RESEARCH ARTICLE

Control of root cap maturation and cell detachment by BEARSKINtranscription factors in ArabidopsisMasako Kamiya1, Shin-Ya Higashio1, Atsushi Isomoto1, Jong-Myong Kim2, Motoaki Seki2,Shunsuke Miyashima1 and Keiji Nakajima1,*

ABSTRACTThe root cap supports root growth by protecting the root meristem,sensing gravity and interacting with the rhizosphere throughmetabolite secretion and cell dispersal. Sustained root capfunctions therefore rely on balanced proliferation of proximal stemcells and regulated detachment of distal mature cells. Although thegene regulatory network that governs stem cell activity in the root caphas been extensively studied in Arabidopsis, the mechanisms bywhich root cap cells mature and detach from the root tip are poorlyunderstood. We performed a detailed expression analysis of threeregulators of root cap differentiation, SOMBRERO, BEARSKIN1 andBEARSKIN2, and identified their downstream genes. Our resultsindicate that expression of BEARSKIN1 and BEARSKIN2 isassociated with cell positioning on the root surface. We identified aglycosyl hydrolase 28 (GH28) family polygalacturonase (PG) gene asa direct target of BEARSKIN1. Overexpression and loss-of-functionanalyses demonstrated that the protein encoded by this PG genefacilitates cell detachment. We thus revealed a molecular linkbetween the key regulators of root cap differentiation and thecellular events underlying root cap-specific functions.

KEY WORDS: Arabidopsis thaliana, Cell detachment, Cell wall, NACtranscription factor, Root cap

INTRODUCTIONThe root cap has unique functions that facilitate root growth throughthe soil; it provides physical protection to the root meristem, sensesgravity and interacts with the rhizosphere by secreting varioussubstances and by shedding cells (Sievers et al., 2002). InArabidopsis (Arabidopsis thaliana), the root cap consists of twoclonally distinct cell populations, the columella (COL) in the centralpart of the root cap and the lateral root cap (LRC), which occupiesthe peripheral region surrounding the COL. Cells constituting theCOL and LRC are produced from the initials, a distinct set of stemcells at the proximal end of the root cap. In Arabidopsis, thecolumella initials (CIs) exclusively produce COL cells, whereas theepidermis/LRC initials yield both LRC cells and epidermal cells(Dolan et al., 1993).Owing to the continuous production of new cells from the

proximal initials, cells constituting the root cap are graduallydisplaced toward the root tip. As these cells exit from the stem cell

region, they start to differentiate. Differentiation of COL cells ischaracterized by the accumulation of starch-containing amyloplasts.These differentiated COL cells are termed statocytes and act asgravity sensors. When COL cells are further displaced towards thedistal end of the root cap, their subcellular organization changesabruptly. A number of vacuoles and Golgi stacks form in the cellsand endoplasmic reticulum (ER) membranes relocate from the distalcortical area to the perinuclear region. Accordingly, thedifferentiated COL cells transition from statocytes to secretioncells (Sievers et al., 2002).

The final step in root cap maturation involves detachment of theoutermost cell layer. In Arabidopsis, this is accomplished byprogrammed cell death of selected LRC cells and the autonomousseparation of the remaining live cells (Fendrych et al., 2014).Detaching root cap cells are termed border cells (BCs), because theyconstitute the border between the root and the soil environment. Ithas been suggested that BCs mediate plant-rhizosphere interactionsby adjusting the physical and chemical properties of the soil and byinfluencing the microbial flora around the roots (Cannesan et al.,2012; Driouich et al., 2013; Hawes et al., 2000; Vicre et al., 2005).In Arabidopsis, BCs do not detach as individual cells, but ratherseparate as an organized layer. Owing to such a unique mode ofdetachment, Vicre et al. proposed that the BCs of Arabidopsis becalled border-like cells (BLCs) (Vicre et al., 2005). The integrity ofcell wall pectins affects the mode of BLC detachment, as mutationsin putative pectin biosynthetic genes in Arabidopsis resulted in BC-type, rather than BLC-type, separation (Durand et al., 2009).

The mechanisms that regulate root cap formation andmaintenance have been studied via genetic approaches inArabidopsis and several regulatory factors have been identified.WUSCHEL RELATED HOMEOBOX5 (WOX5) is specificallyexpressed in the quiescent center (QC) cells and non-cell-autonomously maintains the undifferentiated status of the adjacentCIs. Recently, WOX5 proteins were shown to move from the QC toCIs, where they directly suppress the expression of a DOFtranscription factor, CYCLING DOF FACTOR 4 (CDF4) (Piet al., 2015; Sarkar et al., 2007). A gradient of CDF4 forms along theproximodistal axis of the root cap and regulates the level of root capdifferentiation (Pi et al., 2015). In a separate study, AUXINRESPONSE FACTOR10 (ARF10) and ARF16 genes were shownto be expressed in the root cap. The arf10 arf16 double mutants didnot accumulate amyloplasts in COL cells, and hence are agravitropic(Wang et al., 2005). A similar defect was observed in plantsoverexpressing microRNA160 (miR160), which targets ARF10 andARF16. However, as expression of a miR160-resistant version ofARF16 in the wild-type background did not affect root capdifferentiation, the role of miR160 is unclear (Wang et al., 2005).

The NAC transcription factors SOMBRERO (SMB) and FEZwere identified by a forward genetic screen based on their alteredexpression of root cap markers (Willemsen et al., 2008). FEZ isReceived 19 July 2016; Accepted 19 September 2016

1Graduate School of Biological Sciences, Nara Institute of Science andTechnology, 8916-5 Takayama, Ikoma, Nara 630-0192, Japan. 2RIKEN Center forSustainable Resource Science, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama,Kanagawa 230-0045, Japan.

*Author for correspondence (k-nakaji@bs.naist.jp)

K.N., 0000-0002-1580-3354

4063

© 2016. Published by The Company of Biologists Ltd | Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

preferentially expressed in the root cap initials and promotesformative divisions. SMB is expressed in differentiated root cap cellsand suppresses FEZ expression. SMB was independently identifiedin our root-specific activation tagging screen and overexpression ofSMB confers root cap-like characteristics to the epidermis (Wakiet al., 2013). Epidermal cells in the SMB-overexpressing rootsunderwent additional anticlinal divisions, which normally occur inthe LRC but not in the epidermis, in the meristematic region. Theseroot cap-like epidermal cells were eventually lost in thedifferentiation zone, possibly via programmed cell death (Wakiet al., 2013). SMB belongs to the group I NAC transcription factors(Pereira-Santana et al., 2015). In Arabidopsis, group I NACtranscription factors also include VND/NST/SND proteins, whichare known to promote secondary cell wall (SCW) synthesis invascular cells, and the two BEARSKIN (BRN) transcription factors,BRN1 and BRN2. Previous GUS reporter analyses indicated thatSMB, BRN1 and BRN2 are expressed in largely overlapping patternsin Arabidopsis roots; SMB is expressed in the entire regioncorresponding to the differentiated COL and LRC cells, whereasBRN1 and BRN2 expression appeared to be stronger in the COL andthe flanking LRC than peripheral LRC (Bennett et al., 2010). Loss-of-function smb mutants are defective in root cap dehiscence andcell patterning in the stem cell region. Mutants of a single BRN geneare normal, whereas brn1 brn2 double mutants are defective in celldetachment (Bennett et al., 2010). Overexpression of SMB, BRN1and BRN2 induced SCW formation in the root vasculature, as didoverexpression of VND/NST/SND members, suggesting that groupI NAC transcription factors have a shared regulatory function(Bennett et al., 2010). However, as SCW synthesis does not occur inwild-type root caps, endogenous functions of SMB, BRN1 andBRN2 are expected to differ from those of the VND/NST/SNDmembers (Bennett et al., 2010).Despite extensive studies of the genetic pathways controlling root

cap differentiation, interaction between these pathways seemslimited (Bennett et al., 2014). Nevertheless, the SMB/BRN1/BRN2pathway appears to act after the cell specification step and thereforeis more closely linked to the differentiation processes than are theother pathways (Bennett et al., 2014; Willemsen et al., 2008). In thisstudy, we performed detailed expression analyses of SMB, BRN1and BRN2, and identified their downstream target genes. Our datasuggest that expression of BRN1 and BRN2 is tightly linked to cellpositioning on the root surface. Furthermore, we found that SMB,BRN1 and BRN2 regulate the expression of genes involved in lipidmetabolism, endomembrane organization and cell separation,cellular events that are closely associated with the classicallydocumented characteristics of the outer root cap layers. A geneencoding glycosyl hydrolase 28 (GH28) polygalacturonase (PG) isdirectly activated by BRN1 and facilitates root cap detachment.Therefore, our analyses linked key regulators of root capdifferentiation with a unique developmental feature of the root cap.

RESULTSExpression of BRN1 and BRN2 is restricted to the outer rootcap layersThe spatial expression patterns of SMB have been investigated byin situ hybridization, transcriptional reporter analysis andcomplementation of smb mutants with SMB-GFP fusion proteinsexpressed under the SMB promoter (Bennett et al., 2010;Waki et al.,2013; Willemsen et al., 2008). These experiments have consistentlyindicated that SMB is transcribed specifically in the differentiatedroot cap cells (Fig. 1A; Fig. S1A). Expression patterns of BRN1 andBRN2, however, have been investigated solely by whole-mount

GUS staining (Bennett et al., 2010), which has low cellularresolution. To analyze the expression patterns of BRN1 and BRN2 inmore detail, we generated transgenic plants that express a cell-autonomous, nuclear-localized YFP-GUS (nYG) reporter (Wakiet al., 2013) under the BRN1 and BRN2 promoters. Observations ofYFP fluorescence by confocal laser scanning microscopy (CLSM)revealed that transcription of BRN1 and BRN2 is restricted to theoutermost root cap layer (Fig. 1D,G). Although weak expressionwas detected in the layer directly beneath the outermost layer, noexpression was detected further inside the root (Fig. 1D,G). Thisexpression pattern was confirmed at the protein level bycomplementing brn1 brn2 double mutants with BRN1-GFP orBRN2-GFP expressed under the respective BRN promoter(Fig. S1B,C). These results suggest that the spatial expressionpattern of BRN1 and BRN2 is distinct from that of SMB. The highlyrestricted expression of BRN1 and BRN2 in the outer root cap layersalso suggests a specific role for BRN1 and BRN2 in the later phasesof root cap differentiation.

SMB modifies the spatial expression pattern of BRN1 andBRN2Ectopic expression of SMB confers root cap-like characteristics tothe epidermis of Arabidopsis roots (Waki et al., 2013). To linkSMB functions to root cap characteristics, we performedmicroarray analysis using dexamethasone (DEX)-inducible SMB-overexpressing plants (35S-iSMB) (Waki et al., 2013). Asdescribed below, this analysis identified BRN1 and BRN2 amongthe genes upregulated by overexpression of SMB. BRN1 and BRN2mRNA levels showed a 3.7- and 7.4-fold increase, respectively,compared with DEX-treated control plants, suggesting that SMBeither directly or indirectly activates BRN1 and BRN2.

To examinewhether SMBmodifies the spatial expression patternsof BRN1 and BRN2, we crossed the pBRN1-nYG and pBRN2-nYGreporter lines with Q2610-iSMB plants, which ectopically expressSMB throughout the root meristematic region in a DEX-dependentmanner (Waki et al., 2013). CLSM observation of DEX-treatedplants revealed that ectopic expression of BRN1 and BRN2 waslimited to the epidermal cells exposed to the root surface (Fig. 1F,I).The inner tissue layers, including the cortex and endodermis, did notexpress BRN1 and BRN2, even though SMB was expressed by theubiquitous Q2610 promoter (Waki et al., 2013). The BRN1 andBRN2 reporter lines were also crossed with the loss-of-function smbmutants (Willemsen et al., 2008). Expression of BRN1 and BRN2reporters was lost in the majority of LRC cells in the smb mutants,but was retained in the COL cells (Fig. 1E,H). By contrast,transcription from the SMB promoter did not respond to the alteredSMB expression (Fig. 1B,C). These results indicate that BRN1 andBRN2 expression primarily depends on the cell being on the rootsurface, and requires SMB in the LRC.

SMB, BRN1 and BRN2 activate gene transcriptionAlthough some NAC transcription factors are known to bind tospecific DNA targets and to regulate gene transcription (Ernstet al., 2004), the regulatory capacity of SMB, BRN1 and BRN2proteins has not been demonstrated. Notably, SMB, BRN1 andBRN2 show little conservation in the WQ box sequences that areresponsible for activating transcription by the group I NAC proteinNST3 (Bennett et al., 2010; Ko et al., 2007). To address this, weconstructed plasmids to express either full-length or segments ofSMB, BRN1 and BRN2 proteins fused with the yeast GAL4 DNA-binding domain (GAL4-BD) (Fig. 2). These plasmids wereintroduced into tobacco protoplasts together with a reporter

4064

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

plasmid that contained a firefly luciferase (fLuc) gene downstreamof the GAL4-binding upstream activation sequence (UAS).Another plasmid harboring the CaMV35S promoter driving therenilla luciferase reporter (35S-rLuc) was co-introduced as aninternal control. Measurement of the luciferase activities in the

transfected protoplasts revealed that the C-terminal domains of thethree NAC factors can activate gene transcription, whereas theN-terminal region containing the NAC DNA-binding domaincannot (Fig. 2). These results indicate that SMB, BRN1 and BRN2act as transcription activators.

0 5 10 15 20

F-luc / R-luc

NAC

NAC

NAC

NAC

NAC

NAC

GAL4-BD

SMB-FL

SMB-N

SMB-C

BRN1-FL

BRN1-N

BRN1-C

BRN2-FL

BRN2-N

BRN2-C

VP16AD

Control

VP16-AD

Fig. 2. The C-terminal domains of SMB, BRN1and BRN2 activate gene transcription in plantcells. The structures of the fusion proteins (left).The bar graph indicates the transcription activationcapacities of the fusion proteins measured by thedual luciferase assay with the value of the control(GAL4-BD alone) set to 1. Error bars indicate thes.d. calculated from five biological replicates. Thisgraph shows a representative result of twoexperiments.

Fig. 1. Transcription of BRN1 andBRN2 is restricted to the outermostroot cap layers. (A-C) Confocalimages of a transcriptional reporterline of SMB. (A) Nuclear-localizedYFP fluorescence indicatesubiquitous transcription of SMB in thedifferentiated root cap cells.(B,C) This transcription pattern is notaffected by the loss-of-function smbmutation (B) or by SMBoverexpression (DEX-treated Q2610-iSMB) (C). (D-I) Confocal images oftranscriptional reporter lines of BRN1and BRN2. Transcription of BRN1and BRN2 is restricted to theoutermost root cap layers (D,G). Thesmb mutant lacks transcription ofBRN1 and BRN2 in the LRC (whitearrowheads in E and H), whereasSMB overexpression activatesectopic transcription of BRN1 andBRN2 in the epidermis (openarrowheads in F and I). BRN1 andBRN2 are ectopically expressed onlyin the epidermal cells exposed to theroot surface. In each set of panels,boxed regions in the left panel aremagnified in the center and rightpanels. Asterisk, QC; Epi, epidermis;COL, columella; LRC, lateral root cap.Scale bars: 200 µm, left panels;20 µm, center and right panels.

4065

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

SMB, BRN1 and BRN2 regulate the expression of genesassociated with root cap differentiationTo search for endogenous targets of SMB, BRN1 and BRN2, weperformed transcriptome analyses of the root tip segments of 35S-iSMB and a control line (35S-GVG) treated with DEX for 17 h(Fig. 3). We identified 437 genes exhibiting more than twofoldupregulation in 35S-iSMB when compared with the control (Fig. 3).As mentioned above, BRN1 and BRN2 were found among theupregulated genes, indicating that genes upregulated by SMB viaBRN1 and/or BRN2 are included in the 437 genes.To exclude genes artificially activated by SMB, BRN1 and

BRN2 overexpression, comparable transcriptome analyses betweenthe triple mutant smb brn1 brn2 and wild-type roots were performedin parallel. A total of 335 genes showing more than twofolddownregulation in the smb brn1 brn2 triple mutant root tips wereidentified (Fig. 3). By extracting the overlap between the twocomparative transcriptome analyses, 60 genes were identified asputative downstream targets of the three NAC factors (Fig. 3;Table S1). Transcriptional nYG reporter lines were generated for 11of the 60 genes and CLSM observations revealed preferentialexpression of all 11 genes in the outer root cap layers (Fig. 4A;Fig. S2). This suggests that our combinatorial transcriptomeapproach successfully identified endogenous target genes.A gene ontogeny (GO) enrichment analysis of 57 annotated

genes out of the 60 candidates by the AmiGO program (Carbonet al., 2009) revealed an enrichment of genes encoding enzymes(Table 1). Genes associated with lipid metabolism were highlyenriched (Table 1). The GO enrichment analysis also indicatedoverrepresentation of extracellular proteins as well as ER and/ornuclear membrane-associated proteins (Table 1). As discussedbelow, both lipid synthesis and endomembrane rearrangement occurat the transition from the statocyte to the secretion cells in the COLlineage (Maitra and De, 1972; Sievers et al., 2002). Thus, ourmicroarray and expression analyses suggest that the three NACfactors regulate a broad range of subcellular events associated withroot cap differentiation.

BRN1 and BRN2 activate a polygalacturonase gene in theoutermost root cap layerIn addition to the lipid synthesis and endomembrane-associatedgenes described above, a gene encoding a GH28 family protein(At1G65570) was identified among the downstream genes. GH28proteins are known to function as PGs in bacteria, fungi and plants(Abbott and Boraston, 2007; Cao, 2012; Sprockett et al., 2011).Arabidopsis mutants defective in GH28 PGs are compromised indevelopmentally regulated cell separation in pollen and carpeldehiscence (Ogawa et al., 2009; Rhee et al., 2003). Because celldetachment is a hallmark of mature root cap cells and the loss-of-function smb and brn1 brnn2 mutants are defective in root capdehiscence (Bennett et al., 2010), we focused our analysis on theAt1G65570 gene.

The spatiotemporal expression pattern of At1G65570 wasanalyzed using transgenic plants harboring the 1.8 kb promoter ofAt1G65570 fused with the nYG reporter gene. CLSM observationof the root tip revealed tightly regulated transcription ofAt1G65570 in the outermost root cap layer (Fig. 4A). Based onthis expression pattern, we named At1G65570 as ROOT CAPPOLYGALACTURONASE (RCPG). The RCPG reporter was alsointroduced into the smb, brn1 brn2 and smb brn1 brn2 mutants.Observation of multiple independent lines revealed a dramaticreduction of RCPG expression in the brn1 brn2 and smb brn1brn2 mutants (Fig. 4C,D), but not in the smb mutant (Fig. 4B).Crossing these reporter lines with wild-type plants restoredreporter expression to comparable levels to that in the wild type(Fig. 4B-D, insets). Combined with the fact that reduced reporterexpression was observed both in brn1 brn2 and smb brn1 brn2

>2-fold up in 35S-iSMB >2-fold down in smb brn1 brn2

437 genes 335 genes

60 377 275

Microarray (duplicate)

Microarray (duplicate)

WT smb brn1 brn2 35S-iSMB Control

17-h DEX treatment

RNA ext. from root tip RNA ext. from root tip

Fig. 3. Comparative microarray analyses to identify genes that actdownstream of SMB, BRN1 and BRN2. In one experiment (left),transcriptomes of SMB-overexpressing roots (35S-iSMB) and control rootswere compared, whereas in the other experiment (right), transcriptomes of thesmb brn1 brn2 triple mutant and wild-type roots were compared. We identified60 genes as candidates that act downstream of the three NAC transcriptionfactors.

Fig. 4.RCPG is specifically transcribed in the detaching root cap cells in amanner that depends on BRN1 and BRN2, but not SMB. (A-D) Confocalimages of the root tip of the transcriptional reporter lines of RCPG. RCPG isspecifically transcribed in the detaching root cap cells in the wild type. Thisexpression pattern is essentially the same in the smbmutant, but dramaticallyreduced in the smb brn1 brn2 and brn1 brn2 mutants. Insets in B-D indicaterestoration of reporter expression in the cross between respective reporter lineswith wild-type plants. Scale bars: 50 µm. (E) Measurement of endogenousRCPG mRNA levels in the wild-type and mutant root tips by RT-qPCR. Errorbars indicate the s.d. from three independently pooled root tips. The graphshows a representative result of two experiments.

4066

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

mutants, these results suggest that the reduced expression of thereporter was caused by the loss of BRN1 and/or BRN2 functions,and was not due to the position of the T-DNA insertion orbackground mutations unrelated to brn1 and brn2. We confirmedthis notion by measuring endogenous RCPG transcript levels byreverse transcription quantitative PCR (RT-qPCR) (Fig. 4E).Taken together, our data indicate that expression of RCPG doesnot require SMB functions, but depends on BRN1 and/or BRN2.

RCPG promotes cell separationGH28 proteins have been extensively studied in bacteria and fungi,and their catalytic mechanism and reaction selectivity betweenendo- and exo-PG have been elucidated at the atomic level (Abbottand Boraston, 2007; Shimizu et al., 2002; van Pouderoyen et al.,2003). Our modeling analyses indicate that RCPG folds into a β-helical structure with an open-ended substrate-binding cleft typicalof endo-PGs (Fig. S3A-C) (Abbott and Boraston, 2007). Both thesubstrate-binding residues and the catalytic Asp residues areperfectly conserved in RCPG (Fig. S3D) (Armand et al., 2000;Pages et al., 2000; Shimizu et al., 2002). These residues are not onlyconserved in sequence but also in the superposition of the RCPGmodel with an experimentally determined bacterial PG structure(Fig. S3E,F) (Shimizu et al., 2002), supporting the notion thatRCPG functions as an endo-PG.To test whether RCPG can promote cell separation in the root cap,

DEX-inducible overexpression lines of RCPG (UAS-RCPG/UAS-

GFPer-35S-GVG) were generated and grown on DEX-containingmedia. CLSM observation of the root tips revealed a dramaticchange in the cell adhesion properties in the root cap: in rootsoverexpressing RCPG, the outermost root cap cells sloughed offindividually (Fig. 5B,C), whereas the control root cap cells detachedas a layer (Fig. 5A). This observation strongly suggests that RCPGpromotes cell separation. Interestingly, cell separation was notectopically induced in the inner root cap layers, even though strongexpression of the co-induced GFP reporter indicated that GVG-mediated overexpression occurred throughout the root cap(Fig. 5B). This indicates that RCPG-mediated cell separationrequires unknown factors and/or conditioning that specificallyoccurs in the outermost root cap layer.

RCPG facilitates root cap removalTo examine whether RCPG activities are necessary for thedetachment of root cap cells, we isolated and characterized a T-DNA insertion mutant of RCPG (GABI_100C05, hereafter calledthe rcpg mutant) (Fig. S4A). RT-PCR analysis of the root tipsegments of homozygous rcpg mutants indicated no accumulationof RCPGmRNA corresponding to the third exon, and no splicing ofthe second intron harboring the T-DNA (Fig. S4B), suggesting thatthe expression and/or functions of RCPG proteins, if any, derivedfrom the rcpg allele were compromised.

Although the growth of the homozygous rcpg mutants wasindistinguishable from that of the wild type, observations of theroots of 5-day-old seedlings revealed incomplete removal ofdetaching root cap layers in the rcpg mutant (Fig. 6). Althoughthis rcpg defect was qualitatively similar to that of the brn1 brn2mutant, it was less conspicuous in the rcpg mutant (Fig. 6).Detaching root cap layers of the rcpg and brn1 brn2 mutantsexhibited a closed, bowl-like shape, as opposed to a flat plate-likeshape seen in the wild-type roots (Fig. 6). As described below, thisphenotype was rescued with RCPG-RFP proteins expressed underthe RCPG promoter (Fig. 7). These results suggest that the mutationin RCPG led to a change in the morphology of the detaching rootcap layers and to their incomplete separation from the root.Considering the dramatically reduced expression of RCPG in thebrn1 brn2 mutants, these observations indicate that RCPG actsdownstream of BRN1 and/or BRN2 and facilitates the removal of theoutermost root cap layer.

RCPG localizes to the apoplastConsistent with the predicted role of RCPG in the degradation ofcell wall pectins, the pSORT program predicted that the RCPG

Table 1. GO enrichment analysis of genes acting downstream of SMB,BRN1 and BRN2

GO term

SMB/BRNdownstreamgene count*

Whole-genomegene count‡

P-value

Molecular functionGO:0016765.Transferase activity,transferring alkyl oraryl groups

5 (8.8%) 137 (0.4%) 0.0031

GO:0016717.Oxidoreductaseactivity, reduction ofO2 to two H2O

3 (5.3%) 25 (0.1%) 0.0071

GO:0019137.Thioglucosidaseactivity

2 (3.5%) 7 (0.03%) 0.0370

Biological processGO:0006629. Lipidmetabolic process

11 (19.3%) 999 (3.3%) 0.0011

GO:0008610. Lipidbiosynthetic process

8 (14.0%) 55 (1.8%) 0.0043

GO:0006636.Unsaturated fatty acidbiosynthetic process

3 (5.3%) 24 (0.1%) 0.0063

GO:0033559.Unsaturated fatty acidmetabolic process

3 (5.3%) 25 (0.1%) 0.0071

Cellular componentGO:0005576.Extracellular region

16 (28.1%) 2924 (9.6%) 0.0322

GO:0005789.Endoplasmicreticulum membrane

6 (10.5%) 384 (1.3%) 0.0419

GO:0042175. Nuclearouter membrane-ERmembrane network

6 (10.5%) 388 (1.3%) 0.0443

*Among a total of 57 genes.‡Among a total of 30,471 genes.

Fig. 5. Overexpression of RCPG alters the behavior of the detaching rootcap cells. (A) A confocal image of the RCPG overexpression line grownwithout the DEX inducer. The outermost root cap cells detach as a layer(arrows). (B,C) Confocal images of a root overexpressing RCPG. Cells in theoutermost layer detach independently by cleavage at the longitudinal walls(arrowheads). Image shown in C is a reconstructed 3D view of the root tip,colored according to the depth across the root diameter for easy recognition.Scale bars: 50 µm.

4067

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

protein is targeted to the extracellular space. To confirm this, wegenerated a construct to express RCPG-RFP fusion proteins drivenby the RCPG promoter ( pRCPG-RCPG-RFP) and introduced thisconstruct into the rcpgmutants. CLSM observations of the resultingtransgenic plants revealed RFP fluorescence in the apoplastssurrounding the outermost root cap cells (Fig. 7A,B). RFPfluorescence appeared as a band surrounding the detaching rootcap layer (Fig. 7B). In segregating T2 progeny, individuals withRCPG-RFP fluorescence had detaching root cap layers exhibiting aflat plate-like morphology, as seen in the wild type (Fig. 7C,E).Those that lacked RFP fluorescence, however, remained to have aclosed bowl-like shape, as seen for the rcpg mutant (Fig. 7D,F).These results confirmed that functional RCPG-RFP proteinslocalized to the apoplast, consistent with the predicted role ofRCPG in the degradation of cell wall pectins.

BRN1 directly binds to the RCPG promoterNAC transcription factors regulate gene transcription by binding tospecific sequences in their target promoters (Ernst et al., 2004).Spatially overlapping expression of RCPG with BRN1 and BRN2,loss of RCPG expression in the brn1 brn2mutant, and the ability ofBRN1 and BRN2 to activate gene transcription collectively suggesta mechanism in which BRN1 and BRN2 directly bind to the RCPGpromoter to activate RCPG expression in the detaching root capcells. To test this possibility, chromatin immunoprecipitationfollowed by quantitative PCR (ChIP-qPCR) was performed using

the aforementioned pBRN1-BRN1-GFP plants that complementedthe brn1 brn2mutant (Fig. S1B). Purification of chromatin fractionsfrom the root tip cells using anti-GFP antibodies followed by qPCRmeasurement revealed significant enrichment of DNA fragmentscovering 117-251 bp upstream of the first ATG of RCPG,demonstrating that BRN1 directly binds to the proximal promoterregion of RCPG (Fig. 8B). This region contains a consensussequence for the secondary wall NAC-binding element (SNBE)(TTnCTTnnnnnnnAAGnAA), a binding site for the VNDtranscription factors (Fig. 8A). Taken together, our ChIP-qPCRanalysis suggests that BRN1 and, by inference, BRN2 directlycontrol the expression of RCPG in the outermost root cap layer, andthereby promotes its dehiscence.

DISCUSSIONExpression patterns of BRN1 and BRN2 are different fromthat of SMBAlthough the smb brn1 brn2 triple mutants were strongly affectedboth in cell separation and stem cell divisions, the brn1 brn2 doublemutants exhibited a weak cell separation defect (Bennett et al.,2010). Whole-mount GUS staining suggested that SMB, BRN1 andBRN2 had similar expression patterns in the root cap (Bennett et al.,2010). However, by using a cell-autonomous reporter and CLSMobservations, we found that the expression of BRN1 and BRN2 istightly restricted to the outer root cap layers. Complementation ofthe brn1 brn2 mutants with the BRN1-GFP and BRN2-GFP fusionproteins expressed under the respective BRN promoters alsosupported the conclusion that functional expression of BRN1 andBRN2 is limited to the outer root cap layers. The apparently broaderexpression of BRN1 and BRN2 found in the previous study is likelyattributable to the use of diffusive GUS staining and the whole-mount set up.

Although expression of BRN1 and BRN2 was ectopicallyactivated in the epidermis by the overexpression of SMB, thesurface-specific expression was still maintained in spite of theubiquitous expression of SMB. This indicates that expression of

Fig. 6. The rcpg and brn1 brn2 loss-of-function mutants fail to separatefrom detaching root cap layers. (A-C) Reconstructed 3D views of the wild-type (A), rcpg mutant (B) and brn1 brn2 mutant (C) roots. (D-F) Medianconfocal sections of the wild-type (D), rcpg mutant (E) and brn1 brn2 mutant(F) roots. Roots were observed without lifting from the agar surface. Thedetaching root cap layers of the rcpg and brn1 brn2 mutants retain a closedbowl-like shape (B,C), whereas those of the wild-type root are flattened (A).Scale bars: 50 µm.

Fig. 7. RCPG-RFP fusion proteins localize to the apoplast andcomplement the defects of the rcpg mutant. (A,B) A median confocalsection of a pRCPG-RCPG-RFP root. RFP fluorescence is specificallydetected in the space surrounding the detaching root cap cells (arrowheads).(B) A magnified view of the boxed region in A. (C-F) Expression of RCPG-RFPis associated with the reversion of detaching root cap morphology from theclosed bowl-like (F) to the flat plate-like (E) shape, which is typical of rcpgmutants (D) and the wild type (C), respectively. Green indicates FDA-positiveviable cells. Scale bar: 50 µm.

4068

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

BRN1 andBRN2 is strictly dependent on surface positioning, as wellas on a second input that is associated with root cap identity.Although SMB is a good candidate for a factor that mediates thesecond input, the persistent expression of BRN1 and BRN2 in theCOL of smb mutants suggests the existence of as yet unknownfactors that promote BRN1 and BRN2 expression in COL. In view ofthe widely accepted concept of position-dependent tissue patterningand its functional significance in the Arabidopsis root (Petrickaet al., 2012), mechanisms that underlie surface-specific geneexpression are of great interest. In the Arabidopsis shoot, cells inthe outermost L1 layer have a clonal lineage and L1-specific geneexpression is maintained by the binding of the HD-ZIP IVtranscription factors ARABIDOPSIS THALIANA MERISTEMLAYER1 (ATML1) and PROTODERMAL FACTOR 2 (PDF2) tothe promoters of target genes as well as to the promoter of PDF2itself (Abe et al., 2003). Although mechanisms regulating surface-specific gene expression have not been reported for the roots, alineage-dependent mechanism is not expected to operate in the rootcap, as cells constituting the root cap continuously turn over.

Therefore, a mechanism that senses outer cell positioning is requiredand the resulting positional information should be eventuallyconverted to the transcriptional control of the BRN1 and BRN2promoters.

SMB, BRN1 and BRN2 regulate a broad range of subcellularevents associated with root cap differentiationSMB, BRN1 and BRN2 constitute the group I NAC transcriptionfactors together with the VND and NST/SND members that controlSCW synthesis in vascular cells (Pereira-Santana et al., 2015).Based on the finding that SMB, BRN1 and BRN2 activate SCWsynthesis in the root vasculature (as do the VND proteins), group INAC proteins appear to possess a shared activation capacity forSCW synthesis (Bennett et al., 2010). However, this overexpressionphenotype is likely artificial (Bennett et al., 2010). In this study, weadopted a comparable transcriptome approach to search forendogenous targets of SMB, BRN1 and BRN2. A GO enrichmentanalysis of the identified genes revealed a bias towards enzyme-coding genes, especially those involved in lipid synthesis. Reporteranalyses indicated that most of these enzyme-coding genes arespecifically expressed in the outer root cap layers. In a classicalultrastructural observation ofMedicago root caps, lipid bodies werefound to develop as root cap cells mature and then to disappear inthe detaching cells (Maitra and De, 1972). It has been proposed thatin the outer root cap layers, starch stored in the amyloplasts israpidly converted to lipids for energy storage and then consumed inthe outermost root cap cells. In this regard, BRN-dependentactivation of lipid synthesis in the outer root cap layers likelyprovides a molecular basis for a root cap maturation process.In addition, our GO enrichment analysis revealed anoverrepresentation of nuclear- and ER membrane-associatedproteins. COL cells are known to undergo dramatic rearrangementof the subcellular compartments during the transition fromstatocytes to secretion cells (Sievers et al., 2002). Therefore, wesuspect that the identified membrane-associated proteins function inthis transition of COL differentiation, though this hypothesisremains to be tested by future mutant analyses.

BRN1 directly controls a gene that encodes a cell wallmodification enzymeOur transcriptome analysis identified a number of extracellularproteins that act downstream of the three NAC factors and wedecided to perform functional analysis of one of these, RCPG.RCPG belongs to the GH28 family of PGs, which occur in bacteria,fungi and plants. In plants, some GH28 proteins are known todegrade cell wall pectins and thereby promote cell separation. Forexample, Arabidopsis with mutations in QUARTET2 (QRT2) andQRT3 are defective in the separation of the four daughter cellsproduced from the microspore mother cell (Preuss et al., 1994).Similarly, mutants of ARABIDOPSIS DEHISCENCE ZONEPOLYGALACTURONASE1 (ADPG1) and ADPG2 exhibitincomplete dehiscence of siliques and anthers. RecombinantADPG1, ADPG2 and QRT3 proteins showed PG activities(Ogawa et al., 2009; Rhee et al., 2003). These reports highlight theessential role of GH28 proteins in pectin degradation anddevelopmentally regulated cell separation in plants. GH28 proteinshave been extensively characterized structurally for their catalyticmechanisms, reaction processivity and exo/endo selectivity(Armand et al., 2000; Pages et al., 2000; Shimizu et al., 2002; vanPouderoyen et al., 2003). Our modeling study indicated that RCPGshares a conserved protein folding with known GH28 endo-PGs, aswell as perfectly conserved positioning of amino acid residues that

% o

f inp

ut

ATG TGA -174

9

1 2 4 3 5

A

B

-986

-8

75

-251

-1

17

-507

-4

30

860

951

-168

2

0

2

4

6

8

1 2 3 4 5 TUB_1

pBRN1-BRN1-GFP/brn1 brn2: Exp.1

pBRN1-BRN1-GFP/brn1 brn2: Exp.2

pBRN1-nYG: Exp.1

pBRN1-nYG: Exp.2

Ex.1 Ex.2 Ex.3

ttncttnnnnnnnaagnaa aacgttacctacggaggctcccaaattacttttaaacaaagcaactcgttttcaaatatc gtagagaaatcaatggcgccgcgcgccgtttgcttaatactttgattcttaaaccacaaa gaaaccctcttctctttatccaagatcctaactaacttatatatatacacacgtgcatac ttctatctttcatcgaaaaatacaataatcttaaactttaaatccttccaattaaaaaaa

acacacaacaaATGGCA……

SNBE consensus -251

TATA-box

Translation

-117

Fig. 8. BRN1 directly binds to the proximal promoter region of RCPG.(A) The RCPG gene structure. Boxes indicate exons. Regions analyzed byChIP-qPCR (B) are shown by bars numbered 1-5 together with the distancefrom the first ATG. The TATA-box element predicted by the TSSP-TCMprogram (Shahmuradov et al., 2005) and the consensus sequence for thesecondary wall NAC-binding element (SNBE) are boxed in the sequencebelow the diagram. (B) qPCRmeasurements ofRCPG genomic fragments co-immunoprecipitated with the BRN1-GFP protein. A transcriptional reporter lineof BRN1 (pBRN1-nYG) was used as a negative control. A region in theunrelated TUB1 gene was used to set the background amplification level.Results from two independent experiments are shown. Error bars indicate s.d.from three qPCR measurements (technical replicates).

4069

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

are known to be important for catalysis and substrate recognition.Functional RCPG-RFP fusion proteins were localized to theapoplast, and overexpression of RCPG promoted cell separation.Expression of RCPG depends on BRN1 and/or BRN2, and BRN1directly binds to the RCPG promoter. Taken together, these resultsstrongly suggest that RCPG degrades cell wall pectins in theoutermost root cap layers and thereby promotes cell separation.Although our results are consistent with the role of RCPG in root

cap dehiscence, the loss-of-function rcpg mutant phenotype wasrelatively weak, and the outermost root cap layer still dehisced in thercpg mutant. The Arabidopsis genome contains a total of 67 genesencoding putative pectin lyases (Cao, 2012) and several of thesegenes appear to be expressed in the root cap (Brady et al., 2007).Although RCPG is the only GH28 member among the identified 60genes, it is possible that root cap separation is preconditioned byNAC-independent PG activities. Alternatively, efficient cellseparation can be achieved by the modification of multiple classesof cell wall components. In this regard, it should be noted thatCELLULASE3 (CEL3) and CEL5 genes, which encode putativecellulases, are specifically expressed in the outer root cap layers, andaweak phenotype is postulated for cel5mutants (del Campillo et al.,2004). Our transcriptome analyses indicated a reduction in theexpression of CEL3 and CEL5 in the smb brn1 brn2 triple mutant,as was suggested previously (Bennett et al., 2010), and weakupregulation of these genes by SMB overexpression. Although theroles of cellulase have not been reported in other instances ofdevelopmentally regulated cell dehiscence, it is possible that somedegree of cellulose decomposition facilitates cell detachment.Another intriguing possibility is that RCPG primarily controls the

shape of the detaching root cap layer and thereby facilitates itsremoval. In the rcpg mutant, the detaching root cap layers have aclosed bowl-like shape as opposed to the flat plate-like shape seen inthe wild type. It has been reported that in mutants of compromisedpectin biosynthesis, root cap cells detached as individual cellsinstead of cell layers (Durand et al., 2009). A similar phenomenonwas also observed in our RCPG-overexpressing lines. Theseobservations suggest that the integrity of the pectin matrix isimportant for connecting the detaching root cap cell layers. RCPGmay preferentially separate cells at their longitudinal walls andthereby promote the efficient removal of the root cap layer.In summary, our study provides a molecular link between the key

regulators of root cap differentiation and the cellular eventsunderlying root cap dehiscence. A catalog of genes actingdownstream of the NAC transcription factors in the root cap willserve as an important reference, not only to identify molecularcomponents associated with the previously described root capdifferentiation process, but also to establish previously unknowncellular events occurring in the root cap differentiation process.

MATERIALS AND METHODSPlant materialsArabidopsis thaliana (L.) Heynh accession Col-0 was used as the wild type.smb (smb-3, SALK_143526), brn1 (brn1-1, SALK_151986), brn2 (brn2-1,SALK_151604), 35S-iSMB, Q2610-iSMB and pSMB-nYG lines have beendescribed previously (Bennett et al., 2010; Waki et al., 2013; Willemsenet al., 2008). Seeds of the rcpgmutant (GABI_100C05) were obtained fromthe Arabidopsis Biological Resource Center (Columbus, OH, USA) andbackcrossed with wild-type plants. The T-DNA insertion was found in thesecond intron (1415 bp downstream of the first ATG) with deletion ofthe flanking 25 bp region rather than in the third exon [as annotated in theGABI-Kat database (https://www.gabi-kat.de/) (Fig. S4A)]. The transgeniclines described below were in the wild-type Col-0 background, unless notedotherwise.

Generation of transgenic plantsNuclear-localized YFP-GUS (nYG) reporter constructs of BRN1, BRN2 andthe genes identified in the microarray analyses were constructed byamplifying the promoter regions of the respective genes by PCR from wild-type genomic DNA using the primers listed in Table S2. PCR fragmentswere digested with restriction enzymes at the restriction sites incorporated atthe end of the primers and inserted into the pBI-Kan-nlsYG plasmid (Wakiet al., 2011). The RCPG reporter construct was introduced into the smb,brn1 brn2 and smb brn1 brn2 mutant backgrounds in addition to wild-typeCol-0.

To express GFP-fusion proteins of SMB, BRN1 and BRN2 under thenative promoters, genomic DNA fragments consisting of the promoter,coding region and introns were amplified by PCR from the wild-typegenomic DNA with the primers listed in Table S2. PCR fragments weredigested at the SalI and BamHI sites incorporated in the primers and insertedinto pBIB-4xGly-sGFP-NosT, which harbors the coding sequence of the4xGly linker and GFP (S65T) (Niwa et al., 1999) followed by the nopalinesynthase (Nos) terminator region. The resulting constructs were introducedinto the smb or brn1 brn2 mutants.

For DEX-inducible overexpression of RCPG, a genomic fragmentencompassing the entire RCPG-coding sequence and the introns wasamplified from the wild-type genomic DNA with the primers listed inTable S2. PCR products were digested with ApaI and SpeI, and inserted intothe pBIB-UAS-NosT plasmid (Waki et al., 2011). The resulting pBIB-UAS-RCPG construct was introduced into the host plants harboring pBIN-UAS-GFPer-35S-GVG (Waki et al., 2013).

For expression of RCPG-RFP fusion proteins by the RCPG promoter,DNA fragments of the RCPG promoter and gene body regions (full codingregion plus introns) were separately amplified from the wild-type genomicDNA with the primers listed in Table S2. The resulting fragments weresequentially inserted into the pDONR P2R_P3-tagRFP-OcsT plasmidharboring tagRFP (Merzlyak et al., 2007) and the octopine synthaseterminator (OcsT) using Gateway technology (Life Technologies). Theassembled insert was then transferred into the bialaphos-resistant binaryvector pBm43GW (Karimi et al., 2005).

Transcription activation assayPlasmids that express either full-length or a segment of the NAC polypeptideand the yeast GAL4-BD were constructed by amplifying the correspondingparts of the NAC cDNA fragments by PCR using the primers listed inTable S2. PCR fragments were digested with BamHI and EcoRI at the sitesincorporated at the end of each primer and inserted into p35S-GAL4BD(Waki et al., 2011). The transcription activation domain of Herpes VP16was used as a positive control (Waki et al., 2011). A transcription activationassay was performed with the Dual Luciferase Assay System (Promega)using protoplasts prepared from the tobacco (Nicotiana tabacum L.) BY-2cell cultures as described previously (Waki et al., 2011).

Microarray analysisTotal RNA was extracted from about 1 cm of root tip segments using theRNeasy Plant Mini Kit (Qiagen). First-strand cDNA synthesis andpreparation of Cy3- and Cy5-labeled cRNAs were performed with theLow Input Quick Amp Labeling Kit (Agilent Technologies). LabeledcRNAs were hybridized with the Agilent 4x44K Arabidopsis GeneExpression Microarray Ver.4.0 (Agilent Technologies) in a two-colorformat with dye-swapped biological duplicates.

MicroscopyConfocal laser scanning microscopy (CLSM) was carried out with a NikonC2 confocal microscope. Roots were stained with 10 µM of propidiumiodide unless noted otherwise. Fluorescein diacetate (FDA) staining wasperformed by soaking the roots in a solution containing 2 µg/ml FDA.

RNA extraction and RT-PCR analysisTotal RNA was extracted from the ∼5 mm root tip segments of 5-day-oldseedlings using the RNeasy Plant Mini Kit (Qiagen). First-strand cDNAwassynthesized using the PrimeScript RT Reagent Kit with gDNA Eraser(Takara Bio). RT-qPCR was performed with the primers listed in Table S2

4070

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

with the SYBR Premix Ex Taq (Takara Bio). Measurements were normalizedto the levels of ACTIN3 transcript.

Molecular modelingThe three-dimensional model of RCPG was calculated at the SWISS-MODEL site (http://swissmodel.expasy.org/). The crystal structure of theendopolygalacturonase I from Stereum purpureum complexed with twogalacturonate molecules (PDB code: 1KCD, chain A) was used as template.Structural images were drawn using the PyMOL program (https://www.pymol.org/).

ChIP-qPCRSeedlings of pBRN1-BRN1-GFP plants (in the brn1 brn2 mutantbackground) were grown on nutrient agar plates for 5 days. To increasethe fraction of root cap-derived cells, seedlings were transferred to freshplates containing 25 µM indole acetic acid to induce lateral root formation.After 3 days, root tip segments with numerous short lateral roots wereharvested and subjected to chromatin purification. ChIP experiments werecarried out as previously described (Kim et al., 2014) using the anti-GFPantibody (1/100; ab290, Abcam). The ChIP fractions were used as templateto measure bound DNA fragments by real-time PCR using the primers listedin Table S2.

AcknowledgementsWe are grateful to Tom Bennett and Ben Scheres for the smb, brn1 and brn2 seeds;and to Masako Kanda and Emi Murata for technical assistance.

Competing interestsThe authors declare no competing or financial interests.

Author contributionsM.K., S.-Y.H., A.I., J.-M.K., S.M. and K.N. conducted the experiments; M.K., J.-M.K.,M.S., S.M. and K.N. designed the experiments; and M.K. and K.N. wrote the paper.

FundingThis work was supported by Japan Society for the Promotion of Science KAKENHIgrants [JP25113007, JP15K14548 and JP21570042 to K.N.].

Data availabilityMicroarray data obtained in this study have been deposited in the Gene ExpressionOmnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo/) under the accessionnumber GSE86443.

Supplementary informationSupplementary information available online athttp://dev.biologists.org/lookup/doi/10.1242/dev.142331.supplemental

ReferencesAbbott, D. W. and Boraston, A. B. (2007). The structural basis forexopolygalacturonase activity in a family 28 glycoside hydrolase. J. Mol. Biol.368, 1215-1222.

Abe, M., Katsumata, H., Komeda, Y. and Takahashi, T. (2003). Regulation ofshoot epidermal cell differentiation by a pair of homeodomain proteins inArabidopsis. Development 130, 635-643.

Armand, S., Wagemaker, M. J. M., Sanchez-Torres, P., Kester, H. C. M., vanSanten, Y., Dijkstra, B. W., Visser, J. and Benen, J. A. E. (2000). The active sitetopology of Aspergillus niger endopolygalacturonase II as studied by site-directedmutagenesis. J. Biol. Chem. 275, 691-696.

Bennett, T., van den Toorn, A., Sanchez-Perez, G. F., Campilho, A., Willemsen,V., Snel, B. and Scheres, B. (2010). SOMBRERO, BEARSKIN1, andBEARSKIN2 regulate root cap maturation in Arabidopsis. Plant Cell 22, 640-654.

Bennett, T., van den Toorn, A., Willemsen, V. and Scheres, B. (2014). Precisecontrol of plant stem cell activity through parallel regulatory inputs. Development141, 4055-4064.

Brady, S. M., Orlando, D. A., Lee, J.-Y., Wang, J. Y., Koch, J., Dinneny, J. R.,Mace, D., Ohler, U. and Benfey, P. N. (2007). A high-resolution rootspatiotemporal map reveals dominant expression patterns. Science 318,801-806.

Cannesan, M. A., Durand, C., Burel, C., Gangneux, C., Lerouge, P., Ishii, T.,Laval, K., Follet-Gueye, M.-L., Driouich, A. and Vicre-Gibouin, M. (2012).Effect of Arabinogalactan proteins from the Root Caps of Pea and Brassica napuson Aphanomyces euteiches Zoospore chemotaxis and germination. PlantPhysiol. 159, 1658-1670.

Cao, J. (2012). The pectin lyases in Arabidopsis thaliana: evolution, selection andexpression profiles. PLoS ONE 7, e46944.

Carbon, S., Ireland, A., Mungall, C. J., Shu, S., Marshall, B., Lewis, S., AmiGOHub and Web Presence Working Group. (2009). AmiGO: online access toontology and annotation data. Bioinformatics 25, 288-289.

del Campillo, E., Abdel-Aziz, A., Crawford, D. and Patterson, S. E. (2004). Rootcap specific expression of an endo-beta-1,4-D-glucanase (cellulase): a newmarker to study root development in Arabidopsis. Plant Mol. Biol. 56, 309-323.

Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts, K. andScheres, B. (1993). Cellular organisation of the Arabidopsis thaliana root.Development 119, 71-84.

Driouich, A., Follet-Gueye, M.-L., Vicre-Gibouin, M. and Hawes, M. (2013). Rootborder cells and secretions as critical elements in plant host defense. Curr. Opin.Plant Biol. 16, 489-495.

Durand, C., Vicre-Gibouin, M., Follet-Gueye, M. L., Duponchel, L., Moreau, M.,Lerouge, P. and Driouich, A. (2009). The organization pattern of root border-likecells of Arabidopsis is dependent on cell wall homogalacturonan. Plant Physiol.150, 1411-1421.

Ernst, H. A., Olsen, A. N., Skriver, K., Larsen, S. and Lo Leggio, L. (2004).Structure of the conserved domain of ANAC, a member of the NAC family oftranscription factors. EMBO Rep. 5, 297-303.

Fendrych,M., VanHautegem, T., VanDurme,M., Olvera-Carrillo, Y., Huysmans,M., Karimi, M., Lippens, S., Guerin, C. J., Krebs, M., Schumacher, K. et al.(2014). Programmed cell death controlled by ANAC033/SOMBRERO determinesroot cap organ size in Arabidopsis. Curr. Biol. 24, 931-940.

Hawes, M. C., Gunawardena, U., Miyasaka, S. and Zhao, X. (2000). The role ofroot border cells in plant defense. Trends Plant Sci. 5, 128-133.

Karimi, M., De Meyer, B. and Hilson, P. (2005). Modular cloning in plant cells.Trends Plant Sci. 10, 103-105.

Kim, J.-M., To, T. K., Tanaka, M., Endo, T. A., Matsui, A., Ishida, J., Robertson,F. C., Toyoda, T. and Seki, M. (2014). Highly reproducible ChIP-on-chip analysisto identify genome-wide protein binding and chromatin status in Arabidopsisthaliana. Methods Mol. Biol. 1062, 405-426.

Ko, J.-H., Yang, S. H., Park, A. H., Lerouxel, O. and Han, K.-H. (2007). ANAC012,a member of the plant-specific NAC transcription factor family, negativelyregulates xylary fiber development in Arabidopsis thaliana. Plant J. 50,1035-1048.

Maitra, S. C. and De, D. N. (1972). Ultrastructure of root cap cells : formation andutilization of lipid. Cytobios 5, 111-118.

Merzlyak, E. M., Goedhart, J., Shcherbo, D., Bulina, M. E., Shcheglov, A. S.,Fradkov, A. F., Gaintzeva, A., Lukyanov, K. A., Lukyanov, S., Gadella, T. W. J.et al. (2007). Bright monomeric red fluorescent protein with an extendedfluorescence lifetime. Nat. Methods 4, 555-557.

Niwa, Y., Hirano, T., Yoshimoto, K., Shimizu, M. and Kobayashi, H. (1999). Non-invasive quantitative detection and applications of non-toxic, S65T-type greenfluorescent protein in living plants. Plant J. 18, 455-463.

Ogawa, M., Kay, P., Wilson, S. and Swain, S. M. (2009). ARABIDOPSISDEHISCENCE ZONE POLYGALACTURONASE1 (ADPG1), ADPG2, andQUARTET2 are Polygalacturonases required for cell separation duringreproductive development in Arabidopsis. Plant Cell 21, 216-233.

Pages, S., Heijne,W. H.M., Kester, H. C. M., Visser, J. andBenen, J. A. E. (2000).Subsite mapping of Aspergillus niger endopolygalacturonase II by site-directedmutagenesis. J. Biol. Chem. 275, 29348-29353.

Pereira-Santana, A., Alcaraz, L. D., Castano, E., Sanchez-Calderon, L.,Sanchez-Teyer, F. and Rodriguez-Zapata, L. (2015). Comparative genomicsof NAC transcriptional factors in angiosperms: implications for the adaptation anddiversification of flowering plants. PLoS ONE 10, e0141866.

Petricka, J. J., Winter, C. M. and Benfey, P. N. (2012). Control of Arabidopsis rootdevelopment. Annu. Rev. Plant Biol. 63, 563-590.

Pi, L., Aichinger, E., van der Graaff, E., Llavata-Peris, C. I., Weijers, D., Hennig,L., Groot, E. and Laux, T. (2015). Organizer-derivedWOX5 signal maintains rootcolumella stem cells through chromatin-mediated repression of CDF4 expression.Dev. Cell 33, 576-588.

Preuss, D., Rhee, S. Y. and Davis, R. W. (1994). Tetrad analysis possible inArabidopsis with mutation of the QUARTET (QRT) genes. Science 264,1458-1460.

Rhee, S. Y., Osborne, E., Poindexter, P. D. and Somerville, C. R. (2003).Microspore separation in the quartet 3 mutants of Arabidopsis is impaired by adefect in a developmentally regulated polygalacturonase required for pollenmother cell wall degradation. Plant Physiol. 133, 1170-1180.

Sarkar, A. K., Luijten, M., Miyashima, S., Lenhard, M., Hashimoto, T., Nakajima,K., Scheres, B., Heidstra, R. and Laux, T. (2007). Conserved factors regulatesignalling in Arabidopsis thaliana shoot and root stem cell organizers. Nature 446,811-814.

Shahmuradov, I. A., Solovyev, V. V. and Gammerman, A. J. (2005). Plantpromoter prediction with confidence estimation. Nucleic Acids Res. 33,1069-1076.

Shimizu, T., Nakatsu, T., Miyairi, K., Okuno, T. and Kato, H. (2002). Active-sitearchitecture of endopolygalacturonase I from Stereum purpureum revealed by

4071

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT

crystal structures in native and ligand-bound forms at atomic resolution.Biochemistry 41, 6651-6659.

Sievers, A., Braun, M. andMonshausen, G. B. (2002). The root cap: structure andfunction. In Plant Root: The Hidden Half (ed. Y. Waisel, A. Eshel and U. Kafkafi),pp. 33-47. New York: CRC Press.

Sprockett, D. D., Piontkivska, H. and Blackwood, C. B. (2011). Evolutionaryanalysis of glycosyl hydrolase family 28 (GH28) suggests lineage-specificexpansions in necrotrophic fungal pathogens. Gene 479, 29-36.

van Pouderoyen, G., Snijder, H. J., Benen, J. A. and Dijkstra, B. W. (2003).Structural insights into the processivity of endopolygalacturonase I fromAspergillus niger. FEBS Lett. 554, 462-466.

Vicre, M., Santaella, C., Blanchet, S., Gateau, A. and Driouich, A. (2005). Rootborder-like cells of Arabidopsis. Microscopical characterization and role in theinteraction with rhizobacteria. Plant Physiol. 138, 998-1008.

Waki, T., Hiki, T., Watanabe, R., Hashimoto, T. and Nakajima, K. (2011). TheArabidopsis RWP-RK protein RKD4 triggers gene expression and patternformation in early embryogenesis. Curr. Biol. 21, 1277-1281.

Waki, T., Miyashima, S., Nakanishi, M., Ikeda, Y., Hashimoto, T. and Nakajima,K. (2013). A GAL4-based targeted activation tagging system in Arabidopsisthaliana. Plant J. 73, 357-367.

Wang, J.-W.,Wang, L. J., Mao, Y. B., Cai,W. J., Xue, H.W. andChen, X. Y. (2005).Control of root cap formation by MicroRNA-targeted auxin response factors inArabidopsis. Plant Cell 17, 2204-2216.

Willemsen, V., Bauch, M., Bennett, T., Campilho, A., Wolkenfelt, H., Xu, J.,Haseloff, J. and Scheres, B. (2008). The NAC domain transcription factors FEZand SOMBRERO control the orientation of cell division plane in Arabidopsis rootstem cells. Dev. Cell 15, 913-922.

4072

RESEARCH ARTICLE Development (2016) 143, 4063-4072 doi:10.1242/dev.142331

DEVELO

PM

ENT