cyclin-dependent kinase tpk2 is a critical cell cycle regulator in toxoplasma gondii

© 2002 Blackwell Science Ltd

Cyclin-dependent kinase TPK2 is a critical cell cycleregulator in Toxoplasma gondii

significant hazard to the fetus if a mother acquires theinfection during pregnancy, and it causes life-threateningdisease in immunocompromised individuals, includingindividuals with AIDS. After initial infection with T. gondii,actively replicating tachyzoites differentiate to slowgrowing bradyzoites that are thought to persist for the lifeof the host.

Most of the clinical cases of toxoplasmosis are due tothe reactivation of latent bradyzoites into tachyzoite forms(Luft and Remington, 1992). The mechanisms that controlinterconversion between tachyzoite and bradyzoite arenot fully understood but differentiation to bradyzoitesappears to be a stress response (Weiss and Kim, 2000).The loss of tachyzoite replication competency has beencorrelated with bradyzoite differentiation (Kaufman et al.,1985; Jerome et al., 1998). Studies in other modelsystems, such as Saccharomyces cerevisiae, indicatethat regulation of stress-induced differentiation is coupledwith cell cycle regulation (Edgington et al., 1999; Rua etal., 2001).

Within the cell cycle, there are checkpoints where thecell monitors whether appropriate events such as DNAreplication or mitosis have occurred. Feedback mecha-nisms can slow or arrest the cell cycle if the correct eventshave not occurred. In addition, commitment to differen-tiation is usually cell cycle-dependent. The proper regula-tion of cell cycle checkpoints is critically important for the survival of an organism. It appears that all eukaryoticcells including protozoa use similar mechanisms to regulate progression through these transitions (Hunt,1991; Norbury and Nurse, 1992; Reed, 1992; Nigg, 1995;Reed 1997; Hassan et al., 2001). The G1-S and G2-Mtransitions are usually the most important cell cyclecheckpoints.

Cyclin-dependent protein kinases (cdks), members ofthe family of serine/threonine kinases, control the majortransitions of the eukaryotic cell cycle. As key regulators,activity of cdks is tightly regulated in response to bothintra- and extracellular signals (Moreno et al., 1991;Morgan, 1995). Although cellular cdk levels usuallyremain constant within the cell cycle, activity of thesekinases is regulated by association with cyclins, cdkinhibitors, and by phosphorylation and dephosphorylationevents (Hunt, 1991; Pines, 1995). Cyclins are positiveregulatory subunits of cdks whose levels oscillate duringcell cycle progression (Solomon, 1993; Ekholm and Reed,2000).

Molecular Microbiology (2002) 45(2), 321–332

Farzana Khan, Jianzhong Tang, Chang-le Qin andKami Kim*Departments of Medicine (Division of InfectiousDiseases) and of Microbiology and Immunology, AlbertEinstein College of Medicine, Bronx, NY 10461, USA.

Summary

The Apicomplexan parasite Toxoplasma gondii repli-cates by endodyogeny, an unusual form of binaryfission. We tested the role of TPK2, a homologue ofthe CDC2 cyclin-dependent kinases, in cell cycle regulation. TPK2 tagged with HA epitope (TPK2-HA-wt) was expressed in mammalian cells as con-firmed by Western blot analysis using HA tag andPSTAIRE antibodies. TPK2-HA-wt phosphorylated apeptide from Histone H1, proving that TPK2 is a func-tional kinase. TPK2-HA-wt coimmunoprecipitatedwith mammalian cyclins A, B1, D3 and E. Despitebeing a functional kinase, TPK2 did not rescueSchizosaccharomyces pombe cdc2 and Saccha-romyces cerevisiae cdc28 mutant strains. Overex-pression of a dominant-negative mutant of TPK2(TPK2-HA-dn) in T. gondii tachyzoites arrested repli-cation. FACS analysis of tachyzoites expressingTPK2-HA-dn revealed an increase in the fraction ofcells in S-phase when compared with TPK2-HA-wttransfected parasites. Expression of TPK2-HA-wt didnot arrest tachyzoite replication. No discernable G2cell cycle block was evident suggesting that cell cyclecheckpoints differ in T. gondii from most othereukaryotic cells. These data suggest that TPK2 exe-cutes an essential function in T. gondii cell cycle andis likely to be the T. gondii CDC2 orthologue.

Introduction

Cell cycle regulation is tied with developmental regulationin many systems. The protozoan parasite Toxoplasmagondii is an obligate intracellular parasite with three devel-opmental stages in its life cycle: tachyzoite, bradyzoiteand sporozoite. The parasite replicates by endodyogeny,an unusual form of binary fission in which daughter cellsare assembled within mother cells. The parasite is a

Accepted 11 April, 2002. *For correspondence. E-mail [email protected]; Tel. (+1) 718 430 2611; Fax (+1) 718 430 8968.

We report the cloning and molecular characterization ofCDC2-related protein kinase TPK2 in Toxoplasma gondii.We show that TPK2 protein has kinase activity and asso-ciates with different mammalian cyclins. A dominant-negative mutant of TPK2 arrests T. gondii replication, suggesting that TPK2 is an essential regulator of the T.gondii cell cycle.

Results

Isolation of TPK2 from T. gondii

TPK2, a CDC2-related protein kinase, was cloned from T. gondii by reverse transcription (RT)-PCR using twodegenerate oligonucleotide primers as described previ-ously (Qin et al., 1998). The deduced protein sequenceof TPK2 (AF042172) reveals conservation of key func-tional domains of the CDC2 kinase family, including con-servation of amino acid sequence EKIGEGTYG in theATP binding domain, conservation of the highly conservedPSTAIRE region implicated in cyclin binding, and conser-vation of the catalytic KLADFGLAR region involved in thephosphotransfer reaction (Fig. 1). Substitutions in theGDSEIDQ region, which interacts with the cdk-activatingkinase (CAK), are present (GTGNEDQ in T. gondii; Fig.1). The nucleotide sequence of TPK2 is 99% identical to

T. gondii CRK2, a CDC2-related kinase reported byWastling and Kinnaird (Wastling and Kinnaird, 1998) withidentical amino acid sequence. TPK2 and CRK2nucleotide differences are probably due to minor strainpolymorphism. The polypeptide sequence shows 75%homology to both Plasmodium knowlesi (Vinkenoog et al., 1995) and Plasmodium falciparum cdks (Ross-Macdonald et al., 1994), and 63% identity to human cell division cycle, CDC2 protein (Elledge and Spottswood,1991). The deduced amino acid sequence shows 55%identity with both S. pombe p34CDC2 (Lee and Nurse, 1987)and S. cerevisiae p34CDC28 (Lorincz and Reed, 1984).

Expression of TPK2 in bacteria and mammalian cells

Western blot analysis of T. gondii lysate with PSTAIREantibody revealed multiple immunoreactive bands includ-ing in the 34–35 kDa region, the expected size of TPK2(arrowhead, left panel Fig. 2A). This immunoreactive bandwas not seen in human foreskin fibroblasts (HFF) (Fig. 2A) or COS-7 lysates (Fig. 2B) with the presumed

© 2002 Blackwell Science Ltd, Molecular Microbiology, 45, 321–332

322 F. Khan et al.

Fig. 1. TPK2 amino acid sequence and expression constructs.A. Deduced amino acid sequence of TPK2. Emboldened residuesrepresent the ATP binding domain EKIGEGTYG, the PSTAIREcyclin binding region, and the conserved catalytic KLADFGLARregion (bold and italicised; the sequence of dead kinase mutantused to make dominant-negative is indicated below). The residuesGTGNEDQ (underlined) encompass the region corresponding tothe GDSEIDQ cdk-activating kinase domain.B. Constructs used for transfection. TPK2-HA-wt and TPK2-HA-dnwere cloned in mammalian (pcDNA3), Schizosaccharomycespombe (pREP41) and Toxoplasma gondii (GRA1 or SAG1)expression vectors.

Fig. 2. PSTAIRE antibody recognizes TPK2 from T. gondii.A. Left: Western blot of lysate from human foreskin fibroblast (HFF)host cells, purified intracellular replicating RH strain tachyzoites(RH int) and lysed out extracellular RH strain tachyzoites (RH ext)using PSTAIRE antibody. The arrowhead indicates a band at theexpected relative molecular mass of TPK2. The circle indicates theposition of the endogenous mammalian cdk/CDC2 (faint band inHFF lane). The migration of markers is indicated in kDa. Middle:Coomassie-stained gel loaded with purified GST-TPK2 and GST-TPK3, a GSK-3/shaggy kinase family member (Qin et al., 1998).The arrowhead indicates the major GST-TPK2 band. Right:Western blot of a gel loaded with GST fusion proteins GST-TPK2and GST-TPK3. PSTAIRE antibody recognizes GST-TPK2, but notGST-TPK3. The arrowhead indicates the major GST-TPK2 band.B. Subconfluent COS-7 cells were transfected with pcDNA3 vectoralone (lane 1) pcDNA3/TPK2-HA-wt (lane 2) or pcDNA3/TPK2-HA-dn (lane 3) and harvested 48 h after transfection. Western blotswere performed with HA (left) and PSTAIRE (right) antibodies. Thelower band in the PSTAIRE Western is endogenous mammaliancdk/CDC2.

Toxoplasma cell cycle regulation 323

endogenous cdk/CDC2 migrating slightly faster onSDS–PAGE. (The circle in next to the HFF lane of Fig. 2Amarks the faint band corresponding to endogenouscdk/CDC2.) Levels of cdk are low in HFF because theyare quiescent, but cdk/CDC2 was readily apparent whenmore cell lysate was used or lysates were prepared fromactively growing cells (data not shown). (Wastling and Kinnaird, 1998) also noted multiple reactive bands in T.gondii lysate with PSTAIRE antibody, and this appears tobe common in the protozoa (Mottram and Smith, 1995).

TPK2 was expressed in Escherichia coli as a GSTfusion protein. Like GST-TPK3, which has kinase activity(Qin et al., 1998), GST-TPK2 was a soluble protein thatwas easily purified. GST-TPK2 was recognized byPSTAIRE peptide antibody (Fig. 2A) but did not havekinase activity (data not shown). The PSTAIRE cyclinbinding box is characteristic of CDC2 family members.Although lack of kinase activity could have been due toimproper folding of TPK2, cdks typically require binding tocyclins for kinase activity. We therefore expressed TPK2in mammalian cells reasoning that folding was more likelyto be correct and that mammalian cyclins might partnerTPK2.

Kinase activity of TPK2 expressed in COS-7 cells

TPK2 was tagged with HA epitope at the C-terminus

(TPK2-HA-wt) and cloned into mammalian expressionvector pcDNA3 (see Fig. 1). In parallel, a ‘dead kinase’mutant was generated with the substitution of anasparagine residue (N) for the aspartic acid (D) at posi-tion 143 (TPK2-HA-dn; see Fig. 1). The amino acidsequence KLAD*FGLAR (* indicates point mutation) isfound to be conserved in all protein kinases and a DDN mutation abolishes kinase activity. Overexpressionof a ‘dead kinase’ cdk leads to a dominant-negative phenotype and cell cycle arrest (Van den Heuvel andHarlow, 1993).

The expression of TPK2-HA-wt and TPK2-HA-dn inCOS-7 cells was confirmed by Western blot analysisusing HA tag monoclonal and PSTAIRE polyclonal anti-bodies. A single band of about 35–36 kDa observed onimmunoblot with HA tag antibody (Fig. 2B), whereas twobands corresponding to TPK2-HA and endogenouscdk/CDC2 (approximately 33 kDa) appeared when im-munoblots were incubated with PSTAIRE antibody (Fig. 2B). TPK2-HA-wt and TPK2-HA-dn were equally wellexpressed in COS-7 cells. Interestingly, TPK2-transfectedCOS-7 cells had lower levels of endogenous cdk/CDC2,perhaps due to downregulation of endogenous cdk/CDC2expression.

At 48 h after transient transfection, TPK2-HA-wt andTPK2-HA-dn protein were immunoprecipitated with HAantibody from COS-7 cells (Fig. 3A). Western blots with


Fig. 3. TPK2-HA-wt immunoprecipitates havekinase activity.A. Subconfluent COS-7 cells were transfectedwith pcDNA vector alone, TPK2-HA-wt, orTPK2-HA-dn and harvested 48 h aftertransfection. Lysates were immunoprecipitated(IP) with HA or PSTAIRE antibodies.Immunoprecipitates were resolved bySDS–PAGE and Western blots wereperformed with HA or PSTAIRE antibody. The positions of TPK2-HA and mammaliancdk/CDC2 are indicated. HC and LC indicate the heavy and light chains of the immunoglobulin used for theimmunoprecipitation that are recognized bythe secondary antibody used for Western blotanalysis.B. TPK2-HA-wt and TPK2-HA-dn HA antibodyimmunoprecipitates shown in (A) were used for kinase assay as described inExperimental procedures. Control reactionsincluded immunoprecipitation of TPK2-HA-wtcell lysates without peptide substrate (1),mock immunoprecipitations without cell lysate(2), and immunoprecipitation of COS-7 cellstransfected with pcDNA vector alone (3).TPK2-HA-wt (4, 5), TPK2-HA-dn (6), andcontrol samples were immunoprecipitated in duplicate and tested for kinase activity.Olomoucine (100 mM) was added to kinasereactions in sample 5. Total cpm withstandard deviation are shown for arepresentative experiment.

HA and PSTAIRE antibodies were performed to verify that TPK2-HA-wt and TPK2-HA-dn were present in theimmunoprecipitates and that endogenous CDC2/cdk wasnot present in the complex of HA-antibody immunopre-cipitated proteins (Fig. 3A). Control immunoprecipitationswith PSTAIRE antibody followed by Western confirmedthat both endogenous cdk/CDC2 and TPK2 were presentin the COS-7 lysate.

The HA immunocomplex from TPK2-HA-wt transfectedcells showed in vitro phosphorylation activity using a 10-amino-acid peptide from histone H1 as substrate (Fig. 3B). This kinase activity was inhibited by the cyclin-dependent kinase inhibitor olomoucine. As expected, theHA immunocomplex from TPK2-HA-dn transfected cellsdid not show any kinase activity. The results confirmedthat TPK2 is a catalytically active kinase and that theD143N mutation abolishes kinase activity.

TPK2 binds mammalian cyclins A, B1, D3 and E

To determine whether TPK2 binds to mammalian cyclins,lysates of COS-7 cells transfected with TPK2-HA-wt andTPK2-HA-dn were immunoprecipitated with antibodiesspecific for cyclins A, B1, D3 and E. The immunocomplexwas immunoblotted with PSTAIRE antibody or HA anti-body (Fig. 4). The TPK2-HA-wt and endogenous cdk/CDC2 coimmunoprecipitated with cyclins A, B1, D3 andE. Similar results were obtained in cells transfected with TPK2-HA-dn, indicating that the DDN point mutation

in the catalytic region does not affect TPK2 binding withcyclins.

TPK2 does not complement S. cerevisiae and S. pombetemperature-sensitive yeast mutants

To investigate whether TPK2 could complement S.pombe cdc2 temperature-sensitive mutants (SP36 andSP 599), wild-type TPK2 (untagged or tagged with HAepitope at the C-terminus) was cloned into pREP41 Spombe expression vector (Maundrell, 1989; Forsburg,1993). T. gondii TPK2 expressed under the control of thiamine inducible promoter nmt1 was unable to rescuethe yeast temperature-sensitive mutants at the restrictivetemperature (36∞C). The temperature-sensitive strainstransfected with TPK2 and TPK2-HA grew well at per-missive temperature (26°C) with and without thiamineindicating that the expression of TPK2 protein is not toxic.TPK2 was detectable by Western blot in S. pombeextracts, suggesting that the failure to complement yeastCDC2 mutants was not due to poor protein expression.TPK2 also did not complement S. cerevisiae in similarexperiments with S. cerevisiae cdc28 mutant strainsL5193 (cdc28–4) and L5191 (cdc28–1N).

TPK2-HA-dn arrests T. gondii replication

Overexpression of TPK2-HA-wt and TPK2-HA-dn wastested in T. gondii. TPK2-HA-wt and TPK2-HA-dn wereefficiently expressed in tachyzoites of RH and ME49-PLK strains as observed by immunofluorescent assayusing HA antibody in transiently transfected T. gondii(Fig. 5A). TPK2-HA-wt and TPK2-HA-dn were distributedthroughout the parasite. TPK2-HA-wt immunopre-cipitated with HA antibody from transfected tachyzoiteshad kinase activity (data not shown). Owing to powerfulinhibitory effects upon tachyzoite replication (see below),similar amounts of TPK2-HA-dn could be not im-munoprecipitated for comparison of kinase activity toTPK2-HA-wt.

The effect of TPK2-HA-wt and TPK2-HA-dn on parasitemultiplication was studied on transiently transfected RHtachyzoites. The total number of parasites per vacuolewas counted at 48 h (Fig. 5B). Transfection of tachyzoiteswith TPK2-HA-dn driven by GRA1 and SAG1 promotersarrested T. gondii replication. Using the strong constitu-tive GRA1 promoter (Kim et al., 2001), 75% of vacuolesthat were TPK2-HA-dn positive had only one parasite and25% two parasites. TPK2-HA-dn expression driven by the weaker SAG1 promoter also inhibited replication.Although a greater proportion of parasites replicatedonce, no vacuole was found to have more than two par-asites, indicating that the TPK2-HA-dn executed a strongeffect on T. gondii replication. The normal doubling time


324 F. Khan et al.

Fig. 4. TPK2-HA interacts with mammalian cyclins A, B1, D3 andE. COS-7 cells were lysed 48 h after transfection with pcDNA(lanes 1–4), TPK2-HA-wt (lanes 5–8) or TPK2-HA-dn (lanes 9–12).Cyclins were immunoprecipitated from lysates with antibodiesspecific for the following mammalian cyclins: cyclin A (mitotic cyclin;lanes 1, 5, 9), cyclin B1 (mitotic cyclin; lanes 2, 6, 10), cyclin D3(G1 cyclin; lanes 3, 7, 11) and cyclin E (G1 cyclin; lanes 4, 8, 12)antibodies. Immunoprecipitates were separated by SDS–PAGE and transferred to nitrocellulose membrane. Western blot wasperformed with HA mouse monoclonal or rabbit PSTAIRE antibody.


of RH strain parasites is approximately 5 h and for ME49/PLK 9 h (Radke and White, 1998; Radke et al., 2001).

Overexpression of TPK2-HA-wt driven by GRA1 andSAG1 promoters slowed replication when compared withcontrol mock transfected vacuoles (Fig. 5B), but parasitescontinued to replicate and went on to lyse host cells.

Parasites transfected with TPK2-HA-wt and TPK2-HA-dn were also stained for apical antigen C4F3

(Morrissette et al., 1994) to identify the presence of inter-nal daughter parasites. C4F3 stains the apical complexand has been used to identify nascent daughter cells individing tachyzoites (Radke et al., 2001). Formation of the apical complexes is a marker for the beginning ofcytokinesis.

There was no accumulation of internal daughters in parasites expressing TPK2-HA-dn or TPK2-HA-wt whencompared with control parasites. Approximately 24 h aftertransfection, the percentage of vacuoles with internaldaughter parasites was 12.5 ± 0.5% in untransfected con-trols, 10.8 ± 1.7% in parasites transfected with GRA1-TPK2-HA-wt, and 5.8 ± 1.8% for parasites transfectedwith GRA1-TPK2-HA-dn. The difference between theTPK2-HA-dn transfectants and controls was not statisti-cally significant, and similar to the 11% reported for RHstrain (Radke et al., 2001). Similarly, no visible differencewas found in frequency of nuclear division in parasitesexpressing TPK2-HA-wt and TPK2-HA-dn versus control with DAPI staining (data not shown). The numberof tachyzoites with daughter cells is typically slightly more than those with dividing or two nuclei, suggestingthat daughter cell formation immediately precedesnuclear division and marks an initial phase of cytokinesis(Radke et al., 2001). These data suggested that par-asites expressing TPK2-HA-dn were arresting at a pointin the cell cycle before nuclear division or daughter cellformation.

Overexpression of TPK2-HA alters the T. gondii cellcycle profile

To confirm these findings, the total DNA content of para-sites was measured by FACS analysis after staining withpropidium iodide. Cells in G1 have a haploid DNA content,G2/M a diploid DNA content, and those in S-phase haveintermediate DNA content. The transiently transfectedparasites expressing TPK2-HA-wt and TPK2-HA-dnunder GRA1 or SAG1 promoter control were incubatedwith anti HA antibodies and FITC secondary antibodies.The DNA content of FITC-positive cells and FITC-negative cells were analysed by using the Mod Fitprogram (Fig. 6 and Table 1). Overexpression of TPK2-HA-wt driven by the GRA1 promoter slowed cell division(Fig. 5B) and also resulted in statistically significant dif-ferences in cell cycle distribution from control cells withfewer cells in G1 and more in S-phase (Table 1). MostGRA1-TPK2-HA-dn transfected cells did not replicate(Fig. 5B). Tachyzoites expressing TPK2-HA-dn had afurther increase in the fraction of cells in S-phase and a concomitant reduction of tachyzoites in G1-phaseexpressing TPK2-HA-dn. The increase in number of S-phase cells was statistically significant compared withcells expressing TPK2-HA-wt.


Fig. 5. TPK2-HA-dn expression inhibits T. gondii replication.A. Expression of TPK2-HA-wt and TPK2-HA-dn in T. gondii RH andPLK strains. RH and PLK strain tachyzoites were transfected withTPK2-HA-wt or TPK2-HA-dn driven by the GRA1 promoter andallowed to invade HFF cells. At 48 h after transfection, monolayerswere fixed and labelled with HA monoclonal followed by FITC-conjugated secondary antibody. Fluorescent images were overlaidwith phase images.B. RH strain tachyzoites were transiently transfected with TPK2-HA-wt and TPK2-HA-dn driven by GRA1 and SAG1 promoters andused to inoculate HFF. At 48 h after transfection the cultures werefixed and labelled using HA monoclonal and FITC-conjugatedsecondary antibodies. The number of parasites in FITC-positivevacuoles was counted. Control indicates data from FITC-negativevacuoles from a mock transfection. Graphs show mean percentageof vacuoles with the indicated number of parasites ± standarddeviation from four independent transfection experiments.

Expression of TPK2-HA driven by the weaker SAG1promoter had similar but less pronounced effects uponcell cycle. Most SAG1-TPK2-HA-dn transfectants repli-cated once before arresting, but cell cycle profile as determined by FACS was similar to GRA1-TPK2-HA-dntransfected cells (Fig. 6B). Parasites expressing SAG1-driven TPK2-HA-wt replicated more slowly than FITC-negative cells from the same culture flask or tachyzoitesfrom mock-transfected control cultures (Fig. 5B) butshowed a similar DNA profile (Fig. 6B). The percentageof cells with G2/M DNA (diploid) content was similar in allsamples analysed suggesting that a G2 block did notoccur.

Despite complete inhibition of cell replication, TPK2-HA-dn did not arrest cells at a single point in the cell cycle.Instead replication arrested at more than one point in the

cell cycle, with greater than expected numbers of cellsarrested in S-phase.

Discussion

Studies in different experimental systems have indicatedthat cyclin-dependent kinases activated during eukaryoticcell cycle progression (Nigg, 1995; Pines, 1995; Hassanet al., 2001). In the present study, we report the cloningand characterization of the role of CDC2-related proteinkinase TPK2 from T. gondii and provide evidence thatTPK2 is essential for T. gondii cell cycle progression.TPK2 protein is a functionally active enzyme in vitro andmutation D143N abolished TPK2 activity as has beenseen with other kinases.

Co-immunoprecipitation of wild-type and mutant TPK2-


326 F. Khan et al.

Fig. 6. TPK2-HA-dn alters the cell cycleprofile of transfected cells. RH straintachyzoites were transfected with TPK2-HA-wtor TPK2-HA-dn driven by GRA1 or SAG1promoters. Approximately 48 h aftertransfection, tachyzoites were fixed with 3%PFA and incubated with HA primary and FITCsecondary antibodies. DNA was stained withpropidium iodide. The total DNA content ofparasites was assayed by flow cytometry inHA-FITC-positive and HA-FITC-negative cells.Cell cycle profile (percent G1, S, G2/M) wasdetermined using MOD FIT software for FITC-labelled tachyzoites and FITC-negativetachyzoites within each transfected culture.The control transfection was mock-transfectedwithout DNA.A. Flow cytometry tracings for arepresentative experiment for GRA1-TPK2-HA-wt- and GRA1-TPK2-HA-dn-transfected T. gondii. Tracings are shown from FITC-negative (HA-negative) and FITC-positivecells from each transfected cultureapproximately 48 h after transient transfection.The y-axis represents number of cells and thex-axis represents relative PI fluorescentintensity. Cell cycle profile (G1; S; G2/M)derived using MOD FIT software is shown.Values for tracings (%G1;%S;%G2/M) shownare: TPK2-HA-wt (FITC-negative: 61%, 21%,18%; FITC-positive 41%, 35%, 23%); TPK2-HA-dn (FITC-negative: 53%, 28%, 19%;FITC-positive: 37%, 48%, 15%).B. Graph of cell cycle profiles for cellstransfected with GRA1 and SAG1 TPK2-HAconstructs and controls. Percentage of cells inG1 (light blue); S (red); and G2/M (blue) aredisplayed for FITC-negative and -positive cellstransfected with each construct. This is anexperiment independent of A.


HA kinase with various mammalian cyclins is consistentwith TPK2 being functionally active after binding with acyclin partner. TPK2-HA-dn was coimmunoprecipitatedwith mammalian cyclins and would be expected to inter-act with binding partners or substrates in T. gondii.

Overexpression of catalytically inactive kinases fre-quently creates a dominant-negative effect. This isthought to occur when inactive kinase titrates essentialcofactors present in limiting amounts. cdks have special-ized functions in mammalian cells and transfection withdominant-negative mutant cdks typically leads to cellcycle arrest at a single point in the cell cycle (Van denHeuvel and Harlow, 1993). In both S. pombe and S.cerevesiae, a single cdk governs both G1 and G2 pro-gression with activity determined by cell cycle specificcyclins (G1 or mitotic cyclins).

We examined the phenotypic consequences of theinactivation of TPK2 in T. gondii replication. The dominant-negative mutant TPK2-HA-dn inhibited T. gondiireplication. FACS analysis of TPK2-HA-dn-expressingcells showed the accumulation of cells in S-phase butsynchronized block was not seen. Several independenttransfection experiments using both RH and PLK strainssupported the conclusion that the inhibition of T. gondiireplication imposed by dominant-negative mutant resultsfrom defective TPK2 function. TPK2-HA-dn driven by thestrong GRA1 promoter prevented cell division completelyin most cells, whereas parasites transfected with theweaker SAG1-TPK2-HA-dn underwent one divisionbefore arresting. These data suggest that as sufficientlevels of TPK2-HA-dn accumulate, cells arrest in the cellcycle and that there may be several points within the cell cycle that TPK2-HA-dn exerts dominant-negativeeffects.

During the last decade, several cyclin-dependentkinases have been cloned in protozoan parasites.Although genetic studies have clearly shown that some of

these kinases are essential (Mottram et al., 1996; Hassanet al., 2001), relatively little is known about their specificrole in the control of cell cycle. Protozoa appear to haveonly a single CDC2 homologue, and we have not identi-fied any other candidates beyond TPK2. Therefore, byanalogy to yeast, one would expect that TPK2 governsboth G1 and G2 transitions partnered with different cellcycle-specific cyclins. In this case, TPK2-HA-dn would beexpected to bind to endogenous cyclins preventing cellcycle progression at more than one point in the cell cycle.Thus, the alteration of the cell cycle distribution elicited byTPK2-HA-dn without accumulation of cells at a singlepoint in the cell cycle is the expected result if TPK2governs more than one cell cycle transition.

Recent studies in fungi have implicated cdks andcyclins in regulation of stress induced differentiation (Edgington et al., 1999; Loeb et al., 1999; Rua et al.,2001). Further studies in T. gondii are needed to estab-lish the role of cell cycle regulation in stage transitionbetween tachyzoite and bradyzoite, as well as from sporozoite to tachyzoite. Cyclins have been identified ina number of protozoa, including T. gondii (Kvaal et al.,2002) and P. falciparum (Le Roch et al., 2000), but char-acterization of the full repertoire of cyclins in T. gondii hasnot yet been described.

Studies by Radke and colleagues (Radke et al., 2001)have suggested that T. gondii tachyzoites do not have amajor G2 phase and that the cell cycle consists of G1, Sfollowed immediately by mitosis. These investigators havehypothesized that the classic G2 cell cycle checkpointpresent in yeast and mammalian cells may not be present(Radke et al., 2001). Because asynchronous T. gondiitachyzoite populations have an unusual bimodal S-phasepopulation with a major S-phase population with neardiploid DNA content, they instead have hypothesized thatT. gondii may have a distinct premitotic checkpoint asso-ciated with endodyogeny. Our data with TPK2-HA-dn are


Table 1. Effects of TPK2-HA overexpression on cell cycle profile.

Construct Percentage G1 Percentage S Percentage G2/M

Control (No DNA) 65.3 ± 2.3 18.7 ± 3.2 16.3 ± 2.7GRA1-TPK2-HA-wt FITC-negative 60.0 ± 2.6a 23.7 ± 2.6b 16.3 ± 0.9c

GRA1-TPK2-HA-wt FITC-positive 47.0 ± 3.5a,d 34.0 ± 2.1b,e 18.7 ± 2.2c,f

GRA1-TPK2-HA-dn FITC-negative 60.0 ± 3.6 24.3 ± 2.0 15.3 ± 2.3GRA1-TPK2-HA-dn FITC-positive 39.7 ± 1.5d 44.7 ± 2.4e 16.0 ± 2.1f

After staining cells with propidium iodide and HA antibody (FITC-positive), flow cytometry was used to analyse fluorescence of RH tachyzoites48 h after transient transfection with the indicated constructs. Cell cycle profile was determined using MOD FIT software. Untransfected cells withineach culture (FITC-negative) were compared with transfected cells (FITC-positive) and mock-transfected control tachyzoites. The mean per-centage of cells in G1 (n DNA content), S (intermediate DNA content) and G2/M (2n DNA content) is presented with the standard error of themean. Results are means from three independent transfection experiments.a. p = 0.04.b. p = 0.04.c. p = 0.37.d. p = 0.12.e. p = 0.03.f. p = 0.43.

consistent with this hypothesis. We did not see any evi-dence of accumulation of cells with G2 DNA content, nordid we see any evidence of arrest during mitosis usingDAPI nuclear staining or C4F3 staining of apical com-plexes. Formation of apical complexes begins in late S-phases and is a marker for formation of nascent daughtercells. This signifies the beginning of cytokinesis duringendodyogeny and is followed shortly thereafter by nucleardivision. We saw accumulation of tachyzoites with DNAcontent consistent with the S-phase, suggesting that thereis indeed a major premitotic cell cycle checkpoint withouta major G2 phase (Radke et al., 2001).

TPK2-HA-wt overexpression slowed but did not arrestreplication, and when driven by the strong GRA1 pro-moter, TPK2-HA-wt overexpression perturbed cell cycleprofile. This effect was more pronounced in experimentswhere the transfection efficiency was very high. Theslowing of replication seen with TPK2-HA-wt suggeststhat, as in other systems, there is a balance of factors nec-essary for cell cycle progression. Interestingly, as for thedominant-negative mutant, perturbation of the cell cycleby TPK2-HA-wt was associated with accumulation of cellsin S-phase rather than G1 as is more typical when repli-cation slows. This further supports the idea that S-phaseis a prominent cell cycle checkpoint in T. gondii (Radkeet al., 2001).

Our results with TPK2-HA-dn differ from what wasobserved when T. gondii tachyzoites were treated withaphidicolin, an agent that prevents DNA replication andusually arrests cells at the G1/S interface (Shaw et al.,2001). With aphidicolin, apical daughter formation pro-ceeds although DNA replication and nuclear division areblocked. Because of this, the aphidicolin block is irre-versible. Collectively, the data strongly suggest that con-ventional cell cycle checkpoints observed in yeast andmammalian cells are either not present or regulated bydifferent mechanisms in T. gondii.

TPK2 could not complement temperature-sensitivestrains of S. pombe or S. cerevisiae. As TPK2 is a func-tional kinase, it is possible that T. gondii kinase is not ableto interact with the complete complement of yeast regu-latory proteins necessary to restore cell cycle progres-sion. Most CDC2-related genes from other protozoa arealso unable to rescue yeast temperature-sensitive strains(Gomez et al., 1998). The only exception is the Leish-mania major CRK3 gene that did not rescue using con-ventional plasmid-based strategies but did rescue a S.pombe cdc2 mutant under controlled expression of inte-grated constructs (Wang et al., 1998).

cdks interact with cyclins, phosphatases, and activatingkinases. Although the catalytic domains and cyclin bindingdomains are well conserved in TPK2, there is divergencefrom the yeast CDC2 GDSEID motif in TPK2. The

GDSEID motif is very important in cdk complex activationby phosphorylation at T167 in fission yeast (T158 in T.gondii, T161 in human) (Fleig et al., 1992; Gomez et al.,1998; Wastling and Kinnaird, 1998). This phosphoryla-tion is an essential step in cell cycle regulation. TheGDSEID motif has been characterized by mutation in S.pombe, and strains carrying mutation in the conservedresidue E215 (within GDSEID) lack T167 phosphoryla-tion, can still bind cyclin but have no CDC2 kinase activity (Fleig et al., 1992). T. gondii and the other Apicomplexa have major variations in the GDSEIDQ motif(GTGNEDQ in T. gondii), suggesting a divergence in the control of cdk activation by phosphorylation. cdk-activating kinase activity and interactions are not as conserved among species and in a given species may be highly specific.

TPK2 appears to function similarly to other CDC2-related cdk family members. Cyclins that interact withTPK2 have been identified from T. gondii by yeast two-hybrid screening (Kvaal et al., 2002), consistent with thehypothesis that TPK2 partnered with different cyclinsgoverns specific transitions within the cell cycle. Cell cycleregulation, perhaps due to the different requirements ofendodyogeny versus conventional cytokinesis, appears tobe governed by regulation of somewhat different cell cyclecheckpoints, including a major cell cycle checkpoint thatis present in late S-phase. Further studies are required toidentify the cyclins and other regulatory proteins that areinvolved in the unique regulation of T. gondii endodyogenyas well as stage differentiation.

Experimental procedures

Parasite strains and cell culture

Toxoplasma gondii strains RH and ME49-PLK (sometimesalso called PTG) were used in this study. Parasites weremaintained by serial passage in confluent monolayers ofhuman foreskin fibroblasts (HFF) in Dulbecco’s modifiedEagle’s medium (DMEM) supplemented with 10% (v/v) foetalbovine serum (FBS) (Collaborative Research or Gemini Bio-products), 2 mM glutamine and 20 mM penicillin and strepto-mycin. COS-7 cells were maintained in Ham’s F12 nutrientmixture (Cellgro) supplemented with 10% FBS, 2 mM gluta-mine and 20 mM penicillin and streptomycin incubated at37∞C under a 5% CO2 atmosphere.

Cloning and sequencing of T. gondii TPK2 gene

Genomic DNA and whole cellular RNA were isolated fromfreshly lysed out tachyzoites of T. gondii RH strain asdescribed previously (Qin et al., 1998). Two degenerateoligonucleotide primers were synthesized for polymerasechain reaction (PCR) amplification of Toxoplasma gondiiprotein kinase cDNA. The forward primer 5¢-GG(GACT)


328 F. Khan et al.


GA(AG)GG(GACT)AC(GATC)TA(TC)GG-3¢ was designedfrom ATP binding site in subdomain I GEGTYG, where-as reverse primer 5¢-TG(GATC)GG(CT)TT(GATC)A(AG)(AG)TC(GATC)C(GT)(AG)TG-3¢ from amino acid sequenceHRDLKPQ in subdomain VI. The PCR conditions and strat-egy are defined elsewhere (Qin et al., 1998). The TPK2 PCRprobe was used to screen an RH strain cDNA library (a giftof J. Ajioka, Cambridge University; Wan et al., 1996). Twopositive clones were identified and one encompassing the fullcoding region of TPK2 was sequenced on both strands.Although several kinases with homology to cdks were iden-tified (Qin et al., 1998; TPK1-6; TPK2 AF042172), no otherkinases with sequences diagnostic for the CDC2 family werecloned.

Plasmid constructs

For creation of GST-TPK2, oligonucleotide primers, KK12(CGGAATTCTACTTACCACCTTCCGGAA; GST-F) andKK13 [CGGAATTCTCCAATCAACATTCGCCA (GST-R)] withsynthetic EcoRI sites were used to PCR-amplify TPK2 fromthe cDNA clone. After digestion with EcoRI, the PCR prod-ucts were ligated into bacterial expression vector pGEX-kg,to yield pGEX-kg-TPK2. GST-TPK2 recombinant protein wasexpressed and purified as described previously (Qin et al.,1998).

KK12 and KK46 (GTAACTCGAGTCGCCCCTGAAAGTCGCAA with a synthetic XhoI site) were used to PCR-amplifyTPK2 and to fuse it in frame with an HA tag in mammalianexpression vector pcDNA3-CFLU cut with EcoRI and XhoI(original vector Invitrogen, HA version gift of Joel Ernst,UCSF) to yield pcDNA3-CFLU-TPK2.

KK233 (TGCATGCATGGAGAAGTATCAGA with syntheticNsiI site) and KK250 (GGAATTAATTAAGCGTAATCTGGAACATCGTATGGGTAA with a synthetic PacI site) were used to PCR amplify TPK2-HA from pcDNA3-CFLU-TPK2. Theamplified fragment digested with NsiI and PacI, was clonedin T. gondii expression vectors pGRA1-GFP5S65T-GRA2(Kim et al., 2001) and pSAG1-GFP5S65T-GRA2 replacingGFP with TPK2-HA. All inserts were verified by DNAsequencing.

Production of dominant-negative mutant TPK2-HA-dn

The dominant-negative mutation in TPK2 (Van den Heuveland Harlow, 1993) was produced using the Quick ChangeTM

Site-Directed Mutagenesis Kit (Stratagene) according to the protocol recommended by the manufacturer. The con-served sequence KLAD*FGLAR (wild type) was mutated to KLAN*FGLAR (dominant-negative mutant) using for-ward 5¢-CTGAAACTTGCAAATTTTGGACTCGCACGC-3¢ andreverse 5¢-GCGTGCGAGTCCAAAATTTGCAAGTTTCAG-3¢primers.

Transfection

Toxoplasma gondii. Procedures used for routine transfectionhave been described elsewhere (Kim et al., 1993; Soldati and Boothroyd, 1993). Tachyzoites of RH and PLK strains

were transiently transfected with 100 mg of GRA1-TPK2-HA-wt, SAG1-TPK2-HA-wt and GRA1-TPK2-HA-dn, SAG1-TPK2-HA-dn, their corresponding dominant-negative mutantconstructs. The transfected parasites were inoculated either in four-chamber slides (Nalge Nunc) or T25 flasks for24–48 h.

COS-7 cells. All transfections were performed in T75flasks. pcDNA3 containing TPK2-HA-wt and TPK2-HA-dn (15 mg of DNA/transfection) and 30 ml of Lipofectamine 2000Reagent (Life Technologies) were diluted in 720 ml of SFMhybridoma (Gibco) in separate tubes. Both solutions weremixed and incubated for 20 min, followed by addition of 1.5 ml of SFM hybridoma and further incubation for 10 min atroom temperature. The DNA mixture was overlaid on washedsubconfluent monolayer of COS-7 cells. After 4 h of incuba-tion at 37∞C, 3 ml of Ham’s F12 with 20% FBS was added to the flasks without removing the transfection mixture and incubated for 24–48 h until protein was isolated. COS-7 cells,transfected with Lipofectamine 2000 without DNA or withpcDNA3 vector without insert, were used as controls.

Antibodies

HA (F-7), CDC2 (PSTAIRE), cyclin A (BF683), cyclin B1(GNS1), cyclin D3 (D-7) and cyclin E (HE1) antibodies werefrom Santa Cruz Biotechnology. Mouse monoclonal C4F3(Morrissette et al., 1994) was provided by David Roos (Uni-versity of Pennsylvania) and HA polyclonal rabbit antibody byDavid Russell (Cornell University).

Protein extraction and Western blots

Total protein extract from COS-7 cells and parasites was prepared by resuspending cell pellets in cold lysis buffer (150 mM NaCl, 1% Triton X-100 and 50 mM Tris-HCl, pH7.5–8.0) with proteinase inhibitors cocktail (Sigma), followedby an incubation on ice for 20 min and centrifugation for 10 min at 13 000 r.p.m in a microfuge at 4∞C. Supernatant wascollected and protein concentration was measured using theBio-Rad dye binding reagent with bovine serum albumin(BSA) as a standard. In parallel, 100 mg of each extract was resuspended with 5¥ Laemmli’s buffer, separated by12% SDS-polyacrylamide gel electrophoresis (PAGE) and transferred to nitrocellulose membranes using Trans-Blot SD(Bio-Rad). Nitrocellulose membranes were blocked in 5%non-fat powdered milk in phosphate-buffered saline (PBS)containing 0.05% Tween 20 (PBST) and incubated for 1 hwith primary antibodies (HA or PSTAIRE) at 1:500 dilution in1% BSA in PBST. Blots were washed three times for 5 mineach with PBST, incubated for 1 h at room temperature withcorresponding secondary antibodies linked to horseradishperoxidase (Amersham), and visualized by Super Signalchemiluminescent substrate (PIERCE).

Immunoprecipitation and kinase assay

All steps in immunoprecipitations were carried out at 4∞C. Supernatant were passed through Centricon YM-50


(Millipore), precleared with protein G for 1 h, and incubatedwith HA antibody for 1–2 h or with antibodies raised againstdifferent mammalian cyclins (cyc A, cyc B1, cyc D3 and cycE). Immunocomplexes were collected with protein Gsepharose and washed four times with lysis buffer.

Kinase assay was carried out using a kit from Promega(Sigma TECTR CDC2 Protein Kinase Assay system).Immunoprecipitates were incubated with [g-32P]-ATP(Amersham Pharmacia Biotech; 3000 Ci mmol-1) and a 10-amino-acid CDC2 kinase substrate (PKTPKKAKKL) fromHistone H1 using the protocol provided by the manufacturer.32P labelling of the peptide was measured in a scintillationcounter. In some cases, kinase reactions were performedwith 100 mM olomoucine (Sigma).

Flow cytometry

Transiently transfected parasites within host cells werescraped from flasks. Cells were passed sequentially through18-, 23-, 25- and 27-gauge needles to disrupt any intact hostcells and filtered through a 3 mm Nucleopore filter to removehost cell debris (including host cell nuclei), collected by centrifugation at 400 g for 15 min, and fixed in 3% para-formaldehyde at room temperature for 1–2 h. Fixed parasiteswere pelleted, washed with PBS containing 0.2% Triton X-100(PBSTx), and permeabilized for 1 h at room temperature inPBSTx. Parasites were incubated 1 h with monoclonal HA(F-7) mouse monoclonal antibody (1:200), followed by two washes with PBS and treated 1 h with fluorescein-conjugated anti-mouse IgG (1:50) (FITC from PIERCE). Par-asites were washed two times with PBSTx and finally resus-pended in 0.5 ml of PBS containing RNAse 40 mg ml-1

(Sigma), incubated for 10 min, and stained with propidiumiodide 50 mg ml-1 (PI, Sigma) for 1 h in dark at 37∞C.

Nuclear DNA content was determined based on PI fluo-rescence on a FACScan (Becton-Dickinson) in both FITC-negative and -positive cells. Cell aggregates, apoptotic, andpolyploid cells were gated out of the analysis using Mod Fit software. Each profile was compiled from approximately100 000 total gated events including FITC-negative and -positive parasites.

Immunofluorescence assay (IFA)

Human foreskin fibroblasts (HFF) cells grown in four-chamber slides (Nalge Nunc) were inoculated with 5, 10, 15 and 20 ml of transiently transfected tachyzoites with GRA1-TPK2-HA, SAG1-TPK2-HA and their correspondingdominant-negative mutants. After 48 h of transfection, slideswere washed and fixed in 3% paraformaldehyde for 1 h andpermeabilized for 30 min in 0.25% Triton X-100 in PBS(PBSTx) at room temperature. The slides were incubatedwith HA monoclonal antibody (1:200) or HA polyclonal (1:500)or apical monoclonal antibodies C4F3 (1:500; Morrissette etal., 1994) for 1 h at 37∞C in a humid chamber, washed threetimes in PBSTx and treated for 1 h with secondary fluores-cence FITC- (1:50) or Cy3 (1:200)-conjugated anti-mouse oranti-rabbit IgG (PIERCE). Slides were washed three timesand mounted using Vectashield mounting medium for fluo-rescence H-1000 (Vector Laboratory). Slides were evaluated

using an Olympus inverted microscope model 1 ¥ 70 andimages collected using CCD (cooled couple device) camera.

Yeast complementation assays

For S. cerevesiae expression, the TPK2 insert from pGEX-kg was digested with EcoRI and ligated into pDAD.Yeast strains L5193 (cdc28–4), L5140 (wild type), L5191(cdc28–1N) were transformed with pDAD, pDAD-TPK2,pDAD-TPK2r (TPK2 in the wrong orientation), and pDAD-CDC28 using standard LiOAcetate/PEG yeast transformationprotocols. Gene expression was induced by plating yeastclones onto Galactose+ plates at restrictive temperature(37∞C). Yeast strains and vectors were gifts of J. Celenza,Boston University.

KK266 (GGAATTCCATATGGAGAAGTATCA with a syn-thetic NdeI site) and KK267 (CGTTAGGATCCTTCGCCCCTGA with a synthetic BamHI site) were used to PCR-amplifyTPK2 from pcDNA3-CFLU-TPK2. The PCR product wasdigested with NdeI and BamHI and ligated with NdeI- andBamHI-digested Schizosaccharomyces pombe pREP41X-LacZ expression vector, which contains a thiamine repres-sible nmt1 promoter (Maundrell, 1990; Forsburg, 1993). Theconstructs pREP41-LacZ, pREP41-LacZ-TPK2 were intro-duced into S. pombe strains carrying cdc2 temperature-sensitive alleles (obtained from Dr T. Matsumura, Albert Einstein College of Medicine) SP36 (cdc2–33ts, Leu 1–32,h-s) and SP599 (cdc2-M55ts, Leu 1–32,h+n) by LiOAcetateprotocol (Moreno et al., 1991). For induction, cells wereprecultured in EMM medium containing 5 mg ml-1 thiamine torepress the nmt1 promoter, then washed and either grown in thiamine-free liquid media or streaked on thiamine-free plates to derepress the promoter, at 25∞C or 36∞C. Cells were observed under microscope using a Zeiss Axioskopmicroscope.

Acknowledgements

This work was supported by grants from the NIH (AI41058,AI01535) and a Burroughs Wellcome Fund New InvestigatorAward in Molecular Parasitology. We thank members of theKim laboratory for helpful comments throughout the courseof this work.

References

Edgington, N.P., Blacketer, M.J., Bierwagen, T.A., and Myers,A.M. (1999) Control of Saccharomyces cerevisiae fila-mentous growth by cyclin-dependent kinase cdc28. MolCell Biol 2: 1369–1380.

Ekholm, S.V., and Reed, S.I. (2000) Regulation of G1 cyclin-dependent kinases in the mammalian cell cycle. Curr OpinCell Biol 12: 676–684.

Elledge, S.J., and Spottswood, M.R. (1991) A new humanp34 protein kinase, CDK2, identified by complementationof a cdc28 mutation in Saccharomyces cerevisiae, is ahomolog of Xenopus Eg1. EMBO J 10: 2653–2659.

Fleig, U.N., Gould, K.L., and Nurse, P. (1992) A dominant-negative allele of p34cdc2 shows altered phosphoamino acid


330 F. Khan et al.


content and sequesters p56cdc13 cyclin. Mol Cell Biol 12:2295–2301.

Forsburg, S.L. (1993) Comparison of Schizosaccharomycespombe expression systems. Nucleic Acids Res 21: 2955–2956.

Gomez, E.B., Kornblihtt, A.R., and Tellez-Inon, M.T. (1998)Cloning of a cdc2-related protein kinase from Try-panosoma cruzi that interacts with mammalian cyclins. MolBiochem Parasitol 91: 337–351.

Hassan, P., Ferguson, D., Grant, K.M., and Mottram, J.C.(2001) The CRK3 protein kinase is essential for cell cycleprogression of Leishmania mexicana. Mol Biochem Para-sitol 113: 189–198.

Hunt, T. (1991) Cyclins and their partners: from a simple ideato complicated reality. Semin Cell Biol 2: 213–222.

Jerome, M.E., Radke, J.R., Bohne, W., Roos, D.S., andWhite, M.W. (1998) Toxoplasma gondii bradyzoites spon-taneously form during sporozoite-initiated development.Infect Immun 66: 4838–4844.

Kaufman, H.E., Remington, J.S., and Jacob, L. (1985) Toxo-plasmosis: The nature of virulence. Am J Opthalmol 46:255–261.

Kim, K., Soldati, D., and Boothroyd, J.C. (1993) Genereplacement in Toxoplasma gondii with chloramphenicolacetyltransferase as selectable marker. Science 262: 911–914.

Kim, K., Eaton, M.S., Schubert, W., Wu, S., and Tang, J.(2001) Optimized expression of green fluorescent protein(GFP) in Toxoplasma gondii using thermostable GFPmutants. Mol Biochem Parasitol 113: 309–313.

Kvaal, C.A., Radke, J.R., Guerini, M.N., and White, M.W.(2002) Isolation of a Toxoplasma gondii cyclin by the yeasttwo-hybrid interactive screen. Mol Biochem Parasitol inpress.

Lee, M.G., and Nurse, P. (1987) Complementation used toclone a human homologue of fission yeast cell cycle controlgene cdc2. Nature 327: 31–35.

Le Roch, K., Sestier, C., Dorin, D., Waters, N., Kappes, B.,Chakrabarti, D., Meijer, L., and Doerig, C. (2000) Activa-tion of a Plasmodium falciparum cdc2-related kinase byheterologous p25 and cyclin H. Functional characterizationof a P. falciparum cyclin homologue. J Biol Chem 275:8952–8958.

Loeb, J.D., Sepulveda-Becerra, M., Hazan, I., and Liu, H.(1999) A G1 cyclin is necessary for maintenance of fila-mentous growth in Candida albicans. Mol Cell Biol 19:4019–4027.

Lorincz, A.T., and Reed, S.T. (1984) Primary structure homol-ogy between the product of yeast cell division control gene CDC28 and vertebrate oncogenes. Nature 307: 183–185.

Luft, B.J., and Remington, J.S. (1992) Toxoplasmicencephalitis in AIDS. Clin Infec Dis 15: 211–222.

Maundrell, K. (1989) nmt1 of fission yeast: a highly tran-scribed gene completely repressed by thiamine. J BiolChem 265: 10854–10864.

Moreno, S., Klar, A., and Nurse, P. (1991) Molecular geneticanalysis of fission yeast Schizosaccharomyces pombe.Methods Enzymol 194: 795–823.

Morgan, D.O. (1995) Principles of CDKs regulations. Nature374: 131–134.

Morrissette, N.S., Bedian, V., Webster, P., and Roos, D.S.(1994) Characterization of extreme apical antigens fromToxoplasma gondii. Exp Parasitol 79: 445–459.

Mottram, J.C., and Smith, G. (1995) A family of trypanosomecdc2-related protein kinases. Gene 162: 147–152.

Mottram, J.C., McCready, B.P., Brown, K.G., and Grant, K.M.(1996) Gene disruptions indicate an essential function for the LmmCRK1 cdc2-related kinase of Leishmania mexicana. Mol Microbiol 22: 573–583.

Nigg, E.A. (1995) Cyclin-dependent protein kinases: key regulators of the eukaryotic cell cycle. Bioassays 17: 471–480.

Norbury, C., and Nurse, P. (1992) Animal cell cycle and theircontrol. Ann Rev Biochem 61: 441–470.

Pines, J. (1995) Cyclins and cyclin-dependent kinases: a biochemical view. Biochem J 308: 697–711.

Qin, C.L., Tang. J., and Kim, K. (1998) Cloning and in vitroexpression of TPK3, a Toxoplasma gondii homologue of shaggy/glycogen synthase kinase–3 kinases. MolBiochem Parasitol 93: 273–283.

Radke, J.R., and White, M.W. (1998) A cell cycle model forthe tachyzoite of Toxoplasma gondii using the Herpessimplex virus thymidine kinase. Mol Biochem Parasitol94: 237–247.

Radke, J.R., Striepen, B., Guerini, M.N., Jerome, M.E., Roos,D.S., and White, M.W. (2001) Defining the cell cycle for thetachyzoite stage of Toxoplasma gondii. Mol Biochem Parasitol 115: 165–175.

Reed, S.I. (1992) The role of P34 kinases in the G1 to S-phase transition. Ann Rev Cell Biol 8: 529–561.

Reed, S.I. (1997) Control of the G1/S transition. Cancer Surv29: 7–23.

Ross-Macdonald, P.B., Graeser, R., Kappes, B., Franklin, P.,and Williamson, D.H. (1994) Isolation and expression ofgene specifying a cdc2-like protein kinase from the humanmalaria parasite Plasmodium falciparum. Eur J Biochem220: 693–701.

Rua, D., Tobe, B.T., and Kron, S.J. (2001) Cell cycle controlof yeast filamentous growth. Curr Opin Microbiol 4: 720–727.

Shaw, M.K., Roos, D.S., and Tilney, L.G. (2001) DNA repli-cation and daughter cell budding are not tightly linked inthe protozoan parasite Toxoplasma gondii. Microbes Infect3: 351–362.

Soldati, D., and Boothroyd, J.C. (1993) Transient transfectionand expression in the obligate intracellular parasite Toxo-plasma gondii. Science 260: 349–352.

Solomon, M.J. (1993) Activation of the various cyclin/cdc2protein kinases. Curr Opin Cell Biol 5: 180–186.

Van den Heuvel, S.V., and Harlow. E. (1993) Distinct roles of cyclin-dependent kinases in cell cycle control. Science262: 2050–2054.

Vinkenoog, R., Veldhulsen, B., Sperance, M.A., del Portilb,H.A., Janse, C., and Waters, A.P. (1995) Comparison ofintrons in a cdc2-homologous gene with in a number ofPlasmodium species. Mol Biochem Parasitol 71: 233–241.

Wan, K.L., Blackwell, J.M., and Ajioka, J.W. (1996) Toxo-plasma gondii expressed sequence tags: insight into tachy-zoite gene expression. Mol Biochem Parasitol 75: 179–186.


Wang, Y., Dimitrov, K., Garrity, L.K., Sazer, S., and Beverley,S.M. (1998) Stage-specific activity of the Leishmania majorCRK3 kinase and functional rescue of a Schizosaccha-romyces pombe cdc2 mutant. Mol Biochem Parasitol 96:139–150.

Wastling, J.M., and Kinnaird, J.H. (1998) Isolation and char-

acterization of a genomic clone encoding a cdc2-relatedkinase of Toxoplasma gondii. Mol Biochem Parasitol 94:143–148.

Weiss, L.M., and Kim, K. (2000) The development andbiology of bradyzoites of Toxoplasma gondii. Front Biosci5: D391–D405.


332 F. Khan et al.

cyclin-dependent kinase tpk2 is a critical cell cycle regulator in toxoplasma gondii

Documents