LETTERS

Crystal structure of T4 endonuclease VII resolving aHolliday junctionChristian Biertumpfel1, Wei Yang1 & Dietrich Suck2

Holliday proposed a four-way DNA junction as an intermediate inhomologous recombination1, and such Holliday junctions havesince been identified as a central component in DNA recombina-tion and repair2. Phage T4 endonuclease VII (endo VII) was thefirst enzyme shown to resolve Holliday junctions into duplexDNAs by introducing symmetrical nicks in equivalent strands3.Several Holliday junction resolvases have since been character-ized4, but an atomic structure of a resolvase complex with aHolliday junction remained elusive. Here we report the crystalstructure of an inactive T4 endo VII(N62D) complexed with animmobile four-way junction with alternating arm lengths of 10and 14 base pairs. The junction is a hybrid of the conventionalsquare-planar and stacked-X conformation. Endo VII protrudesinto the junction point from the minor groove side, opening itto a 14 A 3 32 A parallelogram. This interaction interrupts thecoaxial stacking, yet every base pair surrounding the junction

remains intact. Additional interactions involve the positivelycharged protein and DNA phosphate backbones. Each scissilephosphate that is two base pairs from the crossover interacts witha Mg21 ion in the active site. The similar overall shape and surfacecharge potential of the Holliday junction resolvases endo VII,RuvC, Ydc2, Hjc and RecU, despite having different folds, activesite composition and DNA sequence preference, suggest a con-served binding mode for Holliday junctions.

The 157-residue endo VII encoded by gene 49 of bacteriophage T4resolves branched multimeric T4 DNA before packaging into phageheads5,6. Endo VII displays broad substrate specificity and can bindand cleave single-base mismatches in a DNA duplex as well as three-way and four-way branched DNA structures7. Crystal structures ofendo VII alone revealed two elongated subunits, each consisting ofsix helices and a b-hairpin, intertwined into an S-shaped dimer8. Thetwo subunits are antiparallel, with the amino terminus of one subunit

1National Institute of Diabetes and Digestive and Kidney Diseases, Laboratory of Molecular Biology, 9000 Rockville Pike, Bethesda, Maryland 20892, USA. 2European MolecularBiology Laboratory, Structural and Computational Biology Programme, Meyerhofstr. 1, 69117 Heidelberg, Germany.

a b cArm 1

Arm 4Arm 3

Arm 2

38°

32 Å14 Å

40°

134°

View c

130°

25°

4°

139°

Monomer B

Monomer A

Strand F 5′3′

5′

3′ 5′ Strand D 3′

3′

5′

Strand C

Strand E

Figure 1 | Structure of the T4 endo VII(N62D)–Holliday junction complex.a, The front view of the complex shows the molecular surface of endo VII,with the two subunits coloured differently; the Holliday junction in ribbondiagrams, with each strand colour-coded. Symmetry-related DNAs areshown in grey, and Mg21 ions are shown as purple spheres. b, The branch

point of the junction is open. The angles between DNA arms are marked.Superimposed on the Holliday junction is the composite-omit electrondensity map contoured at 1.0 s. Scissors indicate the scissile phosphates. c, Aside view of the Holliday junction. Angles of DNA arms relative to a flatsurface are shown.

Vol 449 | 4 October 2007 | doi:10.1038/nature06152

616Nature ©2007 Publishing Group

interacting with the carboxy terminus of the other. In the absence of aDNA substrate, endo VII exhibits remarkable flexibility both in thecentre and at the tips of the ‘S’9. Holliday junctions in solution arealso flexible10,11. In the absence of cations, Holliday junctions adoptan extended square-planar conformation. When cations are presentto counteract charge repulsions, Holliday junctions exist in a co-axially stacked-X form, in which four arms are stacked in two pairsand each pair shares one helical axis.

To obtain substrate complexes, active-site residues of endo VIIwere individually mutated to make enzymes that were catalyticallyinactive but competent at binding Holliday junctions. By systematic-ally varying the DNA arm lengths and pairing them with inactivatedendo VII, we obtained 82 different forms of protein–DNA co-crystals.All but three diffracted X-rays poorly. The first crystal structure solvedis the H43N endo VII bound to two DNA heteroduplexes, each com-posed of 14 base pairs (bp) plus two base mismatches (SupplementaryInformation and Supplementary Fig. 1). Using the protein part ofthis complex as a search model, we solved the structure of theendo VII(N62D) complexed with a Holliday junction that had armlengths of alternating 10 bp and 14 bp. Each asymmetric unit containsone Holliday junction bound to a protein dimer (Fig. 1a), and thestructure has been refined at 3.1 A to Rwork 5 24.5% and Rfree 5 27.2%(see Supplementary Table 1). All residues of endo VII and most of the48 bp DNA are traceable except for 1.5 bp at the end of a 14-bp arm(arm 1 in Fig. 1a).

The Holliday junction bound to endo VII is antiparallel, as definedby the polarities of the two non-exchanging strands (blue and green

in Fig. 1). The phosphate backbones of the exchanging strands (redand orange in Fig. 1) are sharply kinked at the crossover point tomake a U-turn. In contrast to the conventional co-axially stackedmodel, the pairwise stackings of arms 1 on 4 and 2 on 3 are inter-rupted by protein residues protruding into the crossover region ofthe junction (Fig. 2). The centre of the junction (branch point) isopened by endo VII into a parallelogram with cross dimensions of14 A between the exchanging strands and 32 A between the non-exchanging strands (Fig. 1b). However, every base pair surroundingthe branch point is intact (Fig. 1). All four arms are in standard Bconformation and extend from the edges of the parallelogram nearlyin a plane (Fig. 1b, c). Arms 1 and 3 (cleavage arms) are almostparallel with their helical axes ,15 A apart. Arms 2 and 4 (non-cleavage arms) are tilted by ,25u towards the major groove (Fig.1c). The roughly ‘H’-shaped junction deviates from the square-planar conformation in the angles between adjacent arms, whichare ,40u and ,135u instead of 90u. The Holliday junction structureobserved in this crystal is in perfect agreement with the gel electro-phoretic mobility of a four-way junction complexed with endo VII(ref. 12).

Endo VII approaches the Holliday junction from the minor-groove side of the branch point. Two long antiparallel helices (H2from two subunits) abut the backbones of the non-exchangingstrands with the negative end of the helical dipole, and stabilize the30-A separation between them (Fig. 2a). Residues Gln 67, His 70,Lys 71 and Arg 74 on these helices penetrate into the junction, keep-ing the exchanging strands 14 A apart (Fig. 2b, c). In addition, the

a

e

e

e

d

d

d

b

c

H70

H70

Arm 2

Arm 3

Arm 4

Arm 1

H1H6

H1T4

NC

R153

K149

H2

H4

H4

H5H6

12

13

56

7

89

10

H1

H5H5

H6

K141

K121

H6

H2

H3

H3

Q67

Q67K71

K71

K71

K71

R74

R74

R74

R74

H70

H70

5

5

98

7

4

321

1

Figure 2 | Protein–DNA interactions. a, The back view of the complexshows endo VII in ribbon diagrams and the Holliday junction as tube-and-sticks with a semi-transparent molecular surface. The four quarters ofendo VII are indicated by orange ovals, and Mg21 and Zn21 are shown aspurple and yellow spheres, respectively. b, c, Protein–DNA interactions at

the branch point. The DNA strands are colour-coded as in Fig. 1. Thedirection and dipolar potential ofa-helices are depicted by arrows and 1 and– signs. d, e, Magnified views of the interactions with arm 1 (or 3) and 4 (or2), respectively. Dashed lines represent hydrogen bonds. Base pairnumbering from the junction is labelled on backbone phosphates.

NATURE | Vol 449 | 4 October 2007 LETTERS

617Nature ©2007 Publishing Group

guanidinium group of each Arg 74 stacks with the first base pair ofarm 2 or 4. These are the only direct interactions between endo VIIand DNA bases. Beyond the branch point, the cleavage arms arecontacted by endo VII around the second and seventh base pair(Figs 2, 3a, and Supplementary Fig. 2), and arms 2 and 4 are contactednear the tenth base pair (Fig. 2e and Supplementary Fig. 2). Theseinteractions are solely with the DNA backbones, which explains thelack of sequence specificity in endo VII cleavage.

The junction has an overall two-fold symmetry (Fig. 1), with itscentre coinciding with the pseudo-dyad axis of the endo VII dimer.The two halves of the protein–Holliday junction complex are notidentical and cannot be superimposed (Supplementary Fig. 3a–c).In contrast, the structure of endo VII bound to two 16-bp hetero-duplexes, each of which occupies the binding site of a cleavage arm(Supplementary Fig. 1), is nearly symmetric (Supplementary Fig.3d). Structural comparison of the two endo VII–DNA complexesreveals that the S-shaped dimeric protein is divided into four struc-turally constant parts: two tips and two internal turning points(Supplementary Fig. 3). Each part is mainly associated with onearm of the Holliday junction (Fig. 2a). The tip of the S, composedof three C-terminal helices (H4, H5 and H6), interacts with arms 2and 4; the turning point of the S, composed of the N-terminal regionsof one subunit and the middle region of another, interacts with arms1 and 3 (Fig. 2). Each protein part exhibits a degree of autonomy, andthe movements of the tips of the S and arms 2 and 4 are mostprominent in the Holliday junction complex (Supplementary Fig.3). Such mobility may explain the independent cleavage by two pro-tein subunits13. Simultaneous interactions by helix H6 with the adja-cent arms (1 and 2 or 3 and 4) 7–9 bp from the branch point may

stabilize protein–DNA complexes and enable endo VII to recognizeand cleave a heteroduplex as well as 3-way and 4-way junctions.

The active sites of endo VII are clearly marked by the catalyticallyessential residues (Asp 40, His 41 and Asn 62; refs 14, 15), the char-acteristic bba fold16 and a Mg21 ion. The scissile phosphates thatinteract with the Mg21 ions in the active sites are symmetricallylocated on each exchanging strand two nucleotides 39 to the branchpoint. The Mg21 ion is coordinated by the side chains of D40 andN62(D), the O39 (leaving group) and the non-bridging Sp oxygen ofthe scissile phosphate (Fig. 3a). The location and coordination geo-metry of the Mg21 resemble the B metal ion in a two-metal ionmechanism17. His 41 and His 43 are also required for efficient cata-lysis14. His 41 approaches the 59 side of the scissile phosphate, andHis 43 seems to be on the O39 leaving-group side potentially involvedin Mg21 coordination. A similar arrangement of active site residueshas been found in homing endonucleases I-HmuI and I-PpoI (ref. 18;Fig. 3b, c), which, like endo VII, belong to the bba-metal family (alsoknown as HNH endonucleases)16. A general mechanism for catalysisby this group of enzymes might involve His 41 (or an equivalentresidue) as a general base to activate water for nucleophilic attack,whereas the divalent cation probably destabilizes the substrate, sta-bilizes the phosphoanion transition state and facilitates productformation.

Holliday junctions were previously crystallized either alone in thestacked-X form or in the square-planar conformation when com-plexed with the tetrameric RuvA or site-specific tyrosine recombi-nases Cre, Flp and phage l integrase19–24 (Fig. 4a–d). The junctions inco-crystal structures are open at the centre, as is observed withendo VII. RuvA stabilizes the Holliday junction in a perfect square

a

b c

Figure 3 | The active site of endo VII. a, A stereo view of the active site. TheMg21 ion (purple sphere) is coordinated by D40, N62D, two oxygen atomsof the scissile phosphate and a water molecule (red sphere). H41 and possiblyH105 from the neighbouring subunit activate the water molecule for

nucleophilic attack. b, The active site of I-HmuI complexed with Mn21 andthe DNA cleavage product (1U3E). c, The active site of I-PpoI complexedwith DNA substrate in the presence of Na1 (1CZ0). The structures areidentified by their Protein Data Bank (PDB) codes.

LETTERS NATURE | Vol 449 | 4 October 2007

618Nature ©2007 Publishing Group

plane, presumably to facilitate branch migration. However, in thecomplexes with tyrosine recombinases, the Holliday junction haslittle interaction with the proteins at the branch point and exhibitstwo-fold instead of four-fold symmetry. The opening in the centre isdue to sequence-specific interactions of the arms with the four pro-tein subunits, which pull the junction apart as dictated by the inter-subunit contacts (Fig. 4c). The absence of interactions with protein atthe branch point allows the junction to isomerize during the recom-bination process, so each pair of strands can be sequentially actedon23 (Supplementary Fig. 4).

Holliday junctions have now also been solved in complex withT7 endonuclease I (ref. 25), which has a type IIP restriction-endonuclease-like active site26 and may represent a class of nucleasesthat recognize Holliday junctions in a stacked-X form (Fig. 4b). How-ever, many Holliday junction resolvases, including Schizosaccharomycespombe Ydc2, Escherichia coli RuvC, archaeal Hjc and bacterial RecU,probably share a similar substrate recognition mode with endo VII.Some of them show sequence preferences, which may be attributedto an indirect-readout mechanism19. Despite the lack of conservationin tertiary and quaternary structures, diverse active site compositionsand different catalytic mechanisms4, these Holliday junction resolvaseshave an S shape or an S-shaped positive electrostatic surface potentialwith comparable dimensions to those of endo VII (refs 27–30; Fig. 4d).They all possess protruding residues in the centre of the ‘S’, and theactive sites are marked by the negative charges for metal-ion coordina-tion near the turning points of the ‘S’. These similarities suggest that

they may recognize and resolve Holliday junctions in a manner similarto endo VII.

METHODS SUMMARY

T4 endo VII was expressed and purified as reported previously8. DNAs were

prepared by annealing purified synthetic oligos. Protein and DNA samples were

mixed at a ratio of one dimer per Holliday junction at a final protein concentra-

tion of 10 mg ml21. Crystals were grown by the vapour-diffusion method in 0.1 M

Bis-Tris (pH 5.5–6.5), 25% (w/v) PEG 3350 and 0.1–0.2 M salt. Diffraction data

were collected at ESRF and APS. The structures were solved by molecular replace-

ment. Details of the whole process of sample preparation, diffraction data collec-

tion, structure determination and analysis are described in the Methods section.

Full Methods and any associated references are available in the online version ofthe paper at www.nature.com/nature.

Received 1 June; accepted 7 August 2007.Published online 16 September 2007.

1. Holliday, R. A mechanism for gene conversion in fungi. Genet. Res. 5, 282–304(1964).

2. Liu, Y. & West, S. C. Happy Hollidays: 40th anniversary of the Holliday junction.Nature Rev. Mol. Cell Biol. 5, 937–944 (2004).

3. Mizuuchi, K., Kemper, B., Hays, J. & Weisberg, R. A. T4 endonuclease VII cleavesHolliday structures. Cell 29, 357–365 (1982).

4. Lilley, D. M. & White, M. F. The junction-resolving enzymes. Nature Rev. Mol. CellBiol. 2, 433–443 (2001).

5. Kemper, B. & Janz, E. Function of gene 49 of bacteriophage T4. I. Isolation andbiochemical characterization of very fast-sedimenting DNA. J. Virol. 18, 992–999(1976).

a

e

b c d

T4 endo VII

T4 endo VII S. pombe Ydc2 B. stearo. RecU S. sol. Hjc

Holliday junction P1 Cre recombinase E. coli RuvA

E. coli RuvC

Figure 4 | Structural comparisons of Holliday junction and Hollidayjunction resolvases. a, The Holliday junction complexed with T4 endo VII.b, Orthogonal views of a Holliday junction in a stacked-X form (1M6G).c, The Holliday junction complexed with Cre recombinase in a square-planar conformation (3CRX). Each subunit is shown in a different colour.The two catalytic subunits are indicated by scissors. The N-terminal

domains of Cre are removed for clarity. d, Four DNA duplexes complexedwith E. coli RuvA mimic a square-planar Holliday junction (1C7Y).e, Molecular shape and electrostatic surface potential (blue, positive; red,negative) of Holliday junction resolvases: T4 endo VII, S. pombe Ydc2(1KCF), E. coli RuvC (1HJR), Bacillus stearothermophilus (B. stearo.) RecU(2FCO) and Sulfolobus solfataricus (S. sol.) Hjc (1HH1).

NATURE | Vol 449 | 4 October 2007 LETTERS

619Nature ©2007 Publishing Group

6. Kemper, B. & Brown, D. T. Function of gene 49 of bacteriophage T4. II. Analysis ofintracellular development and the structure of very fast-sedimenting DNA. J. Virol.18, 1000–1015 (1976).

7. Solaro, P. C., Birkenkamp, K., Pfeiffer, P. & Kemper, B. Endonuclease VIIof phage T4 triggers mismatch correction in vitro. J. Mol. Biol. 230, 868–877(1993).

8. Raaijmakers, H. et al. X-ray structure of T4 endonuclease VII: a DNA junctionresolvase with a novel fold and unusual domain-swapped dimer architecture.EMBO J. 18, 1447–1458 (1999).

9. Raaijmakers, H., Toro, I., Birkenbihl, R., Kemper, B. & Suck, D. Conformationalflexibility in T4 endonuclease VII revealed by crystallography: implications forsubstrate binding and cleavage. J. Mol. Biol. 308, 311–323 (2001).

10. Duckett, D. R. et al. The structure of the Holliday junction, and its resolution. Cell55, 79–89 (1988).

11. Lilley, D. M. Structures of helical junctions in nucleic acids. Q. Rev. Biophys. 33,109–159 (2000).

12. Pohler, J. R., Giraud-Panis, M. J. & Lilley, D. M. T4 endonuclease VII selects andalters the structure of the four-way DNA junction; binding of a resolution-defective mutant enzyme. J. Mol. Biol. 260, 678–696 (1996).

13. Giraud-Panis, M. J. & Lilley, D. M. Near-simultaneous DNA cleavage by thesubunits of the junction-resolving enzyme T4 endonuclease VII. EMBO J. 16,2528–2534 (1997).

14. Giraud-Panis, M. J. & Lilley, D. M. T4 endonuclease VII. Importance of a histidine-aspartate cluster within the zinc-binding domain. J. Biol. Chem. 271, 33148–33155(1996).

15. Golz, S., Christoph, A., Birkenkamp-Demtroder, K. & Kemper, B. Identification ofamino acids of endonuclease VII essential for binding and cleavage of cruciformDNA. Eur. J. Biochem. 245, 573–580 (1997).

16. Scholz, S. R. et al. Experimental evidence for a bba-Me-finger nuclease motif torepresent the active site of the caspase-activated DNase. Biochemistry 42,9288–9294 (2003).

17. Yang, W., Lee, J. Y. & Nowotny, M. Making and breaking nucleic acids: two-Mg21-ion catalysis and substrate specificity. Mol. Cell 22, 5–13 (2006).

18. Stoddard, B. L. Homing endonuclease structure and function. Q. Rev. Biophys. 38,49–95 (2005).

19. Khuu, P. A., Voth, A. R., Hays, F. A. & Ho, P. S. The stacked-XDNA Holliday junction and protein recognition. J. Mol. Recognit. 19, 234–242(2006).

20. Hargreaves, D. et al. Crystal structure of E. coli RuvA with bound DNA Hollidayjunction at 6 A resolution. Nature Struct. Biol. 5, 441–446 (1998).

21. Ariyoshi, M., Nishino, T., Iwasaki, H., Shinagawa, H. & Morikawa, K. Crystalstructure of the Holliday junction DNA in complex with a single RuvA tetramer.Proc. Natl Acad. Sci. USA 97, 8257–8262 (2000).

22. Gopaul, D. N., Guo, F. & Van Duyne, G. D. Structure of the Holliday junctionintermediate in Cre-loxP site-specific recombination. EMBO J. 17, 4175–4187(1998).

23. Conway, A. B., Chen, Y. & Rice, P. A. Structural plasticity of the Flp–Hollidayjunction complex. J. Mol. Biol. 326, 425–434 (2003).

24. Biswas, T. et al. A structural basis for allosteric control of DNA recombination by lintegrase. Nature 435, 1059–1066 (2005).

25. Hadden, J. M., Declais, A.-C., Carr, S. B., Lilley, D. M. J. & Phillips, E. V. Thestructural basis of Holliday junction resolution by T7 endonuclease I. Naturedoi:10.1038/nature06158 (this issue).

26. Declais, A. C., Hadden, J., Phillips, S. E. & Lilley, D. M. The active site of thejunction-resolving enzyme T7 endonuclease I. J. Mol. Biol. 307, 1145–1158 (2001).

27. Ariyoshi, M. et al. Atomic structure of the RuvC resolvase: a Holliday junction-specific endonuclease from E. coli. Cell 78, 1063–1072 (1994).

28. Bond, C. S., Kvaratskhelia, M., Richard, D., White, M. F. & Hunter, W. N. Structureof Hjc, a Holliday junction resolvase, from Sulfolobus solfataricus. Proc. Natl Acad.Sci. USA 98, 5509–5514 (2001).

29. Ceschini, S. et al. Crystal structure of the fission yeast mitochondrial Hollidayjunction resolvase Ydc2. EMBO J. 20, 6601–6611 (2001).

30. McGregor, N. et al. The structure of Bacillus subtilis RecU Holliday junctionresolvase and its role in substrate selection and sequence-specific cleavage.Structure 13, 1341–1351 (2005).

Supplementary Information is linked to the online version of the paper atwww.nature.com/nature.

Acknowledgements We thank D. Leahy and M. Gellert for critical reading of themanuscript, S. Ramon-Maiques for collecting the diffracting data of theendo VII–heteroduplex complex, and D. M. Lilley for background reading materials.C.B. thanks J. Basquin, E. Ennifar and C. Sauter for help with crystallization and datacollection, and M. Nowotny and J. Y. Lee for help with manuscript preparation. Thisresearch was supported by EMBL, Deutsche Forschungsgemeinschaft and theIntramural Research Program of NIDDK, NIH.

Author Contributions C.B. carried out all experiments. The project was initiated atEMBL and finished at NIH. All authors contributed to experimental design,interpretation and manuscript preparation.

Author Information Atomic coordinates and structure factors of theendo VII–DNA complexes have been deposited in the Protein Data Bank. Theaccession codes are 2QNC and 2QNF for the Holliday junction and theheteroduplex complex, respectively. Reprints and permissions information isavailable at www.nature.com/reprints. The authors declare no competing financialinterests. Correspondence and requests for materials should be addressed to W.Y.(wei.yang@nih.gov) or D.S. (suck@embl.de).

LETTERS NATURE | Vol 449 | 4 October 2007

620Nature ©2007 Publishing Group

METHODSProtein and DNA sample preparation. T4 endo VII was expressed and purified

as reported previously8 with minor modifications. The purified protein was

stored in 10 mM HEPES (pH 7.0), 250 mM NaCl and 1 mM DTT with or with-

out 10 mM MgCl2. Oligonucleotides were either purchased in HPLC-purified

form from Metabion or were obtained from the Facility for Biotechnology

Resources (FDA/NIH, Bethesda) and subsequently HPLC purified on a Poros

oligo R3 column. Sequences of DNA oligos in the co-crystals are diagrammed in

Supplementary Fig. 2. To make the Holliday junction of 4w214p (2 bp and 14 bp in

alternating arms), two pairs of oligos—4w214p-1 (CACATCGATGGAGCCG)and 4w214p-2 (CGGCTCCATCGATGTG), and 4w214p-3 (CACATCGATGG-

AGCGC) and 4w214p-4 (GCGCTCCATCGATGTG)—were annealed separately

before mixing at a 1:1 molar ratio. To make the Holliday junction of 4w1014 (10

and 14 bp in alternating arms), 4w1014-1 (CGAAGAATTCCGGATTAGGG-

ATCC), 4w1014-2 (GGATCCCTAAGCTCCATCGATGTG), 4w1014-3 (CACA-

TCGATGGAGCCGCTAGGCCT) and 4w1014-4 (AGGCCTAGCGTCCGGAA-

TTCTTCG) were mixed at an equimolar ratio and were annealed by heating to

363 K for 5 min and slow-cooling to 295 K in 90 min. Protein and DNA samples

were mixed at a ratio of one dimer per junction at a final protein concentration of

10 mg ml–1.

Crystallization. Crystals were grown by the vapour-diffusion method at 293 K.

Initial crystallization conditions were found using the Index Screen (Hampton

Research). Crystals of endo VII–4w214p complexes were obtained in 25% (w/v)

PEG 3350, 100 mM Bis-Tris (pH 6.5), 220 mM Li2SO4 and 5% (w/v) glucose and

were transferred to a stabilization solution containing 20% (w/v) PEG 3350,

100 mM Bis-Tris/HCl (pH 6.5), 180 mM Li2SO4 and 20%(w/v) glucose. The

crystals of endo VII–4w1014 complexes were grown in 0.1 M Bis-Tris (pH 5.5)

and 25% (w/v) PEG 3350, and were stepwise soaked in a reservoir solutioncontaining 5, 10 and 20% (w/v) ethylene glycol for cryoprotection.

Diffraction data collection and structure determination. Diffraction data of

the endo VII–Holliday junction crystals were collected at ID 14-1 (ESRF) after

they were flash-cooled in liquid nitrogen and processed with XDS31. Data could

be processed equally well in space groups P43 and P43212. Twinning analysis

indicated partial merohedral twinning for the lower symmetry space group.

Diffraction data of the endo VII–4w214p crystals were collected at 22-ID

(APS) at 100 K and processed with HKL2000 (ref. 32). The crystal belonged to

space group P31. Structure factors for both data sets were calculated with

TRUNCATE33 (Supplementary Table 1).

Molecular replacement with PHASER34 was successfully performed on the

endo VII–4w214p crystal using an apo protein structure (PDB code 1E7D) as

a search model. Because crystals diffracted anisotropically, the anisotropic cor-

rection function in PHASER was used. The resulting electron density map was of

a poor quality and was improved after density modification by solvent flipping

using CNS35. Two DNA duplexes were clearly visible in the 2Fo – Fc map. The

model of protein and DNA was built and refined up to 3 A by multiple rounds

of manual fitting in O36 or COOT37 and positional refinement in CNS.Interestingly, the DNA did not form a Holliday junction of alternating 2-bp

and 14-bp arm lengths inside the crystal. Instead, two 16-mer duplexes with

two mismatching base pairs each are associated with an endo VII dimer in the

asymmetric unit (Supplementary Fig. 1).

The protein part of the refined endo VII–4w214p complex was subsequently

used to solve the structure of the Holliday junction complex by PHASER, which

found a solution only in the space group P43. After applying density modifica-

tion (solvent flipping) in CNS, one arm of the Holliday junction was clearly

visible in a 2Fo – Fc map. After cycles of model building and refinement, the

entire Holliday junction was built in. The final refinement was carried out using

data processed in space group P43212, of which each asymmetric unit contains

one endo VII dimer and one Holliday junction. Because of the rather low reso-

lution, it was not clear which orientation the DNA has inside the crystal.

Refinement was also carried out with the DNA sequence switched between arms

1 and 3, and 2 and 4, which resulted in similar refinement statistics. We assume

that there is a mixture of both orientations in the crystals. Because there is no

sequence-specific recognition, we used one orientation for refinement to keep

the parameter-to-data ratio reasonable.

DNA structures and protein–DNA interactions were analysed using the pro-

grams CURVES38 and NUCPLOT39. Structural superimpositions were per-

formed using the program LSQMAN40. Electrostatic surface potentials were

calculated using GRASP41, and all molecular visualizations were prepared using

PYMOL (http://pymol.sourceforge.net).

31. Kabsch, W. Automatic processing of rotation diffraction data from crystals ofinitially unknown symmetry and cell constants. J. Appl. Crystallogr. 26, 795–800(1993).

32. Otwinowski, Z. & Minor, W. Processing of X-ray diffraction data collected inoscillation mode. Methods Enzymol. 276, 307–326 (1997).

33. The. CCP4 suite: programs for protein crystallography. Acta Crystallogr. D 50,760–763 (1994).

34. McCoy, A. J., Grosse-Kunstleve, R. W., Storoni, L. C. & Read, R. J. Likelihood-enhanced fast translation functions. Acta Crystallogr. D 61, 458–464 (2005).

35. Brunger, A. T. et al. Crystallography & NMR system: A new software suite formacromolecular structure determination. Acta Crystallogr. D 54, 905–921 (1998).

36. Jones, T. A., Zou, J.-Y. & Cowan, S. W. Improved methods for building models inelectron density maps and the location of errors in these models. ActaCrystallogr. A 47, 110–119 (1991).

37. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics. ActaCrystallogr. D Biol. Crystallogr. 60, 2126–2132 (2004).

38. Lavery, R. & Sklenar, H. Defining the structure of irregular nucleic acids:conventions and principles. J. Biomol. Struct. Dyn. 6, 655–667 (1989).

39. Luscombe, N. M., Laskowski, R. A. & Thornton, J. M. NUCPLOT: a program togenerate schematic diagrams of protein–nucleic acid interactions. Nucleic AcidsRes. 25, 4940–4945 (1997).

40. Kleywegt, G. J. Use of non-crystallographic symmetry in protein structurerefinement. Acta Crystallogr. D 52, 842–857 (1996).

41. Nicholls, A., Sharp, K. A. & Honig, B. Protein folding and association: insights fromthe interfacial and thermodynamic properties of hydrocarbons. Proteins 11,281–296 (1991).

doi:10.1038/nature06152

Nature ©2007 Publishing Group