curcumin inhibits the sonic hedgehog signaling pathway and...

Curcumin Inhibits the Sonic HedgehogSignaling Pathway and Triggers Apoptosisin Medulloblastoma Cells

Maha H. Elamin,1 Zakia Shinwari,1 Siti-Faujiah Hendrayani,1 Hindi Al-Hindi,2 Essam Al-Shail,3

Yasser khafaga,4 Amani Al-kofide,5 and Abdelilah Aboussekhra1,6*1Department of Biological and Medical Research, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia2Department of Pathology, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia3Department of Neurosciences, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia4Department of Radio-Oncology, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia5Department of Oncology, King Faisal Specialist Hospital and Research Center, Riyadh, Saudi Arabia6College of Medicine, Al-Faisal University, Riyadh, Saudi Arabia

Medulloblastoma is an aggressive primary brain tumor that arises in the cerebellum of children and young adults.The Sonic Hedgehog (Shh) signaling pathway that plays important roles in the pathology of this aggressive disease is apromising therapeutic target. In the present report we have shown that curcumin has cytotoxic effects on

medulloblastoma cells. Curcumin suppressed also cell proliferation and triggered cell-cycle arrest at G2/M phase.Moreover, curcumin inhibited the Shh–Gli1 signaling pathway by downregulating the Shh protein and its mostimportant downstream targets GLI1 and PTCH1. Furthermore, curcumin reduced the levels of b-catenin, the activate/phosphorylated form of Akt and NF-kB, which led to downregulating the three common key effectors, namely C-myc,N-myc, and Cyclin D1. Consequently, apoptosis was triggered by curcumin through the mitochondrial pathway viadownregulation of Bcl-2, a downstream anti-apoptotic effector of the Shh signaling. Importantly, the resistant cellsthat exhibited no decrease in the levels of Shh and Bcl-2, were sensitized to curcumin by the addition of the Shh

antogonist, cyclopamine. Furthermore, we have shown that curcumin enhances the killing efficiency of nontoxic dosesof cisplatin and g-rays. In addition, we present clear evidence that piperine, an enhancer of curcumin bioavailability inhumans, potentiates the apoptotic effect of curcumin against medulloblastoma cells. This effect was mediated

through strong downregulation of Bcl-2. These results indicate that curcumin, a natural nontoxic compound,represents great promise as Shh-targeted therapy for medulloblastomas. � 2009 Wiley-Liss, Inc.

Key words: chemosensitization; Bcl-2; piperine; radiosensitization

INTRODUCTION

Medulloblastoma, aggressive tumor of the cere-bellum, is the most common malignant brain tumorin children. It represents �20% of pediatric intra-cranial neoplasms [1]. Medulloblastoma, like all theother types of cancer, results from alterations inthe equilibrium between cell growth and cell death,which drives the proliferation of cerebellar granuleneuronal precursors (CGNP) [2]. This equilibrium isunder the control of different metabolic pathways.The most important medulloblastoma-related carci-nogenesis pathways are Sonic Hedgehog (Shh),WNT/b-catenin, and Akt/nuclear factor-kB (NF-kB)[3]. The Shh signaling pathway plays important rolesin the proliferation of the neuronal precursor of thecerebellum and in the genesis of medulloblastoma[4,5]. Shh induces the transcription of two importanttranscription factors Glioma-associated oncogenehomolog 1 (GLI1) and patched homolog 1 (PTCH1)in many cell types [6]. Furthermore, Shh induces theexpression of different important oncoproteins,

including the cell-cycle proteins N-myc, C-myc,and Cyclin D1 [1,7]. Like Shh, N-myc activity isnecessary for both normal and neoplastic cerebellargrowth [8–10]. Amplification of N-myc and/or C-mycoccurs in 5–10% of medulloblastoma cases [11]. Themyc family of proteins acts as transcription regulatorsthat play key roles in cell-cycle progression, trans-formation, and angiogenesis [12]. Amplifications aswell as high transcriptional levels of MYCC areassociated with an unfavorable survival outcome of

MOLECULAR CARCINOGENESIS 49:302–314 (2010)

� 2009 WILEY-LISS, INC.

Abbreviations: Shh, Sonic Hedgehog; NF-kB, nuclear factor-kB;GLI1, Glioma-associated oncogene homolog 1; PTCH1, patchedhomolog 1; DMSO, dimethyl sulfoxide; PBS, phosphate-bufferedsaline; PI, propidium iodide; IR, ionizing radiation.

*Correspondence to: King Faisal Specialist Hospital and ResearchCenter, BMR, MBC # 03-66, PO Box 3354, Riyadh 11211, SaudiArabia.

Received 4 June 2009; Revised 13 October 2009; Accepted29 October 2009

DOI 10.1002/mc.20604

Published online 18 December 2009 in Wiley InterScience(www.interscience.wiley.com)

medulloblastoma patients [13,14]. The other impor-tant mediator of the Shh pathway is the anti-apoptosis Bcl-2 protein, which is frequently overex-pressed in medulloblastomas [15,16]. The upregula-tion of Bcl-2 and the consequent inhibition ofapoptosis in Shh-dependent medulloblastoma isAkt/NF-kB-related [16]. In fact several lines ofevidence suggest that the Atk/NF-kB pathway syner-gizes with Shh to promote aggressive medulloblas-toma [16,17].

Currently, medulloblastoma patients are besttreated with surgery, craniospinal radiotherapy andchemotherapy [18–21]. However, these aggressiveregimens are associated with serious long-term sideeffects [1,20]. Furthermore, surgery cannot beachieved in all cases. Therefore, several new ther-apeutic solutions are currently under investigation.These include the replacement of combined radio-and chemotherapy by potent and more specificchemotherapy [3,22]. Thereby, there is continuousdemand for the identification and the developmentof nontoxic and efficient anti-medulloblastomaagents. In line with this, several dietary constituentshave been studied and have in fact shown greatpreventive and anti-cancer properties, without theadverse side effects of the currently used chemo-therapeutic agents [23,24]. Curcumin (diferuloyl-methane) is one of the most widely characterizedphytochemicals. It is a yellow natural productextracted from the rhizoma of curcuma longa (tur-meric) that has been used as food spice and colorant.Curcumin is a polyphenolic, nontoxic, pharmaco-logically active substance that has anti-oxidant, anti-inflammatory, and antiseptic activities. Thereby, ithas been used for centuries as therapeutic agentagainst various diseases [25]. Curcumin has variousanti-cancer characteristics that include the inhib-ition of cell proliferation and angiogenesis as well asthe induction of cell death in tumor cells [26].However, curcumin has only marginal effect onvarious normal cell types [27]. Furthermore, it hasbeen recently shown that curcumin induces immu-norestoration in tumor-bearing animals [28], indi-cating that the inclusion of this natural product intherapeutic regimens against cancer should bebeneficial for great proportion of cancer patients. Infact, curcumin has already been the subject of severalclinical trials for potential use as chemotherapeuticagent [25].

In this study we investigated the effect of curcuminon medulloblastoma cells, and we have shown thatthis natural nontoxic agent inhibits the Shh–Gli1signaling and has great anti-medulloblastoma effects.

MATERIALS AND METHODS

Cell Lines, Chemicals, and Cell Culture

DAOY cell line was obtained form ATCC, whilethe other medulloblastoma cells are primary cells

cultured in the laboratory. Cisplatin (cis diammine-dicloroplatinum II), Curcumin, and piperine (Sigma,St. Louis, MO) were dissolved in dimethyl sulfoxide(DMSO) and used at the indicated concentrations.

For the development of primary cell cultures, apiece of the medulloblastoma sections, obtainedfrom consented patients, was first placed in a drop ofcomplete media (DMEM:F12, 50:50 medium supple-mented with 15% NBCS and 1% antibiotics) beforebeing minced with scalpel blades to very small pieces(

Immunoblotting

SDS–PAGE was performed using 12% separatingminigels and equal amounts of protein extract(30 mg) were loaded. After protein migration andtransfer onto polyvinylidene difluroide membrane(PVDF), the membrane was incubated overnightwith the appropriate antibodies:

NF-kB (F-6), Shh (H-160), b-catenin (9F2), N-myc(3C 165), Cyclin D1 (HD11), Survivin (C-19), Atk(b-1), p-Akt (104A282), Bcl-2 (C-2), Bax (B-9),pro-caspase3 (H-277), pro-caspase9 (F-7), PARP(H-250), NF-M (1A2), HuD (E1), Nestin (10C2),GAPDH (FL-335) and b-actin (C-11) and C-myc(C-19) from Santa Cruz, CA.

RNA Extraction, cDNA Synthesis, and RT-PCR Assay

Total RNA was extracted using the Tri1 Reagent(Sigma) and the yield was quantitated spetrophoto-metrically. Following the manufacturer’s instruc-tions, single stranded cDNA was synthesized using200 ng of total RNA, the MMLV reverse transcriptaseand the oligo dT18 (Roche, San Francisco, CA). ThecDNA was amplified for 40 cycles under the follow-ing conditions: melting temperature (958C) for 50 s,annealing temperature (548C) for 50 s, and extensiontemperature (728C) for 1 min. The PCR products wereseparated by electrophoresis on a 2% agarose gel at80 V for an hour. The sequences of the primers wereas follow:

GLI1, Fw: ACC CGG GGT CTC AAA CTG; Rv: GGCTGA CAG TAT AGG CAG AGC

PTCH1, Fw: GAC GCC GCC TTC GCT CTG; Rv:GCC CAC AAC CAA GAA CTT GCC

b-actin, Fw: CCCAGCACAATGAAGATCAAGATCAT;Rv: ATCTGCTGGAAGGTGGACAGCGA

Quantification of Protein and RNA Expression Levels

The expression levels of RNAs and proteinswere measured using the densitometer (BIO-RAD,Hercules, CA; GS-800 Calibrated Densitometer).Films were scanned and protein signal intensity ofeach band was determined. Next, dividing theobtained value of each band by the values of thecorresponding internal control allowed the correc-tion of the loading differences. The fold of inductionwas determined by dividing the corrected values thatcorresponded to the treated samples by that of thenontreated one (time 0).

Annexin V/PI and Flow Cytometry

Confluent cells were either treated with DMSO andused as control or challenged with different agents,whereupon cells were incubated in DMEM/F12medium with supplements. Detached and adherentcells were harvested 72 h later, centrifuged and re-suspended in 1 ml of PBS. Cells were then stained bypropidium iodide (PI) and Alexa Fluor 488 Annexin

V, using Vibrant Apoptosis Assay kit #2 (Molecularprobe, Eugene, OR). Stained cells were analyzed byflow cytometry. The percentage of cells was deter-mined by the FACScadibur apparatus and the CellQuest Pro software from Becton Dickinson (San Jose,CA). For each cell culture three independent experi-ments were performed using 104 cells in eachexperiment.

Cell-Cycle and Cell Death Analysis by Flow Cytometry

Cells were treated with DMSO or curcumin, andthen harvested and resuspended in 1 ml of PBS beforebeing fixed by drop wise addition of 3 ml of 100%methanol. Fixed cells were centrifuged, resuspendedin 50 ml of RNase (1 mg/ml) and incubated for 30 minat room temperature, followed by addition of 1 mlof 0.1 mg/ml of PI. Cells were analyzed for DNAcontent by flow cytometry (Becton Dickinson). Thepercentage of cells in various cell-cycle phases wasdetermined by using Cell Quest software (BectonDickinson).

RESULTS

Curcumin Has Cytotoxic and Anti-Proliferative Effectson Medulloblastoma Cells

We investigated the cytotoxic effect of curcuminon different medulloblastoma primary cells andthe DAOY cell line using the WST-1 assay. Cells wereseeded in triplicates into microtiter plates and treatedwith increasing concentrations of curcumin for 24 h,and then the cytotoxic effect was measured. For eachcell culture, at least three independent experimentswere carried out. Figure 1A shows dose-dependenteffect of curcumin on four different medulloblastomacells (MED-1, MED-4, MED-5, and DAOY). WhileMED-1 cells exhibited high resistance to curcumin,the three other cells showed different sensitivity tothe agent. The LC50 (the concentration that leads to50% survival) were 20, 25, and 28mM for the DAOY,MED-5, and MED-4, respectively (Figure 1A). Thisshows that curcumin is cytotoxic against mostmedulloblastoma cell cultures and that the DAOYcell line is the most sensitive.

Subsequently, the MED-5 cells were treatedwith 40mM curcumin for different periods of time(0, 24, 48, and 72 h) and curcumin-dependent cellkilling was assessed using flow cytometry. Figure 1Bshows that cell death increased in a time-dependentmanner, reaching the maximum proportion (58%)after 72 h of treatment. This confirms the cytotoxiceffect of curcumin against medulloblastoma cellsand shows that its effect is time dependent.

Next, we investigated the effect of curcuminon medulloblastoma cell proliferation using theWST-1 cell proliferation assay. Cells were seededinto microtiter plates and were either mocktreated or challenged with 40mM of curcumin fordifferent periods of time. Figure 1C shows thatwhile the number of nontreated cells increased in

304 ELAMIN ET AL.

Molecular Carcinogenesis

a time-dependent manner, the number of curcumin-treated cells decreased gradually reflecting curcu-min-dependent inhibition of cell proliferation. Likefor apoptosis the effect was more pronounced onDAOY cells, while was not significant against theMED-1 cell culture and intermediate for MED-4 andMED-5 (Figure 1C).

After showing the effect of curcumin on cellproliferation we sought to investigate its effect onthe cell cycle of the MED-4 and MED-5 cell culturesthat were treated with different concentrations for3 days. Figure 1D shows a dose-dependent accumu-lation of cells at the G2/M phase of the cell cyclereaching after 3 days of treatment 59% and 63%in MED-4and MED-5, respectively. Similar proportionof G2/M cells was reached at only 20mM of curcuminin MED-5 cells (Figure 1D). This shows that curcumintriggers G2/M cell-cycle arrest in medulloblastomacells, which led to growth inhibition.

Curcumin Inhibits the Sonic Hedgehog Signaling Pathwayin Medulloblastoma Cells

The Shh signaling pathway is a major regulator ofthe equilibrium between cell proliferation and cell

death, and therefore is implicated in the develop-ment of the cerebellar tumor medulloblastoma[1,29]. Thereby, we sought to study the effect ofcurcumin on this important medulloblastoma-related pathway. To this end, MED-5 cells weretreated with 40 mM of curcumin for different periodsof time (0–24 h), and then cellular lysates wereprepared and used for Western blot analysis usingspecific antibodies and GAPDH as internal control.Figure 2A shows that the expression level of theShh protein was downregulated 12.5-fold after 8 hof treatment, reaching a level as low as 8% of thebasal level. To further appreciate the curcumin effecton the oncogenic Shh signaling pathway, we studiedits effect on the direct downstream targets of the Shhprotein, namely PTCH1 and GLI1. Therefore, MED-5cells were either sham treated or challengedwith 40 mM of curcumin for 8 h. Total RNA waspurified and the levels of the PTCH1 and the GLI1mRNAs were assessed by RT-PCR. Figure 2B showsthat the level of both genes decreased significantlyin response to curcumin treatment. Indeed, thelevel of GLI1 decreased more than five times andthe PTCH1 level decreased more than 2-fold

Figure 1. Cytotoxic and anti-proliferative effects of curcumin onmedulloblastoma cells. (A) Exponentially growing cells were culturedin 96-well plates and treated with the indicated curcumin concen-trations for 72 h. Cell death was analyzed using the WST-1 assay. Thearrows indicate the LC50 for each cell line and the error barsrepresent standard deviations. (B) MED-5 cells were treated with40mM of curcumin and reincubated for the indicated periodsof time. Cell death was assessed by flow cytometry. The numbers in

the boxes represent the proportion of cell death. (C) Cells werecultured in 96 wells plates and challenged with curcumin (40 mM) forthe indicated periods of time, and then cell proliferation wasassessed by the WST-1 assay. Dashed lines: treated cells, continueslines, nontreated cells. (D) Cells were either mock treated orchallenged with the indicated concentrations of curcumin for 72 h.The cell cycle status was analyzed by flow cytometry. The numbersrepresent the proportions of G2/M cells.

ANTI-MEDULLOBLASTOMA EFFECTS OF CURCUMIN 305


as compared to the control nontreated cells(Figure 2B).

To further elucidate the effect of curcumin on theShh signaling pathway, we studied the effect ofcurcumin on the main Shh and Gli1 downstreamtargets, N-myc, C-myc, and Cyclin D1. Cyclin D1and N-myc are important mediators of Shh-inducedproliferation and carcinogenesis [30]. Importantly,curcumin led to a sharp decrease in the expressionof these three proteins during the first 4 h of treat-ment (Figure 2A). The levels of C-myc, Cyclin D1, andN-myc were reduced 14-, 11-, and 6-fold, respectively(Figure 2A). Since the anti-apoptosis Bcl2 proteinis also an important mediator of Shh in medullo-blastoma [15] and its transcriptionally upregulatedby Shh through the Gli1 transcription factor [31],we sought to investigate the effect of curcuminon this protein. Figure 2A shows 50% decrease inthe level of Bcl-2 after 8 h of treatment. Theseresults present the first evidence that curcumininhibits the Shh–Gli1 signaling in medulloblastomacells.

Next, we investigated whether the inhibition ofthe Shh signaling pathway affected the levels ofb-catenin and NF-kB, two major transcription factorsthat are implicated in medulloblastoma carcino-genesis and interact with Shh [16,17,32]. Interest-

ingly, 8 h of curcumin treatment led to a sharpdecrease in the level of the NF-kB protein andthe phosphorylated/active form of the Akt kinase,reaching levels that represents only 6% and 35% ofthe basal level, respectively (Figure 2C). Likewise,the level of the transcription factor b-cateninwas strongly downregulated in response to curcuminreaching a level 10-fold lower than the corres-ponding basal level, after only 4 h of treatment(Figure 2C).

Among the cancer markers that are under thecontrol of the NF-kB pathway there is the anti-apoptosis protein survivin. Figure 2C shows thatcurcumin treatment led to the downregulation ofsurvivin as well. The reduction in the level of thisprotein was time dependent in medulloblastomacells reaching a level 12-fold lower after 24 h oftreatment (Figure 3C).

It is noteworthy that the effect of curcumin onthese proteins and pathways was also observed in theDAOY cell line (data not shown), indicating that thiseffect could be considered as general to mostmedulloblastoma cells.

Together, these results indicate that curcuminhas great inhibitory effect on the Shh signaling path-way and its downstream medulloblastoma-driveneffectors.

Figure 2. Curcumin inhibits the Shh–Gli1 signaling pathway.MED-5 cells were not treated or challenged with curcumin (40 mM)and then reincubated for the indicated periods of time. (A and C)Whole cell extracts were prepared and used for immunoblot analysisusing the indicated antibodies. (B) Total RNA was extracted from

these cells, and the cDNA was synthesized and used to evaluate themRNA expression for the indicated genes using the RT-PCRtechnique. b-Actin was used as internal control. The numbers underthe bands represent the corresponding expression levels ascompared to the basal level (time 0, control).

306 ELAMIN ET AL.


Curcumin Triggers Apoptosis Through the MitochondrialPathway in Medulloblastoma Cells

Since the inhibition of the Shh-dependent signal-ing pathway triggers apoptosis in medulloblastoma[33,34], we investigated whether curcumin triggersapoptosis in these cells. To this end, the Annexin V/PI staining technique followed by flow cytometry

was used. Sixty percent confluent cells were treatedwith different concentrations of curcumin for 3 days,and then were stained and sorted. Figure 3A showsfour groups of cells, viable cells that excluded bothAnnexin V and PI (Annexin V�/PI�), bottom left;early apoptotic cells that were only stained withAnnexin V (Annexin Vþ/PI�), bottom right; lateapoptotic cells that were stained with both Annexin

Figure 3. Curcumin triggers apoptosis through the internal path-way in medulloblastoma cells. Sub-confluent cells were either mocktreated or challenged with the indicated concentrations of curcuminfor 72 h and then cell death was analyzed using the Annexin V/PIflow cytometry assay. (A) Charts, with the numbers indicating theproportion of apoptotic and necrotic cells. (B) Graph representing thedose-dependent apoptosis in the indicated cells. (C) Histogram, cellswere treated with 40 mM curcumin for 72 h. M for MED. (D) The

MED-5 cells were treated with 40mM curcumin for the indicatedperiods of time, and then cell extracts were prepared and used forimmunoblotting analysis using the indicated antibodies. the numbersunder the bands represent the corresponding expression levels ascompared to the basal level (time 0). (E) Graph showing the Bax/bcl-2ratio. Error bars represent standard deviations of three differentexperiments.



V and PI (Annexin Vþ/PIþ), top right and necroticcells that were only stained with PI (Annexin V�/PIþ), top left. The proportion of apoptosis wasconsidered as the sum of both early and lateapoptosis after deduction of the proportion ofspontaneous apoptosis. Curcumin triggered essen-tially apoptosis in all medulloblastoma cells. Thiseffect increased in a dose-dependent manner, andcells showed different responses, with the highestproportion of apoptosis induced in the DAOY cellline (Figure 3A and B). This parallels the cytotoxicresult presented in Figure 1A, indicating thatthe curcumin-dependent cytotoxicity is mediatedmainly through the apoptotic cell death pathway,with only marginal necrosis. It is noteworthy thatthere is a great correlation between the proportion ofcell death detected by WST-1 (Figure 1A) and byAnnexin V (Figure 3A and B).

To shed more light on the effect of curcumin onmedulloblastoma cells we treated 11 medulloblas-toma cells (10 primary cultures and the DAOY cellline) with 40 mM of curcumin for 3 days and then theapoptotic response was assessed. Figure 3C showsthat curcumin has differential effect on medullo-blastoma cells. While eight cells exhibited highsensitivity with more than 40% cell death throughapoptosis, three cell cultures showed high resistanceto the drug. MED-5, MED-7, and DAOY were themost sensitive with 80% cell death, whilst MED-1,and MED-9 were the most resistant with about 30%apoptotic cells (Figure 3C).

To confirm the induction of apoptosis by curcu-min in medulloblastoma cells and determine theapoptotic route that curcumin-dependent Shhinhibition activates, the MED-5 cells were treatedwith 40 mM of curcumin and harvested afterdifferent time periods (0, 24, 48, and 72 h). Wholecell extracts were prepared and 50 mg of extractedproteins were used to evaluate the levels of differentpro- and anti-apoptotic proteins using the immuno-blot technique and specific antibodies. b-Actin andGAPDH were used as internal controls. First, weassessed the effect of curcumin on the caspase-3 andPARP proteins (two principal markers of apoptosis).Figure 3D shows that the level of pro-caspase 3decreased fivefolds after 48 h of curcumin treatment.Concomitantly, the level of the cleaved form of thePARP protein increased significantly after 72 h oftreatment. This clearly shows the induction ofapoptosis by curcumin in medulloblastoma cells.Next, we assessed the levels of Bax and Bcl-2 proteinsand have found that while the level of Bax increasedin a time-dependent manner, the level of Bcl-2decreased sharply after only 24 h of treatment andthen increased slightly (Figure 3D). This resultedafter 48 h of treatment in 15-fold increase in theBax/Bcl-2 ratio (Figure 3E), showing that curcumintriggers apoptosis through the mitochondrial path-way. To confirm this, we assessed the level of the pro-

caspase 9 in these cells, and showed that the level ofthis protein decreased in a time-dependent mannerreaching a level more than threefold lower after 72 hof treatment (Figure 3D). Together, these resultsdemonstrated that curcumin triggers apoptosisin medulloblastoma cells through the internalmitochondrial pathway via Bcl-2 decrease.

The Shh Antagonist Cyclopamine SensitizesCurcumin-Resistant Medulloblastoma Cells

To further elucidate the role of the Shh pathway incurcumin-dependent induction of apoptosis inmedulloblastoma cells, we investigated the effect ofcurcumin on the Shh pathway in the curcumin-resistant MED-1 cells. Figure 4A shows that curcumindid not significantly affect the expression of the Shhand its important downstream protein Cyclin D1 inMED-1 cells. This indicates that the resistance ofthese cells to curcumin could be due to the inabilityof curcumin to inhibit the Shh signaling pathway. Toinvestigate this possibility we explored whethercyclopamine, a natural antagonist of the Shh signal-ing pathway [35], could sensitize MED-1 cells tocurcumin.

Cells were treated with curcumin (20mM), cyclop-amine (10 and 20mM), and the combinations ofboth agents, for 72 h and then the proportion ofapoptosis was determined. Figure 4B shows thatwhile the effect of the single agents is only marginalthe combination of curcumin and cyclopaminetriggered high proportion of apoptotic cells. Indeed,more than 80% of cells died through apoptosis whencyclopamine (20 mM) was added to curcumin (20 mM)(Figure 4C). Similar results were obtained with theMED-9 cells (data not shown). This clearly shows thatMED-1 and MED-9 cells are resistant to curcumin-dependent inhibition of the Shh signaling and thatcurcumin and cyclopamine have synergistic effect ininducing apoptosis in medulloblastoma cells.

Interestingly, in the curcumin-resistant MED-1cells, wherein curcumin increased slightly the levelof the Shh protein, the levels of Cyclin D1 and Bcl-2were not downregulated as in the curcumin-sensitiveMED-5 cells (Figure 2) but rather increased followingtreatment with curcumin (40mM) (Figure 4D). Thisshows that the pro-apoptotic effect of cucumin inmedulloblastoma cells could be mediated throughthe downregulation of Shh and the anti-apoptosisprotein Bcl-2. Similarly, the anti-apoptosis proteinsurvivin was also highly upregulated followingtreatment of MED-1 cells with curcumin (Figure4D), which provides further explanation to the highresistance of these cells to curcumin.

Curcumin Potentiates the Apoptotic Effects ofCisplatin and g-Rays

Ionizing radiation (IR) and cisplatin are the majortherapeutic agents for medulloblastoma [1]. There-fore, we sought to test the ability of curcumin, as

308 ELAMIN ET AL.


inhibitor of the Shh pathway, to potentiate the effectof the DNA damaging agents g-rays and cisplatinin triggering apoptosis in medulloblastoma cells.Therefore, MED-5 cells were either mock treated andused as control or challenged with curcumin(20mM), g-rays (5 Gy), cisplatin (6 mM), and thecombination of curcumin with cisplatin or withg-rays, and then the proportion of induced apoptosiswas assessed by the Annexin V/flow cytometrytechnique (Figure 5A and B). Importantly, whilethe proportion of apoptotic cells was only marginalin response to each of the single agents, thecombination of curcumin with cisplatin or withIR triggered apoptosis in more than 70% of cells,showing a great synergistic effect between curcuminand both cisplatin and IR (Figure 5A and B). Thisclearly shows that curcumin can potentiate the effectof both g-rays and cisplatin in inducing apoptosis inmedulloblastoma cells. Similar results were obtainedwith the DAOY cell line (data not shown). Toelucidate the molecular basis of this potentiationwe investigated the effect of the single agents and thecombinations on the levels of Bax and Bcl-2 in MED-

5 cells using the immunoblotting technique.Figure 5C shows that while the effect of curcuminand cisplatin on the level of Bcl-2 was only marginal,g-rays downregulated Bcl-2 level 5-fold, 48 h pos-tirradiation. Interestingly, the combination of cur-cumin with cisplatin led to a time-dependentdownregulation of Bcl-2 reaching a level 10-foldlower after 72 h of treatment. Likewise, curcuminenhanced the g-ray effect on Bcl-2 leading to a level20-fold lower only 24 h postirradiation (Figure 5C).On the other hand, the level of Bax did notsignificantly change following all the treatments(data not shown). These results show that curcuminpotentiates the action of cisplatin and g-rays intriggering cell death through apoptosis by enhanc-ing the downregulation of the anti-apoptosis Bcl-2protein.

Piperine Potentiates the Effect of Curcumin inTriggering Apoptosis in Medulloblastoma Cells

It has been previously shown that piperineincreases the curcumin bioavailability by 2000%[36]. To test whether this natural product can have

Figure 4. Cyclopamine sensitizes curcumin-resistant medulloblas-toma cells. (A and D) Curcumin (40 mM) treated MED-1 cells wereincubated for the indicated periods of time and proteins wereextracted and used for immunoblot analysis using the indicatedantibodies. The numbers under the bands represent the correspond-ing expression levels as compared to the basal level (time 0). (B) MED-

1 cells were either mock treated or challenged with curcumin orcyclopamine or the combination of both. Cells were then reincu-bated for 72 h and cell death was assessed by Annexin V/PI flowcytometry. The numbers in the charts represent the proportions ofnecrotic and apoptotic cells. (C) Histogram showing the proportionof apoptotic cells.



enhancer effect on curcumin-dependent apoptosisinduction, both products were used separately or incombination against MED-1, MED-4, MED-5, andDAOY cells, and apoptosis was assessed as describedabove. We have found that piperine triggers apop-tosis in medulloblastoma cells in a dose-dependentmanner. In fact 100 and 200 mM of piperine increasedthe proportion of apoptotic cells from 10% to 31%and 57%, respectively (data not shown). Further-more, piperine enhanced the killing effect of curcu-min on all cells tested (Figure 6A and B). The effectcould be considered as additive for MED-4 andDAOY. However, it is rather synergistic for MED-1and MED-5 cells. Importantly, the combination ofboth agents triggered apoptosis in more than 70% ofthe highly resistant MED-1 cell culture (Figure 6B).This suggests that the combination is very effectiveagainst resistant medulloblastoma cells.

To elucidate the molecular basis of the potentia-tion of the curcumin effect by piperine, we inves-tigated the effect of the combination on the level ofthe Bax and Bcl-2 proteins in the curcumin-resistant

MED-1 cells. Figure 6C shows that while the effect ofthe single agents is insignificant on the expressionlevels of Bax and Bcl-2, the combination of curcuminand piperine led to 4-folds increase in the level of Baxand 100-fold decrease in the level of Bcl-2, whichresulted in 400-fold increase in the ratio Bax/Bcl-2(Figure 6D). This shows that piperine enhances theapoptotic effect of curcumin by increasing its effectin downregulating the anti-apoptosis protein Bcl-2.

DISCUSSION

In the present report, we present clear evidencethat curcumin could constitute a potent anti-medulloblastoma agent for the following reasons:

(1) Curcumin has an outstanding safety profile.Indeed, different phase I clinical trials haveshown that curcumin is safe when consumed atdoses as high as 12 g per day for 3 months[25,37].

(2) Curcumin crosses the brain blood barrier andreaches the brain. Indeed, it has been shown that

Figure 5. Curcumin enhances the cytotoxic effect of cisplatin andg-rays through strong Bcl-2 decrease. MED-5 cells were either mocktreated or challenged with curcumin (20 mM) or cisplatin (6 mM) or g-rays (5 Gy) or the combination of curcumin with either cisplatin or g-rays. Cells were then reincubated for different periods of time asindicated. Cell death was assessed by Annexin V/PI flow cytometry

and the level of Bcl-2 was evaluated by immunoblotting. (A) Chartswith the numbers representing the proportions of necrotic andapoptotic cells. (B) Histogram showing the proportion of apoptoticcells. The error bars represent standard deviations. (C) Immunoblots,the numbers under the bands represent the correspondingexpression levels as compared to basal level (time 0).

310 ELAMIN ET AL.


curcumin can reach different regions of the brainincluding the cerebellum in rats [38] andmice [39–41]. In fact, accumulating data invarious experimental models have shown thatdietary curcumin has neuroprotective effectsand therefore is a strong candidate for use inthe prevention or treatment of major disablingage-related neurodegenerative diseases, likeAlzheimer’s, Parkinson’s, and stroke. Thesepromising results have already led to ongoingpilot clinical trials [42].

(3) We have shown here that curcumin inhibitsmedulloblastoma cell proliferation by enablingthe arrest of the cell-cycle at G2/M phase.

(4) Curcumin is known to influence several bio-chemical and molecular pathways that playimportant roles in the development and pro-gression of various types of cancer [37,43]. In thepresent study we present the first evidence thatcurcumin inhibits the Shh signaling. Indeed,curcumin down regulated the Shh protein andalso its main targets in the pathway Gli1 and

PTCH1 (Figure 2). The Shh pathway playsessential roles in the cerebellar developmentand neoplastic transformation [4,5]. Further-more, activation of the Shh signaling promotesmedulloblastoma from both neuronal progeni-tors and stem cells [44,45]. Moreover, blockade ofthe Shh pathway led to medulloblastoma growthinhibition [33]. Thereby, the curcumin-depend-ent inhibition of Shh signaling could be of greattherapeutic value against medulloblastomas.Besides, we have shown that curcumin down-regulates the expression of many importantcancer proteins implicated in different signalingpathways that have been found deregulatedin various cancers, including medullo-blastoma. Indeed, curcumin inhibited two otherimportant medulloblastoma-dependent carci-nogenesis pathways Akt/NF-kB and b-catenin(Figure 2C). In fact it has been recently shownthat the AKT signaling pathway is activated inmedulloblastomas, which exhibited significantexpression of phosphorylated Akt [46]. In the

Figure 6. Piperine potentiates the pro-apoptotic effect of curcu-min through strong downregulation of Bcl-2 in medulloblastomacells. Cells were either mock treated or challenged with curcumin(20 mM) or piperine (100 mM) or the combination of curcumin withpiperine. (A) Cells were then reincubated for 72 h and cell death wasassessed by Annexin V/PI flow cytometry. Charts, the numbersrepresent the proportions of necrotic and apoptotic cells. (B)

Histogram showing the proportion of apoptotic cells. The error barsrepresent standard deviations. (C) MED-1 cells were reincubated forthe indicated periods of time and then cell lysates were prepared andused for immunobloting analysis using the indicated antibodies. Thenumbers under the bands represent the induction/reduction levels ofthe Bax and Bcl-2 proteins. (D) Graphs showing the Bax/Bcl2 ratios.



present study we have shown that curcumindownregulates the phosphorylated/active formof Akt, which is able to increase the incidence ofShh-induced medulloblastoma [17]. Similarly,the level of the oncogenic transcription factorb-catenin was also downregulated by curcuminin medulloblastoma cells. Several lines ofevidence indicate functional interactionbetween the two pathways Shh and Wnt/b-catenin [47]. It has been recently shown thatthe Wnt/b-catenin signaling is required for Hhpathway-driven tumorigenesis [32]. Therefore, itis very important to block Wnt signaling, givenits activation in medulloblastomas [21].

Interestingly, the activation of these three path-ways Akt/NF-kB, Shh, and Wnt/b-catenin convergein the upregulation of C-myc, N-myc, and Cyclin D1,three oncoproteins that play key roles in thedevelopment of medulloblastomas [1,7,10,29]. Highlevels of these three oncoproteins were consideredto be bad prognosis because they are related tounfavorable therapeutic outcome [19]. N-myc proto-oncogene, a member of the myc family of transcrip-tional activators [48], is required for cerebellargranule neuron precursor proliferation [8,9], andtherefore it is an important player in the carcino-genesis of medulloblastoma. Our data show thatcurcumin has strong inhibitory effect on theseproteins in medulloblastoma cells, which furthersupports the inhibition of the three importantmedulloblastoma-driven pathways and the efficientanti-medulloblastoma effect of curcumin. The factthat these pathways have anti-apoptosis effects,suggests that the pro-apoptotic action of curcuminagainst medulloblastoma cells is mediated throughthe inhibition of these pathways and the down-stream anti-apoptosis protein Bcl-2.

(5) We have also shown here that in mostcases, curcumin triggered cell death in highproportions of medulloblastoma cells mainlythrough the apoptotic pathway. This seems totake place by downregulating different anti-apoptosis proteins, including Bcl-2 and survivin.Survivin is a potent anti-apoptosis protein that isdifferentially expressed in cancer and thereforeconstitutes an important anti-cancer target [49].Moreover, high expression of survivin playsimportant role in resistance to chemo- andradiotherapy and has been shown to be relatedto unfavorable outcome for medulloblastomas[50]. Importantly, our data have shown that 24 hof curcumin treatment can reduce survivin to30% of the basal level in medulloblastoma cells.Similar effect has been shown on different othercancer cell lines [25]. Interestingly, when thelevels of Bcl-2 and survivin were assessed incurcumin-resistant medulloblastoma cells MED-

1 and MED-9 an increase rather than decreasewas observed. Concomitantly, no decrease in thelevel of the Shh protein and its downstreamtarget Cyclin D1 was observed, suggesting thatcurcumin-dependent induction of apoptosis ismediated through Shh/Bcl-2 downregulation.Indeed, the natural Shh antagonist cyclopamine,sensitized the MED-1 cells to curcumin(Figure 4).

These results also showed that these two plant-derived Shh-antagonist products have synergisticeffect against medulloblastoma, and this could be ofgreat value for the treatment of these aggressivetumors. Indeed, both agents target pathways that arecrucial for medulloblastoma survival. Furthermore,cyclopamine has been considered for the treatmentof medulloblastoma patients [51,52].

(6) Curcumin sensitized medulloblastoma cells to g-rays and cisplatin, two widely used agents for thetreatment of these neoplasms [1,20]. Indeed, thecombination of curcumin with nontoxic doses ofeach agent led to 80% cell death in differentmedulloblastoma cells. This effect has beenmediated through a strong downregulation ofthe anti-apoptosis protein Bcl-2 (Figure 5C). Ithas been recently shown that curcuminenhanced the anti-tumor effects of gemcitabineand radiation in the PC3 human prostatecancer cell line through downregulating theMDM2 oncogene [53] and pancreatic cancercells in vitro and in vivo [54]. In anotherstudy, curcumin potentiated taxol-inducedapoptosis by downregulating NF-kB and Akt[55]. Together, these results show that curcumincan be used to potentiate the activity andreduce the nondesirable side effects of somechemotherapeutic agents and IR.

(7) Curcumin-dependent induction of apoptosiswas enhanced by piperine, an enhancer ofcurcumin bioavailability. The fact that curcumincan induce the expression of different importanttumor suppressor proteins and inhibit theexpression of various key oncoproteins indicatesthat this agent could be considered as great anti-medulloblastoma product. However, curcuminis limited in its clinical utility owing to its lowbioavailability. Indeed, several reports haveshown that curcumin is rapidly degraded. Majorreasons contributing to the low plasma andtissue levels of curcumin appear to be due topoor absorption, rapid metabolism, and rapidsystemic elimination [56]. Interestingly, it hasbeen shown that piperine, another naturalpolyphenolic nontoxic agent that inhibits hep-atic and intestinal glucuronidation, can signifi-cantly enhance the curcumin absorption leveland bioavailability in both rats and humans by

312 ELAMIN ET AL.


154% and 2000%, respectively [36]. Importantly,we have shown here that piperine is cytotoxicand enhances also the killing effect of curcuminagainst medulloblastoma cells. Strikingly, piper-ine sensitized the cell cultures that were resistantto the killing effect of curcumin. We have alsoshown that the synergistic effect of curcuminand piperine was mediated through down regu-lating the most important anti-apoptosis pro-tein, Bcl-2. Indeed, the combination of bothagents decreased by 100-fold the level of thisprotein (Figure 6). This finding is of greatimportance, since it has been recently shownthat Bcl-2 is an important mediator of the Shhactivity in medulloblastoma [15]. The fact thatcurcumin downregulates both Shh and Bcl-2suggests that this agent in combination withpiperine could constitute a great anti-medullo-blastoma agent.

Together, these findings provide clear evidencethat curcumin inhibits the Shh–Gli1 signaling andtriggers cell growth inhibition and the inductionof cell death through the internal apoptoticpathway in medulloblastoma cells. In addition, itenhances the killing effect of cisplatin and g-raysand targets pathways crucial for tumor survival.Furthermore, piperine enhances curcumin anti-cancer effect showing that the combination of thesetwo natural and safe products could be of great valueif included in the medulloblastoma therapeuticregimens.

ACKNOWLEDGMENTS

We are thankful to Dr. K. Al-Hussein and P.S.Manogaran for their help with the flow cytometry.This work was performed under the RAC proposal #2050016.

REFERENCES

1. Jozwiak J, Grajkowska W, Wlodarski P. Pathogenesis ofmedulloblastoma and current treatment outlook. Med ResRev 2007;6:869–890.

2. Hanahan D, Weinberg RA. The hallmarks of cancer. Cell2000;100:57–70.

3. Gilbertson RJ. Medulloblastoma: Signalling a change intreatment. Lancet Oncol 2004;5:209–218.

4. Wechsler-Reya RJ, Scott MP. Control of neuronal precursorproliferation in the cerebellum by Sonic Hedgehog. Neuron1999;22:103–114.

5. Ho KS, Scott MP. Sonic hedgehog in the nervous system:Functions, modifications and mechanisms. Curr Opin Neuro-biol 2002;12:57–63.

6. Hooper JE, Scott MP. Communicating with Hedgehogs. NatRev Mol Cell Biol 2005;6:306–317.

7. Kenney AM, Widlund HR, Rowitch DH. Hedgehog and PI-3kinase signaling converge on Nmyc1 to promote cell cycleprogression in cerebellar neuronal precursors. Development2004;131:217–228.

8. Kenney AM, Cole MD, Rowitch DH. Nmyc upregulationby sonic hedgehog signaling promotes proliferation in

developing cerebellar granule neuron precursors. Develop-ment 2003;130:15–28.

9. Knoepfler PS, Cheng PF, Eisenman RN. N-myc is essentialduring neurogenesis for the rapid expansion of progenitorcell populations and the inhibition of neuronal differ-entiation. Genes Dev 2002;16:2699–2712.

10. Hatton BA, Knoepfler PS, Kenney AM, et al. N-myc is anessential downstream effector of Shh signaling during bothnormal and neoplastic cerebellar growth. Cancer Res2006;66:8655–8661.

11. Aldosari N, Bigner SH, Burger PC, et al. MYCC and MYCNoncogene amplification in medulloblastoma. A fluorescencein situ hybridization study on paraffin sections from theChildren’s Oncology Group. Arch Pathol Lab Med 2002;126:540–544.

12. Vita M, Henriksson M. The Myc oncoprotein as a therapeutictarget for human cancer. Semin Cancer Biol 2006;16:318–330.

13. Scheurlen WG, Schwabe GC, Joos S, Mollenhauer J,Sorensen N, Kuhl J. Molecular analysis of childhood primitiveneuroectodermal tumors defines markers associated withpoor outcome. J Clin Oncol 1998;16:2478–2485.

14. Grotzer MA, Hogarty MD, Janss AJ, et al. MYC messengerRNA expression predicts survival outcome in childhoodprimitive neuroectodermal tumor/medulloblastoma. ClinCancer Res 2001;7:2425–2433.

15. Bar EE, Chaudhry A, Farah MH, Eberhart CG. Hedgehogsignaling promotes medulloblastoma survival via BclII. Am JPathol 2007;170:347–355.

16. McCall TD, Pedone CA, Fults DW. Apoptosis suppression bysomatic cell transfer of Bcl-2 promotes Sonic hedgehog-dependent medulloblastoma formation in mice. Cancer Res2007;67:5179–5185.

17. Rao G, Pedone CA, Del Valle L, Reiss K, Holland EC, Fults DW.Sonic hedgehog and insulin-like growth factor signalingsynergize to induce medulloblastoma formation from nestin-expressing neural progenitors in mice. Oncogene 2004;23:6156–6162.

18. Gajjar A, Chintagumpala M, Ashley D, et al. Risk-adaptedcraniospinal radiotherapy followed by high-dose chemo-therapy and stem-cell rescue in children with newlydiagnosed medulloblastoma (St Jude Medulloblastoma-96): Long-term results from a prospective, multicentre trial.Lancet Oncol 2006;7:813–820.

19. Brandes AA, Paris MK. Review of the prognostic factors inmedulloblastoma of children and adults. Crit Rev OncolHematol 2004;50:121–128.

20. Rood BR, Macdonald TJ, Packer RJ. Current treatment ofmedulloblastoma: Recent advances and future challenges.Semin Oncol 2004;31:666–675.

21. Rossi A, Caracciolo V, Russo G, Reiss K, Giordano A.Medulloblastoma: From molecular pathology to therapy.Clin Cancer Res 2008;14:971–976.

22. Grill J, Sainte-Rose C, Jouvet A, et al. Treatment ofmedulloblastoma with postoperative chemotherapy alone:An SFOP prospective trial in young children. Lancet Oncol2005;6:573–580.

23. Garg AK, Buchholz TA, Aggarwal BB. Chemosensitizationand radiosensitization of tumors by plant polyphenols.Antioxid Redox Signal 2005;7:1630–1647.

24. Surh YJ. Cancer chemoprevention with dietary phytochem-icals. Nat Rev Cancer 2003;3:768–780.

25. Goel A, Kunnumakkara AB, Aggarwal BB. Curcumin as‘‘Curecumin’’: From kitchen to clinic. Biochem Pharmacol2007;19:19.

26. Aggarwal BB, Kumar A, Bharti AC. Anticancer potential ofcurcumin: Preclinical and clinical studies. Anticancer Res2003;23:363–398.

27. Syng-Ai C, Kumari AL, Khar A. Effect of curcumin on normaland tumor cells: Role of glutathione and bcl-2. Mol CancerTher 2004;3:1101–1108.



28. Bhattacharyya S, Mandal D, Saha B, Sen GS, Das T, Sa G.Curcumin prevents tumor-induced T cell apoptosis throughStat-5a-mediated Bcl-2 induction. J Biol Chem 2007;282:15954–15964.

29. Raffel C. Medulloblastoma: Molecular genetics and animalmodels. Neoplasia 2004;6:310–322.

30. Oliver TG, Grasfeder LL, Carroll AL, et al. Transcriptionalprofiling of the Sonic hedgehog response: A critical role forN-myc in proliferation of neuronal precursors. Proc Natl AcadSci USA 2003;100:7331–7336.

31. Bigelow RL, Chari NS, Unden AB, et al. Transcriptionalregulation of bcl-2 mediated by the sonic hedgehog signal-ing pathway through gli-1. J Biol Chem 2004;279:1197–1205.

32. Hoseong Yang, S, Andl, T, Grachtchouk, V, et al. Patho-logical responses to oncogenic Hedgehog signaling in skinare dependent on canonical Wnt/beta-catenin signaling. NatGenet 2008;40:1130–1135.

33. Berman DM, Karhadkar SS, Hallahan AR, et al. Medullo-blastoma growth inhibition by hedgehog pathway blockade.Science 2002;297:1559–1561.

34. Romer JT, Kimura H, Magdaleno S, et al. Suppression of theShh pathway using a small molecule inhibitor eliminatesmedulloblastoma in Ptc1(þ/�)p53(�/�) mice. Cancer Cell2004;6:229–240.

35. Chen JK, Taipale J, Cooper MK, Beachy PA. Inhibition ofHedgehog signaling by direct binding of cyclopamine toSmoothened. Genes Dev 2002;16:2743–2748.

36. Shoba G, Joy D, Joseph T, Majeed M, Rajendran R, SrinivasPS. Influence of piperine on the pharmacokinetics ofcurcumin in animals and human volunteers. Planta Med1998;64:353–356.

37. Strimpakos AS, Sharma RA. Curcumin: Preventive andtherapeutic properties in laboratory studies and clinical trials.Antioxid Redox Signal 2008;10:511–545.

38. Bala K, Tripathy BC, Sharma D. Neuroprotective and anti-ageing effects of curcumin in aged rat brain regions.Biogerontology 2006;7:81–89.

39. Yang F, Lim GP, Begum AN, et al. Curcumin inhibitsformation of amyloid beta oligomers and fibrils, bindsplaques, and reduces amyloid in vivo. J Biol Chem 2005;280:5892–5901.

40. Ryu EK, Choe YS, Lee KH, Choi Y, Kim BT. Curcumin anddehydrozingerone derivatives: Synthesis, radiolabeling, andevaluation for beta-amyloid plaque imaging. J Med Chem2006;49:6111–6119.

41. Pan MH, Huang TM, Lin JK. Biotransformation of curcuminthrough reduction and glucuronidation in mice. Drug MetabDispos 1999;27:486–494.

42. Cole GM, Teter B, Frautschy SA. Neuroprotective effects ofcurcumin. Adv Exp Med Biol 2007;595:197–212.

43. Thangapazham RL, Sharma A, Maheshwari RK. Multiplemolecular targets in cancer chemoprevention by curcumin.AAPS J 2006;8:E443–E449.

44. Schuller U, Heine VM, Mao J, et al. Acquisition of granuleneuron precursor identity is a critical determinant ofprogenitor cell competence to form Shh-induced medullo-blastoma. Cancer Cell 2008;14:123–134.

45. Yang ZJ, Ellis T, Markant SL, et al. Medulloblastoma can beinitiated by deletion of Patched in lineage-restricted progen-itors or stem cells. Cancer Cell 2008;14:135–145.

46. Hartmann W, Digon-Sontgerath B, Koch A, et al. Phospha-tidylinositol 3’-kinase/AKT signaling is activated in medullo-blastoma cell proliferation and is associated with reducedexpression of PTEN. Clin Cancer Res 2006;12:3019–3027.

47. Taipale J, Beachy PA. The Hedgehog and Wnt signallingpathways in cancer. Nature 2001;411:349–354.

48. Henriksson M, Luscher B. Proteins of the Myc network:Essential regulators of cell growth and differentiation. AdvCancer Res 1996;68:109–182.

49. Altieri DC, Survivin, cancer networks and pathway-directeddrug discovery. Nat Rev Cancer 2008;8:61–70.

50. Haberler C, Slavc I, Czech T, et al. Histopathologicalprognostic factors in medulloblastoma: High expression ofsurvivin is related to unfavourable outcome. Eur J Cancer2006;42:2996–3003.

51. Romer J, CurranT. Targetingmedulloblastoma:Small-moleculeinhibitors of the Sonic Hedgehog pathway as potential cancertherapeutics. Cancer Res 2005;65:4975–4978.

52. Bar EE, Stearns D. New developments in medulloblastomatreatment: The potential of a cyclopamine-lovastatin combi-nation. Expert Opin Investig Drugs 2008;17:185–195.

53. Li M, Zhang Z, Hill DL, Wang H, Zhang R. Curcumin, a dietarycomponent, has anticancer, chemosensitization, and radio-sensitization effects by down-regulating the MDM2 onco-gene through the PI3K/mTOR/ETS2 pathway. Cancer Res2007;67:1988–1996.

54. Kunnumakkara AB, Guha S, Krishnan S, Diagaradjane P,Gelovani J, Aggarwal BB. Curcumin potentiates antitumoractivity of gemcitabine in an orthotopic model of pancreaticcancer through suppression of proliferation, angiogenesis,and inhibition of nuclear factor-kappaB-regulated geneproducts. Cancer Res 2007;67:3853–3861.

55. Bava SV, Puliappadamba VT, Deepti A, Nair A, KarunagaranD, Anto RJ. Sensitization of taxol-induced apoptosis bycurcumin involves down-regulation of nuclear factor-kap-paB and the serine/threonine kinase Akt and is independentof tubulin polymerization. J Biol Chem 2005;280:6301–6308.

56. Anand P, Kunnumakkara AB, Newman RA, Aggarwal BB.Bioavailability of curcumin: Problems and promises. MolPharm 2007;4:807–818.

314 ELAMIN ET AL.


curcumin inhibits the sonic hedgehog signaling pathway and...

Documents