cracking cancers code feb 2014
DESCRIPTION
TRANSCRIPT
![Page 2: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/2.jpg)
The Code
♀♂
Image Credit: National Human Genome Research Institute
• A code passed from cell to cell• ~3.2 billion ‘letters’ in total• Encodes about 22,000 proteins
![Page 3: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/3.jpg)
‘Bugs’ in the Code
Hanahan D & Weinberg R (2011) Hallmarks of Cancer: The Next Generation Cell , Volume 144, Issue 5, Pages 646-674
GACCTGGCAGCCAGGAACGTACTGGT
GACCTGGCAGCC----ACGTACTGGT
Mutations in the Genetic Code
• Vast majority have noconsequence…
…but occasionally…
• Alteration causes a selectivegrowth advantage, increasing the ratio of cell birth to cell death.
Sustain proliferative
signalling
Evade growth
suppressors
Avoid immune destruction
Enabling replicative immortality
Tumor-promoting inflammation
Activating invasion & metastasis
Promoting local blood
supply
Genome instability & mutation
Resisting cell death
Deregulating cellular energetics
![Page 4: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/4.jpg)
Reading the Code: 1
0
200
400
600
800
1000
1200
1400
$100
$1,000
$10,000
$100,000
$1,000,000
$10,000,000
$100,000,000
2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014
Tb
Cost/Genome
Short Read Archive
Draft HumanGenome Project
1st Tumour >12, 000 tumours‘Massively Parralel’
sequencing
Wetterstrand KA. DNA Sequencing Costs: Data from the NHGRI Genome Sequencing Program (GSP) [27/01/2014]Wang and Wheeler (2014) Genomic Sequencing for Cancer Diagnosis and Therapy Annu. Rev. Med. 65: 33-48
![Page 5: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/5.jpg)
Reading the Code: 2
Stein (2010) The case for cloud computing in genome informatics Genome Biology, 11:207Bonfield JK, Mahoney MV (2013) Compression of FASTQ and SAM Format Sequencing Data. PLoS ONE 8(3): e59190.
Challenge: Rate of data production has overtaken improvements in long-term storage capacity.Response: Novel Compression Algorithms
![Page 6: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/6.jpg)
Reading the Code: 3
‘I would say the Human Genome Project is probably
more significant than splitting the atom or going
to the moon.’ Francis Collins, CNN.
‘I would say the Human Genome Project is probably
more significant than splitting the atom or going
to the moon.’ Francis Collins, CNN.
‘I would say the Human Genome Project is probably
more significant than splitting the atom or going
to the moon.’ Francis Collins, CNN.
Shatter & Scan
probab
ing to
obablyy more
the Hu
ly mor
itting
ing to
ignifi ifican ojectProje
Genome
signif
roject
‘ the Human Genome Project probably
more significant’
Identify Original
X 300M
![Page 7: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/7.jpg)
Placing the Code Snippets
………GACCTGGCAGCCAGGAACGTACTGGTGAAAACACCGCAGCATGTCAACATCACAGATTTTGGGCTGGCCAAACT………
TGTCAAGATCACCTGGCAGCCA TTTTGGGCTGGTGGTGAAAACA
Reference genome
TTTGGGCTGGCGTCAAGATCACCAGGAACGTAC
TCAAGATCACACGTACTGGTGA
ACTGGTGAAAA
Candidate variant
![Page 8: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/8.jpg)
Placing the Code Snippets Encodes a protein change in
the EGFR gene This particular coding
change (‘L858R’) renders the tumour sensitive to targeted therapy (Afatinib)
‘Personalised medicine’
D Gonzalez de Castro, P A Clarke, B Al-Lazikani and P Workman (2013) Personalized Cancer Medicine: Molecular Diagnostics, Predictive biomarkers, and Drug Resistance Clinical Pharmacology & Therapeutics; 93 3, 252–259
![Page 9: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/9.jpg)
Identifying Bugs, confidently
Cibulskis et al (2013) Sensitive detection of somatic point mutations in impure and heterogeneous cancer samples Nature Biotechnology 31, 213–219
• “What are we missing?”The influence of sample heterogeneity, purity and read depth.
• ‘False’ mutations: sequencing errors & inaccurate alignment.
• Mutation calling is a work in progress.
• Crowdsourcing a solution.
Roberts et al (2013) A comparative analysis of algorithms for somatic SNV detection in cancer Bioinformatics 2013;29:2223-2230
Caldas C (2012) Cancer sequencing unravels clonal evolution Nature Biotechnology 30, 408–410
![Page 10: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/10.jpg)
Interpreting the Code
Wang L & Wheeler DA. (2014) Genomic sequencing for cancer diagnosis and therapy. Annu Rev Med. Jan 14;65:33-48.
Distinguishing between mutations that confer a selective advantage and those that are selectively neutral.
• Recurrent mutations• Account for variable background
mutation rates
• Comparative genomics
Imielinski M (2012) Mapping the hallmarks of lung adenocarcinoma with massively parallel sequencing. Cell. 2012 Sep 14;150(6):1107-20.
![Page 11: Cracking cancers code feb 2014](https://reader033.vdocument.in/reader033/viewer/2022051612/54c63d1f4a7959ed7f8b4585/html5/thumbnails/11.jpg)
Thank you for your attention
Particular thanks go to:
BABS, Prof. Swanton
& above all to the patients