666-1 cells. Therefore, I compared the

maintenance efficiency of the FR20 and FR29 plasmids using CNE2ZE cells. To this end,

CNE2ZE cells were transfected with the FR20 and FR29 plasmids. Samples were harvested 3

days post-transfection to assess their replication while the remaining cells were continuously

passaged for weekly sample collection for a total of six weeks to analyze plasmid maintenance.

Southern blot results show that the replication signal of the FR20 plasmid decreases more rapidly

than that of the FR29 plasmid (Figure 12). Thus, although the additional 9 repeats within the FR

region reduce plasmid replication efficiency, they appear to confer an advantage to plasmid

segregation and long-term maintenance.

53

Figure 11. The extra 9 repeats reduce plasmid replication efficiency. A. Transient-replication

assays in CNE2ZE cells comparing the bands from FR20 and FR29 plasmids after 3 cell

doublings (3 days) before (Input) and after (+Dpn I) Dpn I digestion. The positions of Dpn I-

resistant bands are indicated by the asterisk. The histogram shows quantification of Dpn I-

resistant bands relative to input bands from 3 experiments. Results were plotted relative to the

signal from the FR20 plasmid (set to one). Error bars indicate standard deviations. B. CNE2ZE

cells were transfected with FR20 or FR29 plasmid as for replication assays. Cells (1x105) were

then plated in four 6-cm dishes and harvested and counted 1, 3, 5, or 7 days later. Average cell

numbers from two independent experiments are plotted with standard deviations.

C

*

A

C

B

*

54

Figure 12. The extra 9 FR repeats improve plasmid segregation. Cells were transfected with

pCAN (negative control), FR20, or FR29 plasmid as indicated and harvested after 3 to 42 cell

doublings. Cells were then lysed by the Hirt method and plasmids were isolated, linearized using

Xho I (for pCAN) or Mlu I and, where indicated, were also incubated with Dpn I to digest

unreplicated plasmids. For samples without Dpn I digestion, 1/10th

of the amount of the sample

was loaded relative to Dpn I-digested samples. DNA was separated by agarose gel

electrophoresis, Southern blotted, and probed with 32

P-labeled FR20. The position of the Dpn I-

resistant plasmid is indicated by the asterisk. The histogram shows quantification of Dpn I-

resistant bands relative to the 3-cell doubling amount, which was set to one (histogram) from

three experiments. Average values with standard deviation are shown.

*

55

III.5 Silencing of PML Protein Leads to a Reduction in Replication Efficiency in NPC cells.

Recently, our laboratory has found that promyelocytic leukemia (PML) bodies have a

repressive function in EBV lytic replication and that EBNA1 promotes the disruption and

degradation of PML bodies, thereby contributing to EBV reactivation. Whether or not PML

nuclear bodies affect latent EBV replication has not yet been investigated. I wished to determine

if PML affected the replication of oriP-containing plasmids in NPC cells. To this end, I

transfected CNE2Z cells and the same cells in which PML expression had been silenced with

shRNA (CNE2Z-shPML) with oriP (negative control), oriPE, and oriPEΔ387-394 plasmids.

Three days post-transfection, I isolated the plasmids from the two cell lines and analyzed their

replication efficiency using the previously described DpnI-resistance assay. oriPEΔ387-394

encodes for an EBNA1 deletion mutant that does not trigger PML disruption and was used to

limit the loss of PML that occurs when wild-type EBNA1 is expressed. Southern blot analysis

showed that in the absence of PML, replication of oriPE and oriPEΔ387-394 plasmids was

decreased by nearly 10-fold compared to the PML-expressing parental cell line, CNE2Z (Figure

13). Therefore, the results suggest that PML positively contributes to EBNA1-mediated

replication from oriP.

56

Figure 13. PML silencing reduces the plasmid replication efficiency in CNE2Z cells.

Transient-replication assays in CNE2Z and CNE2Z-shPML cells comparing the bands from oriP

(negative control), oriPE, and oriPEΔ387-394 plasmids after 3 cell doublings (3 days) before

(Input) and after (+Dpn I) Dpn I digestion. The positions of DpnI-resistant bands are indicated by

the asterisk. The histogram shows quantification of Dpn I-resistant bands relative to input bands

from 3 and 2 independent experiments for CNE2Z and CNE2Z-shPML cell lines, respectively.

Results were plotted relative to the signal from the oriP plasmid for each cell line. The results for

the CNE2ZshPML cell line were then plotted in relation to the results of the CNE2Z cell. Error

bars indicate standard deviations.

*

57

CHAPTER IV: DISCUSSION AND FUTURE DIRECTIONS

IV.1 FR-bound EBNA1 May Enable Expression of GAL4-Cdc6 Fusion Protein and

Facilitate Replication of pBFRGC6-based Plasmids

Six years ago Takeda et al. demonstrated that the recruitment of cellular factors involved

in pre-RC complex formation alone to DNA is sufficient to initiate replication (Takeda et al.

2005). This group created fusion proteins that combine cellular replication initiation factors such

as Cdc6 and Orc2, with the DNA-binding domain of GAL4 and developed an artificial origin in

vivo on pFRLuc plasmids by the recruitment of the fusion proteins to an element containing

GAL4 DNA-binding sites (Takeda et al. 2005). Originally, assaying the replication activity of

this system involved co-transfection of a plasmid encoding one of the fusion proteins and another

plasmid that contains the GAL4 DNA-binding sites (Takeda et al. 2005). We had initially wanted

to use this system to separate EBNA1 replication and segregation functions, which would allow

me to examine the specific regions of EBNA1 that contribute to its segregation function while

the plasmid autonomously replicates. This group provided us with a single plasmid, pFRGC6,

which contained the GAL4-Cdc6 fusion protein, an element containing 5 copies of the GAL4

DNA-binding site, and the FR element of oriP. The recruitment of GAL4-Cdc6 to the GAL4

DNA-binding sites on the pFRGC6 plasmid should create an artificial origin and allow the

plasmid to autonomously replicate, whereas the FR element should allow the plasmid to

segregate in the presence of EBNA1 during cell division. However, unexpectedly, the plasmid

did not replicate in the absence of EBNA1 and did not express GAL4-Cdc6. On the other hand,

the plasmids that encoded wild-type EBNA1 or its deletion mutants Δ8-67, Δ61-83, Δ395-450

expressed the GAL4-Cdc6 fusion protein and replicated. Past studies using chloramphenicol

acetyltransferase (CAT) gene demonstrated that in the presence of EBNA1 the FR element could

enhance transcription of the CAT gene when positioned upstream or downstream of it (Reisman

and Sugden 1986). Moreover, Gahn et al. previously demonstrated that binding of EBNA1 to the

FR element alone could increase the expression of the EBV LMP gene when separated by 10 Kb

(Gahn and Sugden 1995). Therefore, it is likely that EBNA1 and certain deletion mutants

enhanced the expression of the GAL4-Cdc6 fusion protein through binding to the FR, which also

functions as a transcriptional enhancer element. Finally, the fact that the pFRLuc plasmids,

which lack the FR element, do express the fusion protein and can autonomously replicate raises

58

the possibility that the insertion of the FR element into the pBFRGC6 plasmid may inhibit or

disrupt expression of the GAL4-Cdc6 fusion protein in the absence of EBNA1.

IV.2 Higher Levels of EBNA1 do not Inhibit Plasmid Replication and are not Cytotoxic to

CNE2Z Cells.

The EBV episome can stably persist in B-lymphocytes in tissue culture, however, this is

usually not the case in epithelial cell lines such as NPC. With the exception of the C666-1 cell

line, virtually all undifferentiated NPC cell lines cannot consistently maintain the EBV episome

in culture and as a result, they are all EBV-negative (Cheung et al. 1999). As part of my project,

I was interested in understanding the basis for the difference in EBV maintenance between

C666-1 and other NPC cell lines and specifically, whether it is related to oriP-mediated

replication and segregation functions. A previous student in our laboratory found no apparent

difference in oriP-mediated plasmid replication and maintenance between C666-1 and EBV-

negative NPC cell lines under conditions with low EBNA1 expression; however, higher EBNA1

levels interfered with plasmid segregation during mitosis (Sivachandran et al. 2011). Consistent

with a role in selectively inhibiting plasmid maintenance, using the oriPE plasmid which

overexpresses EBNA1, I showed that higher levels of EBNA1 did not decrease plasmid

replication efficiency in either the C666-1 or CNE2ZE cell line and did not exhibit any cytotoxic

effects. In fact, I found that the oriPE plasmid replicated twice as efficiently as the oriP plasmid

in C666-1 cells. Therefore, with no negative effects on plasmid replication or cell growth rate,

higher EBNA1 expression must be detrimental to another aspect of oriP plasmid maintenance,

most likely segregation. EBV-infected NPC cells exhibit latency program II where EBNA1

expression is controlled by the Qp promoter, which is subject to auto-regulation and maintains

low EBNA1 levels (Sample et al. 1992; Rickinson and Kieff 1996). Therefore, a possible

threshold in EBNA1 expression may exist and contribute to how well oriP plasmids, and

potentially the EBV episome, are stably maintained in NPC cells in long-term culture. Moreover,

FR-bound EBNA1 and its interactions with cellular proteins such as EBP2 are necessary for

efficient oriP plasmid segregation; hence, an excess of EBNA1 may perturb ternary complex

formation and disrupt plasmid partitioning. Also, it has been proposed that EBNA1 may interact

directly with DNA through Gly-Arg repeats which resemble AT-hooks (Sears et al. 2004). If

EBNA1 itself binds to regions on mitotic chromosomes, it is possible that when EBNA1 is in

59

excess non-FR-bound EBNA1 molecules may compete with FR-bound EBNA1 and saturate

sites on chromosomal regions that would normally facilitate the tethering of oriP plasmids and

EBV episomes. As a consequence, this could lead to inefficient plasmid and episomal

segregation and would be reflected in decreased long-term maintenance.

Past studies by Yates et al. demonstrated that oriP plasmids do not replicate more than

once per cell cycle even in the presence of excess EBNA1 (Yates and Guan 1991). Therefore, the

increase in oriPE plasmid replication efficiency observed in C666-1 cells should not be

attributed to plasmid re-replication during cell division and indeed, higher levels of EBNA1

alone may improve plasmid replication efficiency in C666-1 cells. Niro Sivachandran in our

laboratory has also shown that replication efficiency of the oriPE plasmid is comparable between

CNE2Z and C666-1 cells (Sivachandran et al. 2011). C666-1 cells express full-length EBNA1

(including the Gly-Ala repeat region) at low levels from the endogenous EBV episome, which is

capable of replicating and maintaining the oriP plasmid (Figure 7B and 9A). However, from my

findings, I suggest that full-length EBNA1 alone may not mediate replication the oriP plasmid as

efficiently as when EBNA1ΔG/A is co-expressed at much higher levels (Figure 9A histogram) in

C666-1 cells. In accordance with this idea, both oriP and oriPE plasmids were replicated with a

similar efficiency in CNE2ZE cells (Figure 8A histogram). This cell line stably expresses

EBNA1ΔG/A at low levels, which enabled replication of the oriP plasmid (Figure 8A, lane 7).

Interestingly, overexpression of EBNA1ΔG/A in CNE2ZE cells did not improve plasmid

replication as it did in C666-1. Together, these findings imply a possible regulatory role for the

Gly-Ala repeat region in EBNA1-mediated plasmid replication. Alternatively, due to the fact that

C666-1 is the only NPC cell that naturally maintains the EBV episome, it is possible that there

are factors unique to this cell line that may enable increased plasmid replication efficiency in the

presence of excess EBNA1 (Cheung et al. 1999). EBNA1 expression is tightly regulated by the

Qp promoter and is normally expressed at low levels in this cell line, therefore, it may be a

limiting factor for some processes.

Despite its ability to disrupt plasmid segregation, high levels of EBNA1 did not interfere

in EBV episomal segregation or maintenance in C666-1 or the EBV-positive gastric carcinoma

epithelial AGS/EBV cell line. These results suggest that additional factors and even sequences

within the complete EBV episome may contribute to the maintenance of the viral genomes. A

nuclear matrix attachment region (MAR) which traverses the oriP sequence and the EBER

60

genes, has been previously identified within the EBV genome (Jankelevich et al. 1992). It is

possible that the MAR may confer additional long-term stability of the viral episome and

contribute to EBV persistence due to the fact that this region has been shown to increase

maintenance of EBV plasmids up to 2-fold greater than plasmids lacking the MAR region

(Jankelevich et al. 1992; White et al. 2001). Moreover, in addition to EBP2, other cellular factors

may affect the maintenance of the EBV genome, which quite possibly could contain recognition

sites for cellular proteins that function with EBNA1 to tether the large EBV episome to mitotic

chromosomes. Also, there is thought to be a selective pressure on C666-1 to maintain the EBV

genomes due to expression of viral proteins (e.g. EBNA1), miRNAs, EBERs etc. on which these

tumour cells may have become dependent for growth and survival (Shannon-Lowe et al. 2009).

Burkitt’s lymphoma cell lines are dependent on EBV for growth and survival in vivo, and do not

lose the episome in long-term culture (Kennedy et al. 2003; Hammerschmidt and Sugden 2004).

It is thought that upon isolation from tumour biopsies, NPC cell lines (except C666-1) lose their

dependency on EBV-induced growth and survival genes and eventually lose the virus in culture

(Shannon-Lowe et al. 2009).

IV.3 Additional 9 Repeats within the FR Element may Confer an Advantage in EBV

Maintenance

The FR element of oriP is a cis-acting sequence that functions in episomal and plasmid

maintenance through its role in segregation (Yates et al. 1984; Reisman and Sugden 1986). It is

comprised of a tandem array of 30 bp high-affinity recognition sites for EBNA1, which

constitutively binds to each of these sites as a dimer and assembles onto the sequence in a

cooperative manner (Hsieh et al. 1993; Summers et al. 1996). The binding of EBNA1 to the FR

sequence enables the EBV episome and EBV-based plasmids to be piggy-backed or tethered to

host condensed mitotic chromosomes and their subsequent segregation to daughter cells during

cell division (Krysan et al. 1989; Ceccarelli and Frappier 2000; Kanda et al. 2001).

For years it has been believed that the FR element of oriP, as cloned from the genome of

the B95-8 EBV strain, is comprised of 20 copies of the 30 bp repeat (Baer et al. 1984). Indeed,

all available oriP-containing plasmids contain 20 repeats within the FR element, which have

been proven to be sufficient for FR-associated functions. However, ten years ago Fruscalzo et al.

discovered that 252bp of the B95-8 derived-oriP sequence had been deleted, most likely due to

61

its hairpin secondary structure and repeat instability in E.coli during cloning procedures

(Fruscalzo et al. 2001). The 252 bp sequence was found to correspond to 9 additional repeats

within the FR element. Hence, the full-length FR of the B95-8 EBV strain actually contains 29

repeats as opposed to 20 repeats (Fruscalzo et al. 2001). Ali et al. were able to subclone the full-

length FR element (29 repeats) into a low-copy plasmid and their studies in B-lymphocytes

revealed some functional differences between 20 and 29 FR repeats (Ali et al. 2009). In B-cells

the 29 repeats were found to reduce the FR transcriptional enhancer activity, but it improved B-

cell transformation, and did not affect plasmid replication efficiency (Ali et al. 2009).

Conversely, in NPC cells, which are of epithelial origin, I have shown that the presence of the

additional 9 repeats within the FR element reduces plasmid replication efficiency by

approximately 40% as compared to an oriP plasmid with the original 20 repeats. As each 30 bp

FR repeat contains an EBNA1 recognition site, the additional 9 repeats potentially allows for a

45% increase in EBNA1 binding by comparing 20 versus 29 repeats within the FR.

One reason why a larger FR might decrease replication is the ability of the FR, when

bound by EBNA1, to stall the progression of replication forks (Gahn and Schildkraut 1989;

Ermakova et al. 1996). The association of EBNA1 with the FR repeat sequences not only

functions in genome segregation, but is also known to impede the progression of replication

forks traversing through FR repeats within oriP as the EBV genome replicates during S phase

(Gahn and Schildkraut 1989; Ermakova et al. 1996; Aiyar et al. 2009). Studies have shown that

oriP-mediated DNA replication initiation occurs at or in close proximity to the DS element and

replication subsequently stalls at the FR element, which presents a barrier to approaching

replication forks (Gahn and Schildkraut 1989; Dhar and Schildkraut 1991). Although the FR

repeats alone have the inherent ability to hinder the progression of replication forks, it is the

binding of EBNA1 to the FR repeats which forms a protein-DNA complex that is responsible for

creating the highly efficient barrier for replication forks (Dhar and Schildkraut 1991). Moreover,

there is evidence that the number of repeats (and EBNA1-binding sites) within the FR element

determines the efficiency with which the FR functions as a replication fork barrier (Platt et al.

1993; Aiyar et al. 2009). Therefore, the presence of the extra 9 repeats may increase the rate of

replication fork stalling at the FR, thereby decreasing replication efficiency. It is conceivable that

impeding replication fork migration through the FR might serve to limit and maintain EBV copy

number in infected cells (Aiyar et al. 2009). Thus, the reduction in replication efficiency due to

62

the full-length FR may be important during EBV latent infection and maintaining a constant

copy number of several cell generations. Moreover, the EBV EBERs genes, which are heavily

transcribed throughout latent infection, are found immediately 5’ of the FR element and are

transcribed toward the FR and DS regions (Baer et al. 1984). Replication of these genes also

proceeds in the same direction; hence, it is thought that the FR replication barrier may also

function to prevent collisions of replication and transcription forks and resultant DNA damage

(Mirkin and Mirkin 2007). This replication fork barrier function of the EBNA1-FR association

may be analogous to the non-transcribed spacer of the rRNA genes in Saccharomyces cerevisiae,

which contains a replication barrier that forms upon the interaction of the DNA-binding protein

Fob1 with its recognition sites and together they avert head-on replication-transcription fork

collisions (Mirkin and Mirkin 2007).

Although the additional 9 repeats within the FR region reduce plasmid replication

efficiency, I have shown that these extra repeats positively affect plasmid maintenance. By

comparing the long-term maintenance efficiencies of FR20 and FR29 plasmids, which contain

20 and 29 FR repeats, respectively, I have shown that these extra 9 repeats may confer an

advantage in plasmid segregation ability, as the FR29 plasmid was maintained better over 6

weeks than the FR20 plasmid. Together, EBNA1 and cellular proteins (e.g. EBP2) tether EBV

genomes and oriP-containing plasmids to mitotic chromosomes via EBNA1-binding to

recognition sites within the FR element, thereby facilitating plasmid and episomal partitioning

during cell division (Kapoor et al. 2001; Kapoor and Frappier 2003; Kapoor et al. 2005).

Therefore, the full-length FR may improve plasmid segregation by increasing the avidity of the

attachment of plasmids to condensed mitotic chromosomes. Each FR repeat contains a high-

affinity EBNA1 recognition site, hence, it is possible that by increasing the number of EBNA1

binding sites, this will in turn strengthen the adhesion between the oriP plasmids to cellular

chromosomes, which could enhance plasmid segregation efficiency during mitosis. Skalsky et al.

studies of KSHV episomal maintenance have also provided evidence that multiple copies of

LANA-binding sites 1 and 2 (LBS1 and LBS2), which lie in a region consisting of 35 to 45

copies of terminal repeats (referred to as the TR region), may have an episomal maintenance

function similar to that of the FR element of oriP (Skalsky et al. 2007). In fact, this group

demonstrated that increasing the number of LANA-binding sites positively affects long-term

KSHV episomal maintenance efficiency, which is similar to the improved oriP plasmid

63

maintenance that I have found with the additional 9 FR repeats. Moreover, as mentioned

previously, the FR repeats inherently function as natural impediments of the replication fork for

the EBV genome. Dheekollu et al. have recently shown that the replication pausing factor

Timeless (or Tim) is necessary for maintenance of the circular EBV episomes in latent EBV-

infected B-lymphocytes (Dheekollu and Lieberman 2011). Tim is an evolutionarily conserved

proteins that helps stabilize replication forks upon encountering repetitive sequences or DNA

secondary structures and may play a role in sister chromatid cohesion and chromosome

segregation during mitosis (Gotter et al. 2007; Leman et al. 2010; Smith-Roe et al. 2011). Tim

was shown to localize to oriP during cellular S phase and silencing of Tim resulted in an

increase in DNA double-stranded breaks, loss of EBV episomal stability, as well as inhibition of

oriP-mediated replication initiation (Dheekollu and Lieberman 2011). Dheekollu et al. proposed

that there is a linkage between replication fork impediments and maintaining DNA stability and

EBV genome persistence. Therefore, it is conceivable that additional replication fork blockage

conferred by the extra 9 FR repeats as well as increased Tim occupation at oriP may contribute

to the improved segregation and maintenance for the FR29 plasmid.

IV.4 Possible Role of PML in Plasmid DNA Replication?

One of the barriers the cell has developed to defend itself against viral infection is PML

nuclear bodies. Over the years, evidence consistent with both positive and negative roles for

PML in viral replication has been accumulating. Our laboratory has demonstrated that EBNA1-

mediated disruption of PML NBs contributes to EBV reactivation and lytic DNA replication,

which implies a repressive function for PML NBs in these processes (Sivachandran et al.

submitted). EBNA1 disrupts PML NBs and lowers PML protein levels in EBV-negative cells as

well as the latently EBV-infected C666-1 cell line (Sivachandran et al. 2008). I have shown that

depletion of PML by targeted short hairpin RNA drastically reduces the oriP plasmid replication

efficiency in NPC cells, which supports a positive contribution of PML to oriP-mediated

replication. However, I also found that upon treatment with the transfection reagent, CNE2Z

cells depleted of PML exhibited a decrease in proliferation rate as well as a noticeable increase in

cell death as compared to PML-positive CNE2Z cells. In fact, unlike the transfected PML-

positive CNE2Z cells, I did not transfer the CNE2ZshPML cells from a small tissue culture dish

to a larger dish following transfection due to the aforementioned growth differences. It is

64

possible that when cells are depleted of PML and are deficient in PML-associated functions they

are considerably more sensitive to cellular stress, which may eventually lead to an increase in

cell death and explain the growth phenotype that I observed with the CNE2ZshPML cells. In

order to measure plasmid replication efficiency, cells are harvested 3 cell doublings post-

transfection. As oriP plasmids are subject to cellular replication licensing and only replicate once

per cell cycle, a decrease in growth rate will lead to a decrease in the amount of times the

plasmids will undergo replication by the normal 3 cell doubling time point. Therefore, the

decrease in oriP plasmid replication signal observed in CNE2ZshPML cells may be attributed to

a combination of (i) reduction in plasmid replication efficiency due to PML depletion and (ii)

decreased cell proliferation after transfection.

IV.5 Future Directions

Recently, Erle Roberston’s group has found that the kinetochore complex component,

Bub1, can interact with LANA, the KSHV structural homologue of EBNA1 (Xiao et al. 2010).

Using FISH, this group also found that Bub1 co-localizes with circular KSHV episomes as well

as LANA on mitotic chromosomes and particularly at the kinetochore. Moreover, depletion of

Bub1 caused a major reduction in KSHV genome maintenance in KSHV-positive cells (Xiao et

al. 2010). The authors proposed that Bub1 may play an important role in KSHV episomal

segregation and maintenance. It is possible that the cellular Bub1 protein may contribute to EBV

maintenance and possibly via interactions with EBNA1. It would be interesting to investigate

whether or not Bub1 can interact with EBNA1 in vitro and/or in vivo and if Bub1 contributes to

the oriP-mediated segregation function.

In 2004, Kanda et al. cloned the Akata-derived EBV genome into the bacterial artificial

chromosome (BAC) vector and developed a system for producing infectious EBV recombinants

(Kanda et al. 2004). I have found that the extra 9 repeats within the FR element of oriP

negatively affect plasmid replication efficiency but have a positive contribution to plasmid

maintenance. Therefore, it would be valuable to use a similar recombinant EBV system and

determine if the additional 9 repeats are advantageous in long-term maintenance of the entire

EBV episome. This could help our understanding of the reason for which the EBV virus has

evolved to maintain this number of repeats and is capable of persisting for the lifetime of its host.

65

Alternative splicing of the PML gene generates seven isoforms of PML protein of

varying sizes that share a common N-terminus but differ in their C-terminal cytoplasmic tails

(Jensen et al. 2001). Xueqi Wang in our laboratory has generated derivatives of the

CNE2ZshPML cell line that stably express each PML isoform (I to VI) at levels that are

comparable to that of endogenous PML. My results have suggested that PML may have a

positive role in DNA replication and it is possible that this function could be attributed to a

single or combination of PML isoforms. It would be interesting to analyze plasmid replication

efficiency in each of the derived CNE2ZshPML cell lines to determine if one of the PML

isoforms can fully or partially restore the reduced plasmid replication efficiency to a level that is

comparable to that of the parental PML-positive CNE2Z cell line. First, it is important to

determine the extent that the decreased proliferation rate may have contributed to the

considerable reduction in plasmid replication efficiency that I had observed in transfected

CNE2ZshPML cells. Essentially, the growth rate of a PML-depleted cell line must be

comparable to that of a PML-positive cell line. Transfection reagents can be toxic and cause

stress to treated cells, hence, finding a less toxic/stressful transfection reagent as well as

optimizing the reagent to DNA ratio and cell density conditions may be helpful and reduce the

amount of cell death that I previously observed. Therefore, once a clear association between

PML-depletion and reduced plasmid replication efficiency can be made, this will facilitate the

subsequent determination of which PML isoform(s) may be involved in DNA replication.

66

CHAPTER V: REFERENCES

Aiyar, A., S. Aras, et al. (2009). "Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-

plasmids by impeding replication and transcription fork migration through the family of

repeats." Virol J 6: 29.

Ali, A. K., S. Saito, et al. (2009). "Distinctive effects of the Epstein-Barr virus family of repeats

on viral latent gene promoter activity and B-lymphocyte transformation." J Virol 83(18):

9163-9174.

Altmann, M., D. Pich, et al. (2006). "Transcriptional activation by EBV nuclear antigen 1 is

essential for the expression of EBV's transforming genes." Proc Natl Acad Sci U S A

103(38): 14188-14193.

Ambinder, R. F., M. Mullen, et al. (1991). "Functional domains of Epstein-Barr nuclear antigen

EBNA-1." J. Virol. 65: 1466-1478.

Ambinder, R. F., W. A. Shah, et al. (1990). "Definition of the sequence requirements for binding

of the EBNA-1 protein to its palindromic target sites in Epstein-Barr virus DNA." J.

Virol. 64: 2369-2379.

Aravind, L. and D. Landsman (1998). "AT-hook motifs identified in a wide variety of DNA-

binding proteins." Nucleic Acids Res 26(19): 4413-4421.

Arias, E. E. and J. C. Walter (2007). "Strength in numbers: preventing rereplication via multiple

mechanisms in eukaryotic cells." Genes Dev 21(5): 497-518.

Atanasiu, C., Z. Deng, et al. (2006). "ORC binding to TRF2 stimulates OriP replication." EMBO

Rep 7(7): 716-721.

Avolio-Hunter, T. M. and L. Frappier (1998). "Mechanistic studies on the DNA linking activity

of the Epstein-Barr nuclear antigen 1." Nucl. Acids Res. 26: 4462-4470.

Avolio-Hunter, T. M., P. N. Lewis, et al. (2001). "Epstein-Barr nuclear antigen 1 binds and

destbilizes nucleosomes at the viral origin of latent DNA replication." Nucl. Acids Res.

29: 3520-3528.

Baer, R., A. T. Bankier, et al. (1984). "DNA sequence and expression of the B95-8 Epstein-Barr

virus genome." Nature 310: 207-211.

Ballestas, M. E., P. A. Chatis, et al. (1999). "Efficient persistence of extrachromosomal KSHV

DNA mediated by latency-associated nuclear antigen." Science 284: 641-644.

Barbera, A. J., M. E. Ballestas, et al. (2004). "The Kaposi's sarcoma-associated herpesvirus

latency-associated nuclear antigen 1 N terminus is essential for chromosome association,

DNA replication, and episome persistence." J Virol 78(1): 294-301.

67

Barbera, A. J., J. V. Chodaparambil, et al. (2006). "The nucleosomal surface as a docking station

for Kaposi's sarcoma herpesvirus LANA." Science 311(5762): 856-861.

Bashaw, J. M. and J. L. Yates (2001). "Replication from oriP of Epstein-Barr virus requires exact

spacing of two bound dimers of EBNA1 which bend DNA." J. Virol. 75: 10603-10611.

Bell, S. P. and A. Dutta (2002). "DNA replication in eukaryotic cells." Annu. Rev. Biochem. 71:

333-374.

Bernardi, R. and P. P. Pandolfi (2007). "Structure, dynamics and functions of promyelocytic

leukaemia nuclear bodies." Nat Rev Mol Cell Biol 8: 1006-1016.

Blake, N., S. Lee, et al. (1997). "Human CD8+ T cell responses to EBV EBNA1: HLA class I

presentation of the (GLY-ALA) containing protein requires exogenous processing."

Immunity 7: 791-802.

Blondel, D., T. Regad, et al. (2002). "Rabies virus P and small P products interact directly with

PML and reorganize PML nuclear bodies." Oncogene 21(52): 7957-7970.

Bochkarev, A., J. Barwell, et al. (1996). "Crystal structure of the DNA-binding domain of the

Epstein-Barr virus origin binding protein, EBNA1, bound to DNA." Cell 84: 791-800.

Bochkarev, A., J. Barwell, et al. (1995). "Crystal structure of the DNA binding domain of the

Epstein-Barr virus origin binding protein EBNA1." Cell 83: 39-46.

Bochkarev, A., E. Bochkareva, et al. (1998). "2.2A structure of a permanganate-sensitive DNA

site bound by the Epstein-Barr virus origin binding protein, EBNA1." J. Mol. Biol. 284:

1273-1278.

Boichuk, S., L. Hu, et al. (2011). "Functional Connection between Rad51 and PML in

Homology-Directed Repair." PLoS One 6(10): e25814.

Brooks, L., Q. Y. Yao, et al. (1992). "Epstein-Barr virus latent gene transcription in

nasopharyngeal carcinoma cells: coexpression of EBNA1, LMP1, and LMP2 transcripts."

J Virol 66(5): 2689-2697.

Bui, C. T., K. Rees, et al. (2003). "Permanganate oxidation reactions of DNA: perspective in

biological studies." Nucleosides Nucleotides Nucleic Acids 22(9): 1835-1855.

Ceccarelli, D. F. J. and L. Frappier (2000). "Functional Analyses of the EBNA1 origin DNA

binding protein of Epstein-Barr virus." J. Virol. 74: 4939-4948.

Chau, C. M. and P. M. Lieberman (2004). "Dynamic chromatin boundaries delineate a latency

control region of Epstein-Barr virus." J Virol 78(22): 12308-12319.

68

Chaudhuri, B., H. Xu, et al. (2001). "Human DNA replication initiation factors, ORC and MCM,

associate with oriP of Epstein-Barr virus." Proc. Natl. Acad. Sci. USA 98: 10085-10089.

Cheung, S. T., D. P. Huang, et al. (1999). "Nasopharyngeal carcinoma cell line (C666-1)

consistently harbouring Epstein-Barr virus." Int J Cancer 83: 121-126.

Cotter, M. A. and E. S. Robertson (1999). "The latency-associated nuclear antigen tethers the

Kaposi's sarcoma-associated herpesvirus genome to host genomes to host chromosomes

in body cavity-based lymphoma cells." Virol. 264: 254-264.

Crowder, C., O. Dahle, et al. (2005). "PML mediates IFN-alpha-induced apoptosis in myeloma

by regulating TRAIL induction." Blood 105(3): 1280-1287.

Cruickshank, J., A. Davidson, et al. (2000). "Two domains of the Epstein-Barr virus origin DNA

binding protein, EBNA1, orchestrate sequence-specific DNA binding." J. Biol. Chem.

275: 22273-22277.

Cummins, J. M., C. Rago, et al. (2004). "Tumour suppression: Disruption of HAUSP gene

stabilizes p53." Nature 428: 486-487.

Cummins, J. M. and B. Vogelstein (2004). "HAUSP is required for p53 destabilization." Cell

Cycle 3(6): 689-692.

Deacon, E. M., G. Pallesen, et al. (1993). "Epstein-Barr virus and Hodgkin's disease:

transcriptional analysis of virus latency in the malignant cells." J Exp Med 177(2): 339-

349.

Delecluse, H.-J., S. Bartnizke, et al. (1993). "Episomal and integrated copies of Epstein-Barr

virus coexist in Burkitt's lymphoma cell lines." J. Virol. 67: 1292-1299.

Delecluse, H. J., R. Feederle, et al. (2007). "Epstein Barr virus-associated tumours: an update for

the attention of the working pathologist." J Clin Pathol 60(12): 1358-1364.

Dellaire, G. and D. P. Bazett-Jones (2004). "PML nuclear bodies: dynamic sensors of DNA

damage and cellular stress." Bioessays 26(9): 963-977.

Deng, Z., C. Atanasiu, et al. (2003). "Telomere repeat binding factors TRF1, TRF2, and hRAP1

modulate replication of Epstein-Barr virus OriP." J Virol 77(22): 11992-12001.

Deng, Z., C. Atanasiu, et al. (2005). "Inhibition of Epstein-Barr virus OriP function by tankyrase,

a telomere-associated poly-ADP ribose polymerase that binds and modifies EBNA1." J

Virol 79(8): 4640-4650.

Deng, Z., L. Lezina, et al. (2002). "Telomeric proteins regulate episomal maintenance of

Epstein-Barr virus origin of plasmid replication." Mol. Cell 9: 493-503.

69

Deutsch, M. J., E. Ott, et al. (2010). "The latent origin of replication of Epstein-Barr virus directs

viral genomes to active regions of the nucleus." J Virol 84(5): 2533-2546.

Dhar, S. K., K. Yoshida, et al. (2001). "Replication from oriP of Epstein-Barr virus requires

human ORC and is inhibited by geminin." Cell 106: 287-296.

Dhar, V. and C. L. Schildkraut (1991). "Role of EBNA-1 in arresting replication forks at the

Epstein-Barr virus oriP family of tandem repeats." Mol. Cell. Biol. 11: 6268-6278.

Dheekollu, J., Z. Deng, et al. (2007). "A role for MRE11, NBS1, and recombination junctions in

replication and stable maintenance of EBV episomes." PLoS ONE 2(12): e1257.

Dheekollu, J. and P. M. Lieberman (2011). "The replisome pausing factor Timeless is required

for episomal maintenance of latent Epstein-Barr virus." J Virol 85(12): 5853-5863.

Di Croce, L. (2005). "Chromatin modifying activity of leukaemia associated fusion proteins."

Hum Mol Genet 14 Spec No 1: R77-84.

Dittmer, D. P., C. J. Hilscher, et al. (2008). "Multiple pathways for Epstein-Barr virus episome

loss from nasopharyngeal carcinoma." Int J Cancer 123(9): 2105-2112.

Djavani, M., J. Rodas, et al. (2001). "Role of the promyelocytic leukemia protein PML in the

interferon sensitivity of lymphocytic choriomeningitis virus." J Virol 75(13): 6204-6208.

Edwards, A. M., A. Bochkarev, et al. (1998). "Origin DNA -binding proteins." Curr. Opin.

Struct. Biol. 8: 49-53.

Epstein, M. A., B. G. Achong, et al. (1964). "Virus Particles in Cultured Lymphoblasts from

Burkitt's Lymphoma." Lancet 1(7335): 702-703.

Ermakova, O., L. Frappier, et al. (1996). "Role ot the EBNA-1 protein in pausing of replication

forks in the Epstein-Barr virus genome." J. Biol. Chem. 271: 33009-33017.

Everett, R. D. (2001). "DNA viruses and viral proteins that interact with PML nuclear bodies."

Oncogene 20(49): 7266-7273.

Everett, R. D. and M. K. Chelbi-Alix (2007). "PML and PML nuclear bodies: implications in

antiviral defence." Biochimie 89(6-7): 819-830.

Everett, R. D. and J. Murray (2005). "ND10 components relocate to sites associated with herpes

simplex virus type 1 nucleoprotein complexes during virus infection." J Virol 79(8):

5078-5089.

Everett, R. D., S. Rechter, et al. (2006). "PML contributes to a cellular mechanism of repression

of herpes simplex virus type 1 infection that is inactivated by ICP0." J Virol 80(16):

7995-8005.

70

Fahraeus, R. (2005). "Do peptides control their own birth and death?" Nat Rev Mol Cell Biol

6(3): 263-267.

Fahraeus, R., H. L. Fu, et al. (1988). "Expression of Epstein-Barr virus-encoded proteins in

nasopharyngeal carcinoma." Int J Cancer 42(3): 329-338.

Fingeroth, J. D., J. J. Weis, et al. (1984). "Epstein-Barr virus receptor of human B lymphocytes is

the C3d receptor CR2." Proc Natl Acad Sci U S A 81(14): 4510-4514.

Frappier, L. (2010). EBNA1 in Viral DNA Replication and Persistence. Epstein-Barr Virus:

Latency and Transformation. E. S. Robertson. Norwich, Caister Academic Press: 37-59.

Frappier, L., K. Goldsmith, et al. (1994). "Stabilization of the EBNA1 protein on the Epstein-

Barr virus latent origin of DNA replication by a DNA looping mechanism." J. Biol.

Chem. 269: 1057-1062.

Frappier, L. and M. O'Donnell (1991). "Epstein-Barr nuclear antigen 1 mediates a DNA loop

within the latent replication origin of Epstein-Barr virus." Proc. Natl. Acad. Sci. USA 88:

10875-10879.

Frappier, L. and M. O'Donnell (1991). "Overproduction, purification and characterization of

EBNA1, the origin binding protein of Epstein-Barr virus." J. Biol. Chem. 266: 7819-

7826.

Frappier, L. and M. O'Donnell (1992). "EBNA1 distorts oriP, the Epstein-Barr virus latent

replication origin." J. Virol. 66: 1786-1790.

Fruscalzo, A., G. Marsili, et al. (2001). "DNA sequence heterogeneity within the Epstein-Barr

virus family of repeats in the latent origin of replication." Gene 265(1-2): 165-173.

Fukayama, M. (2010). "Epstein-Barr virus and gastric carcinoma." Pathol Int 60(5): 337-350.

Fukayama, M., R. Hino, et al. (2008). "Epstein-Barr virus and gastric carcinoma: virus-host

interactions leading to carcinoma." Cancer Sci 99(9): 1726-1733.

Gahn, T. and B. Sugden (1995). "An EBNA1 Dependent enhancer acts from a distance of 10

kilobase pairs to increase expression of the Epstien-Barr virus LMP gene." J. Virol. 69:

2633-2636.

Gahn, T. A. and C. L. Schildkraut (1989). "The Epstein-Barr virus origin of plasmid replication,

oriP, contains both the initiation and termination sites of DNA replication." Cell 58: 527-

535.

Gerber, P., S. Lucas, et al. (1972). "Oral excretion of Epstein-Barr virus by healthy subjects and

patients with infectious mononucleosis." Lancet 2(7785): 988-989.

71

Gotter, A. L., C. Suppa, et al. (2007). "Mammalian TIMELESS and Tipin are evolutionarily

conserved replication fork-associated factors." J Mol Biol 366(1): 36-52.

Grogan, E. A., W. P. Summers, et al. (1983). "Two Epstein-Barr viral nuclear neoantigens

distinguished by gene transfer, serology and chromosome binding." Proc. Natl. Acad. Sci.

USA 80: 7650-7653.

Hammerschmidt, W. and B. Sugden (2004). "Epstein-Barr virus sustains Burkitt's lymphomas

and Hodgkin's disease." Trends Mol Med 10(7): 331-336.

Harris, A., B. D. Young, et al. (1985). "Random association of Epstein-Barr virus genomes with

host cell metaphase chromosomes in Burkitt's lymphoma-derived cell lines." J. Virol. 56:

328-332.

Harrison, S., K. Fisenne, et al. (1994). "Sequence requirements of the Epstein-Barr virus latent

origin of DNA replication." J Virol 68(3): 1913-1925.

Hegde, R. S., S. R. Grossman, et al. (1992). "Crystal structure at 1.7Å of the bovine

papillomavirus-1 E2 DNA-binding protein bound to its DNA target." Nature 359: 505-

512.

Henle, G. and W. Henle (1976). "Epstein-Barr virus-specific IgA serum antibodies as an

outstanding feature of nasopharyngeal carcinoma." Int J Cancer 17(1): 1-7.

Hieter, P., C. Mann, et al. (1985). "Mitotic stability of yeast chromosomes: A colony color assay

that measures nondisjunction and chromosome loss." Cell 40: 381-392.

Hirt, B. (1967). "Selective extraction of polyoma DNA from infected mouse cell culture." J. Mol.

Biol. 26: 365-369.

Holowaty, M. N., Y. Sheng, et al. (2003). "Protein interaction domains of the ubiqutin specific

protease, USP7/HAUSP." J. Biol. Chem. 278: 47753-47761.

Holowaty, M. N., M. Zeghouf, et al. (2003). "Protein profiling with Epstein-Barr nuclear antigen

1 reveals an interaction with the herpesvirus-associated ubiquitin-specific protease

HAUSP/USP7." J. Biol. Chem. 278: 29987-29994.

Hong, M., Y. Murai, et al. (2006). "Suppression of Epstein-Barr nuclear antigen 1 (EBNA1) by

RNA interference inhibits proliferation of EBV-positive Burkitt's lymphoma cells." J

Cancer Res Clin Oncol 132(1): 1-8.

Hsieh, D.-J., S. M. Camiolo, et al. (1993). "Constitutive binding of EBNA1 protein to the

Epstein-Barr virus replication origin, oriP, with distortion of DNA structure during latent

infection." EMBO J. 12: 4933-4944.

72

Huang, D. P., H. C. Ho, et al. (1978). "Presence of EBNA in nasopharyngeal carcinoma and

control patient tissues related to EBV serology." Int J Cancer 22(3): 266-274.

Hung, S. C., M.-S. Kang, et al. (2001). "Maintenance of Epstein-Barr virus (EBV) oriP-based

episomes requires EBV-encoded nuclear antigen-1 chromosome-binding domains, which

can be replaced by high-mobility group-I or histone H1." Proc. Natl. Acad. Sci. USA 98:

1865-1870.

Ilves, I., S. Kivi, et al. (1999). "Long-term episomal maintenance of bovine papillomavirus type

1 plasmids is determined by attachment to host chromosomes, which is mediated by the

viral E2 protein and its binding sites." J. Virol. 73: 4404-4412.

Inman, G. J. (2011). "Switching TGFbeta from a tumor suppressor to a tumor promoter." Curr

Opin Genet Dev 21(1): 93-99.

Ishimi, Y. (1997). "A DNA helicase activity is associated with an MCM4,-6,-7 protein

complex." J. Biol. Chem. 272: 24508-24513.

Ishov, A. M. and G. G. Maul (1996). "The periphery of nuclear domain 10 (ND10) as site of

DNA virus deposition." J Cell Biol 134(4): 815-826.

Jankelevich, S., J. L. Kolman, et al. (1992). "A nuclear matrix attachment region organizes the

Epstein-Barr viral plasmid in Raji cells into a single DNA domain." EMBO J 11: 1165-

1176.

Jensen, K., C. Shiels, et al. (2001). "PML protein isoforms and the RBCC/TRIM motif."

Oncogene 20(49): 7223-7233.

Jones, C. H., S. D. Hayward, et al. (1989). "Interaction of the lymphocyte-derived Epstein-Barr

virus nuclear antigen EBNA-1 with its DNA-binding sites." J. Virol. 63: 101-110.

Julien, M. D., Z. Polonskaya, et al. (2004). "Protein and sequence requirements for the

recruitment of the human origin recognition complex to the latent cycle origin of DNA

replication of Epstein-Barr virus oriP." Virology 326(2): 317-328.

Kanda, T., M. Kamiya, et al. (2007). "Symmetrical localization of extrachromosomally

replicating viral genomes on sister chromatids." J Cell Sci 120(Pt 9): 1529-1539.

Kanda, T., M. Otter, et al. (2001). "Coupling of mitotic chromosome tethering and replication

competence in Epstein-Barr virus-based plasmids." Mol. Cell. Biol. 21: 3576-3588.

Kanda, T., M. Yajima, et al. (2004). "Production of high-titer Epstein-Barr virus recombinants

derived from Akata cells by using a bacterial artificial chromosome system." J Virol

78(13): 7004-7015.

73

Kang, M. S., S. C. Hung, et al. (2001). "Epstein-Barr virus nuclear antigen 1 activates

transcription from episomal but not integrated DNA and does not alter lymphocyte

growth." Proc Natl Acad Sci U S A 98(26): 15233-15238.

Kang, M. S., H. Lu, et al. (2005). "Epstein-Barr virus nuclear antigen 1 does not induce

lymphoma in transgenic FVB mice." Proc Natl Acad Sci U S A 102(3): 820-825.

Kang, M. S., V. Soni, et al. (2008). "Epstein-Barr Virus Nuclear Antigen 1 does not cause

lymphoma in C57BL/6J mice." J Virol 82: 4180-4183.

Kapoor, P. and L. Frappier (2003). "EBNA1 partitions Epstein-Barr virus plasmids in yeast by

attaching to human EBNA1-binding protein 2 on mitotic chromosomes." J. Virol. 77:

6946-6956.

Kapoor, P., B. D. Lavoie, et al. (2005). "EBP2 plays a key role in Epstein-Barr virus mitotic

segregation and is regulated by aurora family kinases." Mol Cell Biol 25(12): 4934-4945.

Kapoor, P., K. Shire, et al. (2001). "Reconstitution of Epstein-Barr virus-based plasmid

partitioning in budding yeast." EMBO J. 20: 222-230.

Kennedy, G., J. Komano, et al. (2003). "Epstein-Barr virus provide a survival factor to Burkitt's

lymphomas." Proc. Natl. Acad. Sci. 100: 14269-14274.

Kennedy, G. and B. Sugden (2003). "EBNA-1, a bifunctional transcriptional activator." Mol Cell

Biol 23(19): 6901-6908.

Kieff, E. (1996). Epstein-Barr virus and its replication. Fields Virology. D. M. K. B.N. Fields,

P.M. Howley. Philadelphia, Lippincott-Raven Publishers: 2343-2396.

Kieff, E. and A. B. Rickinson (2001). Epstein-Barr virus and its replication. Fields Virology. D.

M. Knipe and P. M. Howley. Philadelphia, Lippincott Williams and Wilkins. 2: 2511-

2573.

Kirchmaier, A. L. and B. Sugden (1997). "Dominant-negative inhibitors of EBNA1 of Epstein-

Barr virus." J. Virol. 71: 1766-1775.

Klein, E., L. L. Kis, et al. (2007). "Epstein-Barr virus infection in humans: from harmless to life

endangering virus-lymphocyte interactions." Oncogene 26(9): 1297-1305.

Koons, M. D., S. Van Scoy, et al. (2001). "The replicator of the Epstein-Barr virus latent cycle

origin of DNA replication, oriP, is composed of multiple functional elements." J. Virol.

75: 10582-10592.

Krishnakumar, R. and W. L. Kraus (2010). "The PARP side of the nucleus: molecular actions,

physiological outcomes, and clinical targets." Mol Cell 39(1): 8-24.

74

Krysan, P. J., S. B. Haase, et al. (1989). "Isolation of human sequences that replicate

autonomously in human cells." Mol. Cell. Biol. 9: 1026-1033.

Kutok, J. L. and F. Wang (2006). "Spectrum of Epstein-Barr virus-associated diseases." Annu

Rev Pathol 1: 375-404.

Labib, K., S. E. Kearsey, et al. (2001). "MCM2-7 proteins are essential components of

prereplicative complexes that accumulate cooperatively in the nucleus during G1-phase

and are required to establish, but not maintain, the S-phase checkpoint." Mol Biol Cell

12(11): 3658-3667.

Lear, A. L, Rowe M, et al. (1992). " The Epstein-Barr virus (EBV) nuclear antigen 1 BamHI F

promoter is activated on entry of EBV-transformed B cells into the lytic cycle." J. Virol.

66 : 7461-7468

Langle-Rouault, F., V. Patzel, et al. (1998). "Up to 100-fold increase of apparent gene expression

in the presence of Epstein-Barr virus oriP sequences and EBNA1: Implications of the

nuclear import of plasmids." J. Virol. 72: 6181-6185.

Lehman, C. W. and M. R. Botchan (1998). "Segregation of viral plasmids depends on tethering

to chromosomes and is regulated by phosphorylation." Proc. Natl. Acad. Sci. USA 95:

4338-4343.

Leman, A. R., C. Noguchi, et al. (2010). "Human Timeless and Tipin stabilize replication forks

and facilitate sister-chromatid cohesion." J Cell Sci 123(Pt 5): 660-670.

Li, M., C. L. Brooks, et al. (2004). "A dynamic role of HAUSP in the p53-Mdm2 pathway."

Mol. Cell 13: 879-886.

Li, M., D. Chen, et al. (2002). "Deubiquitination of p53 by HAUSP is an important pathway for

p53 stabilization." Nature 416(6881): 648-653.

Li, Q., M. K. Spriggs, et al. (1997). "Epstein-Barr virus uses HLA class II as a cofactor for

infection of B lymphocytes." J Virol 71(6): 4657-4662.

Lin, A., S. Wang, et al. (2008). "The EBNA1 protein of Epstein-Barr virus functionally interacts

with Brd4." J Virol 82(24): 12009-12019.

Little, R. D. and C. L. Schildkraut (1995). "Initiation of latent DNA replicatoon in the Epstein-

Barr virus genome can occur at sites other than the genetically defined origin." Mol. Cell.

Biol. 15: 2893-2903.

Lupton, S. and A. J. Levine (1985). "Mapping of genetic elements of Epstein-Barr virus that

facilitate extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human

cells." Mol. Cell. Biol. 5: 2533-2542.

75

Mackey, D., T. Middleton, et al. (1995). "Multiple regions within EBNA1 can link DNAs." J.

Virol. 69: 6199-6208.

Mackey, D. and B. Sugden (1999). "The linking regions of EBNA1 are essential for its support

of replication and transcription." Mol. Cell. Biol. 19: 3349-3359.

Marechal, V., A. Dehee, et al. (1999). "Mapping EBNA1 domains involved in binding to

metaphse chromosomes." J. Virol. 73: 4385-4392.

Mayer, M. L., I. Pot, et al. (2004). "Identification of protein complexes required for efficient

sister chromatid cohesion." Mol Biol Cell 15(4): 1736-1745.

McPhillips, M. G., J. G. Oliveira, et al. (2006). "Brd4 is required for E2-mediated transcriptional

activation but not genome partitioning of all papillomaviruses." J Virol 80(19): 9530-

9543.

Middleton, T. and B. Sugden (1992). "EBNA1 can link the enhancer element to the initiator

element of the Epstein-Barr virus plasmid origin of DNA replication." J. Virol. 66: 489-

495.

Miller, G., A. El-Guindy, et al. (2007). "Lytic cycle switches of oncogenic human

gammaherpesviruses(1)." Adv Cancer Res 97: 81-109.

Mirkin, E. V. and S. M. Mirkin (2007). "Replication fork stalling at natural impediments."

Microbiol Mol Biol Rev 71(1): 13-35.

Najjar, I. and R. Fagard (2010). "STAT1 and pathogens, not a friendly relationship." Biochimie

92(5): 425-444.

Nayyar, V. K., K. Shire, et al. (2009). "Mitotic chromosome interactions of Epstein-Barr nuclear

antigen 1 (EBNA1) and human EBNA1-binding protein 2 (EBP2)." J Cell Sci 122(Pt 23):

4341-4350.

Nieduszynski, C. A., Donaldson, A. D. and Blow, J. J. (2001). "Chromosome replication: from

ORC to fork." Genome biology 2: 4031-4031.4032.

Niller, H. H., G. Glaser, et al. (1995). "Nucleoprotein complexes and DNA 5'-ends at oriP of

Epstein-Barr virus." J. Biol. Chem. 270: 12864-12868.

Norio, P. and C. L. Schildkraut (2001). "Visualization of DNA replication on individual Epstein-

Barr virus episomes." Science 294: 2361-2364.

Norio, P. and C. L. Schildkraut (2004). "Plasticity of DNA replication initiation in Epstein-Barr

virus episomes." PLoS Biol 2(6): e152.

76

Norseen, J., A. Thomae, et al. (2008). "RNA-dependent recruitment of the origin recognition

complex." Embo J 27(22): 3024-3035.

Petti, L., C. Sample, et al. (1990). "Subnuclear localization and phosphorylation or Epstein-Barr

virus latent infection nuclear proteins." Virology 176: 563-574.

Platt, T. H., I. Y. Tcherepanova, et al. (1993). "Effect of number and position of EBNA-1

binding sites in Epstein-Barr virus oriP on the sites of initiation, barrier formation, and

termination of replication." J Virol 67(3): 1739-1745.

Raab-Traub, N. (2002). "Epstein-Barr virus in the pathogenesis of NPC." Semin Cancer Biol

12(6): 431-441.

Raab-Traub, N. and K. Flynn (1986). "The structure of the termini of the Epstein-Barr virus as a

marker of clonal cellular proliferation." Cell 47(6): 883-889.

Rawlins, D. R., G. Milman, et al. (1985). "Sequence-specific DNA binding of the Epstein-Barr

virus nuclear antigen (EBNA1) to clustered sites in the plasmid maintenance region."

Cell 42: 859-868.

Rehtanz, M., H. M. Schmidt, et al. (2004). "Direct interaction between nucleosome assembly

protein 1 and the papillomavirus E2 proteins involved in activation of transcription." Mol

Cell Biol 24(5): 2153-2168.

Reichelt, M., L. Wang, et al. (2011). "Entrapment of viral capsids in nuclear PML cages is an

intrinsic antiviral host defense against varicella-zoster virus." PLoS Pathog 7(2):

e1001266.

Reisman, D. and B. Sugden (1986). "trans Activation of an Epstein-Barr viral transcripitonal

enhancer by the Epstein-Barr viral nuclear antigen 1." Mol. Cell. Biol. 6: 3838-3846.

Reisman, D., J. Yates, et al. (1985). "A putative origin of replication of plasmids derived from

Epstein-Barr virus is composed of two cis-acting components." Mol Cell Biol 5(8): 1822-

1832.

Reisman, D., J. Yates, et al. (1985). "A putative origin of replication of plasmids derived from

Epstein-Barr virus is composed of two cis-acting components." Mol. Cell. Biol 5: 1822-

1832.

Rickinson, A. B. and E. Kieff (1996). Epstein-Barr virus. Fields Virology. D. M. K. B.N. Fields,

P.M. Knipe, P.M. Howley. Philadelphia, Lippincott-Raven Publishers: 2397-2446.

Rickinson, A. B. and E. Kieff (2001). Epstein-Barr virus. Fields Virology. D. M. Knipe and P.

M. Howley. Philadelphia, Lippincott Williams and Wilkins: 2575-2627.

77

Rogers, R. P., M. Woisetschlaeger, et al. (1990). "Alternative splicing dictates translational start

in Epstein-Barr virus transcripts." EMBO J 9(7): 2273-2277.

Sample, J., E. B. D. Henson, et al. (1992). "The Epstein-Barr virus nuclear protein 1 promoter

active in type I latency is autoregulated." J. Virol. 66: 4654-4661.

Saridakis, V., Y. Sheng, et al. (2005). "Structure of the p53 binding domain of HAUSP/USP7

bound to Epstein-Barr nuclear antigen 1 implications for EBV-mediated

immortalization." Mol Cell 18(1): 25-36.

Sarkari, F., X. Wang, et al. (2011). "The herpesvirus associated ubiquitin specific protease,

USP7, is a negative regulator of PML proteins and PML nuclear bodies." PLoS One 6(1):

e16598.

Scaglioni, P. P., T. M. Yung, et al. (2006). "A CK2-dependent mechanism for degradation of the

PML tumor suppressor." Cell 126(2): 269-283.

Schaefer, B. C., J. L. Strominger, et al. (1995). "Redefining the Epstein-Barr virus-encoded

nuclear antigen EBNA-1 gene promoter and transcription initiation site in group I Burkitt

lymphoma cell lines." Proc Natl Acad Sci U S A 92(23): 10565-10569.

Schepers, A., M. Ritzi, et al. (2001). "Human origin recognition complex binds to the region of

the latent origin of DNA replication of Epstein-Barr virus." EMBO J. 20: 4588-4602.

Sears, J., J. Kolman, et al. (2003). "Metaphase chromosome tethering is necessary for the DNA

synthesis and maintenance of oriP plasmids but is insufficient for transcription activation

by Epstein-Barr nuclear antigen 1." J Virol 77(21): 11767-11780.

Sears, J., M. Ujihara, et al. (2004). "The amino terminus of Epstein-Barr Virus (EBV) nuclear

antigen 1 contains AT hooks that facilitate the replication and partitioning of latent EBV

genomes by tethering them to cellular chromosomes." J Virol 78(21): 11487-11505.

Seto, E., L. Yang, et al. (2005). "Epstein-Barr virus (EBV)-encoded BARF1 gene is expressed in

nasopharyngeal carcinoma and EBV-associated gastric carcinoma tissues in the absence

of lytic gene expression." J Med Virol 76(1): 82-88.

Shah, K. M. and L. S. Young (2009). "Epstein-Barr virus and carcinogenesis: beyond Burkitt's

lymphoma." Clin Microbiol Infect 15(11): 982-988.

Shah, W. A., R. F. Ambinder, et al. (1992). "Binding of EBNA-1 to DNA creates a protease-

resistant domain that encompasses the DNA recognition and dimerization functions." J.

Virology 66: 3355-3362.

Shanmugaratnam, K. (1978). "Histological typing of nasopharyngeal carcinoma." IARC Sci

Publ(20): 3-12.

78

Shannon-Lowe, C., E. Adland, et al. (2009). "Features distinguishing Epstein-Barr virus

infections of epithelial cells and B cells: viral genome expression, genome maintenance,

and genome amplification." J Virol 83(15): 7749-7760.

Shaw, J., L. Levinger, et al. (1979). "Nucleosomal structure of Epstein-Barr virus DNA in

transformed cell lines." J. Virol. 29: 657-665.

Shire, K., D. F. J. Ceccarelli, et al. (1999). "EBP2, a human protein that interacts with sequences

of the Epstein-Barr nuclear antigen 1 important for plasmid maintenance." J. Virol. 73:

2587-2595.

Shire, K., P. Kapoor, et al. (2006). "Regulation of the EBNA1 Epstein-Barr virus protein by

serine phosphorylation and arginine methylation." J Virol 80(11): 5261-5272.

Silla, T., I. Haal, et al. (2005). "Episomal maintenance of plasmids with hybrid origins in mouse

cells." J Virol 79(24): 15277-15288.

Simpson, K., A. McGuigan, et al. (1996). "Stable episomal maintenance of yeast artificial

chromosomes in human cells." Mol. Cell. Biol. 16: 5117-5126.

Sivachandran, N., J. Y. Cao, et al. (2010). "Epstein-Barr virus nuclear antigen 1 Hijacks the host

kinase CK2 to disrupt PML nuclear bodies." J Virol 84(21): 11113-11123.

Sivachandran, N., C. W. Dawson, et al. (2011). "Contributions of the Epstein-Barr Virus EBNA1

Protein to Gastric Carcinoma." J Virol.

Sivachandran, N., F. Sarkari, et al. (2008). "Epstein-Barr nuclear antigen 1 contributes to

nasopharyngeal carcinoma through disruption of PML nuclear bodies." PLoS Pathog

4(10): e1000170.

Sivachandran, N., F. Sarkari, et al. (2008). "Epstein-Barr Nuclear Antigen 1 Contributes to

Nasopharyngeal Carcinoma through the Disruption of PML Nuclear Bodies." PLoS

Pathogens 4(10): e1000170.

Sivachandran, N., N. N. Thawe, et al. (2011). "Epstein-Barr virus nuclear antigen 1 replication

and segregation functions in nasopharyngeal carcinoma cell lines." J Virol 85(19):

10425-10430.

Skalsky, R. L., J. Hu, et al. (2007). "Analysis of viral cis elements conferring Kaposi's sarcoma-

associated herpesvirus episome partitioning and maintenance." J Virol 81(18): 9825-

9837.

Smith-Roe, S. L., S. S. Patel, et al. (2011). "Timeless functions independently of the Tim-Tipin

complex to promote sister chromatid cohesion in normal human fibroblasts." Cell Cycle

10(10): 1618-1624.

79

Sternas, L., T. Middleton, et al. (1990). "The average number of molecules of Epstein-Barr

nuclear antigen 1 per cell does not correlate with the average number of Epstein-Barr

virus (EBV) DNA molecules per cell among different clones of EBV-immortalized

cells." J.Virol. 64: 2407-2410.

Su, W., T. Middleton, et al. (1991). "DNA looping between the origin of replication of Epstein-

Barr virus and its enhancer site: stabilization of an origin complex with Epstein-Barr

nuclear antigen 1." Proc. Natl. Acad. Sci. USA 88: 10870-10874.

Sugden, B., K. Marsh, et al. (1985). "A vector that replicates as a plasmid and can be efficiently

selected in B-lymphoblasts transformed by Epstein-Barr virus." Mol Cell Biol 5(2): 410-

413.

Sugden, B. and N. Warren (1989). "A promoter of Epstein-Barr virus that can function during

latent infection can be transactivated by EBNA-1, a viral protein required for viral DNA

replication during latent infection." J Virol 63(6): 2644-2649.

Summers, H., J. A. Barwell, et al. (1996). "Cooperative assembly of EBNA1 on the Epstein-Barr

virus latent origin of replication." J. Virol. 70: 1228-1231.

Summers, H., A. Fleming, et al. (1997). "Requirements for EBNA1-induced permanganate

sensitivity of the Epstein-Barr virus latent origin of DNA replication." J. Biol. Chem.

272: 26434-26440.

Sun, Y., G. Hegamyer, et al. (1992). "An infrequent point mutation of the p53 gene in human

nasopharyngeal carcinoma." Proc Natl Acad Sci U S A 89(14): 6516-6520.

Takeda, D. Y., Y. Shibata, et al. (2005). "Recruitment of ORC or CDC6 to DNA is sufficient to

create an artificial origin of replication in mammalian cells." Genes Dev 19(23): 2827-

2836.

Tang, Q., P. Bell, et al. (2000). "Replication but not transcription of simian virus 40 DNA is

dependent on nuclear domain 10." J Virol 74(20): 9694-9700.

Tellam, J., M. H. Fogg, et al. (2007). "Influence of translation efficiency of homologous viral

proteins on the endogenous presentation of CD8+ T cell epitopes." J Exp Med 204(3):

525-532.

Tempera, I., Z. Deng, et al. (2010). "Regulation of Epstein-Barr virus OriP replication by

poly(ADP-ribose) polymerase 1." J Virol 84(10): 4988-4997.

Thorley-Lawson, D. A. (2001). "Epstein-Barr virus: exploiting the immune system." Nat Rev

Immunol 1(1): 75-82.

Thorley-Lawson, D. A. and M. J. Allday (2008). "The curious case of the tumour virus: 50 years

of Burkitt's lymphoma." Nat Rev Microbiol 6(12): 913-924.

80

Thorley-Lawson, D. A., E. M. Miyashita, et al. (1996). "Epstein-Barr virus and the B cell: that's

all it takes." Trends in Microbiology 4: 204-208.

Uozaki, H. and M. Fukayama (2008). "Epstein-Barr virus and gastric carcinoma--viral

carcinogenesis through epigenetic mechanisms." Int J Clin Exp Pathol 1(3): 198-216.

Van Scoy, S., I. Watakabe, et al. (2000). "Human p32: A coactivator for Epstein-Barr virus

nuclear antigen-1-mediated transcriptional activation and possible role in viral latent

cycle DNA replication." Virol. 275: 145-157.

Wang, S. and L. Frappier (2009). "Nucleosome Assembly Proteins Bind to Epstein-Barr Nuclear

Antigen 1 (EBNA1) and Affect its Functions in DNA Replication and Transcriptional

Activation." J. Virol. 83: 11704-11714.

Wang, Y., J. E. Finan, et al. (1997). "P32/TAP, a cellular protein that interacts with EBNA-1 of

Epstein-Barr virus." Virology 236: 18-29.

White, R. E., R. Wade-Martin, et al. (2001). "Sequences adjacent to oriP improve the persistence

of Epstein-Barr virus-based episomes in B cells." J. Virol. 75: 11249-11252.

Wilson, J. B., J. L. Bell, et al. (1996). "Expression of Epstein-Barr virus nuclar antigen-1 induces

B cell neoplasia in transgenic mice." EMBO 15: 3117-3126.

Woisetschlaeger, M., C. N. Yandava, et al. (1990). "Promoter switching in Epstein-Barr virus

during the initial stages of infection of B lymphocytes." Proc Natl Acad Sci U S A 87(5):

1725-1729.

Wood, V. H., J. D. O'Neil, et al. (2007). "Epstein-Barr virus-encoded EBNA1 regulates cellular

gene transcription and modulates the STAT1 and TGFbeta signaling pathways."

Oncogene 26(28): 4135-4147.

Wu, H., D. F. J. Ceccarelli, et al. (2000). "The DNA segregation mechanism of the Epstein-Barr

virus EBNA1 protein." EMBO Rep. 1: 140-144.

Wu, H., P. Kapoor, et al. (2002). "Separation of the DNA replication, segregation, and

transcriptional activation functions of Epstein-Barr nuclear antigen 1." J Virol 76(5):

2480-2490.

Wysokenski, D. A. and J. L. Yates (1989). "Multiple EBNA1-binding sites are required to form

an EBNA1-dependent enhancer and to activate a minimal replicative origin within oriP

of Epstein-Barr virus." J. Virol. 63: 2657-2666.

Xiao, B., S. C. Verma, et al. (2010). "Bub1 and CENP-F can contribute to Kaposi's sarcoma-

associated herpesvirus genome persistence by targeting LANA to kinetochores." J Virol

84(19): 9718-9732.

81

Yates, J. L. and S. M. Camiolo (1988). "Dissection of DNA replication and enhancer activation

functions of Epstein-Barr virus nuclear antigen 1." Cancer Cells 6: 197-205.

Yates, J. L., S. M. Camiolo, et al. (2000). "The minimal replicator of Epstein-Barr virus oriP." J.

Virol 74: 4512-4522.

Yates, J. L. and N. Guan (1991). "Epstein-Barr virus-derived plasmids replicate only once per

cell cycle and are not amplified after entry into cells." J. Virol. 65: 483-488.

Yates, J. L., N. Warren, et al. (1984). "A cis-acting element from the Epstein-Barr viral genome

that permits stable replication of recombinant plasmids in latently infected cells." Proc.

Natl. Acad. Sci. USA 81: 3806-3810.

Yates, J. L., N. Warren, et al. (1985). "Stable replication of plasmids derived from Epstein-Barr

virus in various mammalian cells." Nature 313(6005): 812-815.

Yates, J. L., N. Warren, et al. (1985). "Stable replication of plasmids derived from Epstein-Barr

virus in various mammalian cells." Nature 313: 812-815.

Yin, Q. and E. K. Flemington (2006). "siRNAs against the Epstein Barr virus latency replication

factor, EBNA1, inhibit its function and growth of EBV-dependent tumor cells." Virology

346(2): 385-393.

Yin, Y., B. Manoury, et al. (2003). "Self-inhibition of synthesis and antigen presentation by

Epstein-Barr virus-encoded EBNA1." Science 301(5638): 1371-1374.

Yoshioka, M., M. M. Crum, et al. (2008). "Autorepression of Epstein-Barr virus nuclear antigen

1 expression by inhibition of pre-mRNA processing." J Virol 82(4): 1679-1687.

You, J., J. L. Croyle, et al. (2004). "Interaction of the bovine papillomavirus E2 protein with

Brd4 tethers the viral DNA to host mitotic chromosomes." Cell 117: 349-360.

You, J., V. Srinivasan, et al. (2006). "Kaposi's Sarcoma-Associated Herpesvirus Latency-

Associated Nuclear Antigen Interacts with Bromodomain Protein Brd4 on Host Mitotic

Chromosomes." J Virol 80(18): 8909-8919.

Young, L. S. and P. G. Murray (2003). "Epstein-Barr virus and oncogenesis: from latent genes to

tumours." Oncogene 22(33): 5108-5121.

Yu, L., P. M. Loewenstein, et al. (1995). "In vitro interaction of the human immunodeficiency

virus type 1 Tat transactivator and the general transcription factor TFIIB with the cellular

protein TAP." J. Virol. 69: 3017-3023.

Yu, M. C., J. H. Ho, et al. (1986). "Cantonese-style salted fish as a cause of nasopharyngeal

carcinoma: report of a case-control study in Hong Kong." Cancer Res 46(2): 956-961.

82

Yuan, J., E. Cahir-McFarland, et al. (2006). "Virus and cell RNAs expressed during Epstein-Barr

virus replication." J Virol 80(5): 2548-2565.

Zhang, D., L. Frappier, et al. (1998). "Human RPA (hSSB) interacts with EBNA1, the latent

origin binding protein of Epstein-Barr virus." Nucl. Acid Res. 26: 631-637.

Zhou, J., C. M. Chau, et al. (2005). "Cell cycle regulation of chromatin at an origin of DNA

replication." Embo J 24(7): 1406-1417.

Zhou, J., Z. Deng, et al. (2010). "Regulation of Epstein-Barr virus origin of plasmid replication

(OriP) by the S-phase checkpoint kinase Chk2." J Virol 84(10): 4979-4987.

Zhou, J., A. R. Snyder, et al. (2009). "Epstein-Barr virus episome stability is coupled to a delay

in replication timing." J Virol 83(5): 2154-2162.

zur Hausen, H., H. Schulte-Holthausen, et al. (1970). "EBV DNA in biopsies of Burkitt tumours

and anaplastic carcinomas of the nasopharynx." Nature 228(5276): 1056-1058.