cytochrome c oxidase subunit 1 (coi) profile of the...

Keywords: DNA barcoding, Helicostylinae, mitochondrial COI, Philippine land snails

Cytochrome C Oxidase Subunit 1 (COI) Profile of the Philippine Helicostylinae

(Gastropoda: Stylommatophora: Camaenidae)

1Insitute of Biology, College of Science, University of the Philippines Diliman, Quezon City 1101 Philippines

2Natural Sciences Research Institute, University of the Philippines Diliman, Quezon City 1101 Philippines

3Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines Los Baños 4031 Laguna, Philippines4Department of Biodiversity, Earth and Environmental Sciences,

College of Arts and Sciences, Drexel University, Philadelphia, PA 19104 USA5College of Science, University of the Philippines Cebu, Cebu City 6000 Philippines

*Corresponding author: [email protected]

Gizelle A. Batomalaque1,4,*, Gerard Clinton L. Que1, Tyrill Adolf B. Itong5, Anna Regina L. Masanga1,

Emmanuel Ryan C. de Chavez3, and Ian Kendrich C. Fontanilla1,2

The Philippines is the center of radiation of the land snail subfamily Helicostylinae, with around 253 recognized species. Despite their morphological diversity, research on their biology and taxonomy is lacking. We present here the first mitochondrial COI profiles of 32 species of Philippine helicostyline land snails. With the addition of sequences downloaded from GenBank, we tested the utility of the COI for species identification. Relative distributions of intraspecific and interspecific distances overlapped; hence, no barcoding gap was observed. However, 90% of uncorrected interspecific comparisons can distinguish species at 14% genetic distance or lower. Furthermore, the COI barcodes could not discriminate several co-distributed species that have similar conchological features, which should be flagged for taxonomic re-evaluation.

Philippine Journal of Science148 (S1): 1-13, Special Issue on GenomicsISSN 0031 - 7683Date Received: 31 Jan 2019

INTRODUCTIONThe Helicostylinae, a subfamily under family Camaenidae (sensu Bouchet et al. 2017) and order Stylommatophora, are hermaphroditic ground and tree snails whose center of diversity is the Philippine Islands (Parkinson et al. 1987, Abbott 1989, de Chavez et al. 2015) and whose distribution extends to Taiwan, the Moluccas, and the smaller islands off the coast of Borneo (Schileyko 2004, Schilthuizen et al. 2013). Members of this subfamily

exhibit a range in shell forms from discoidal, depressed and keeled, globose, to elongated conical forms (Parkinson et al. 1987). Within the Philippines, different helicostyline species vary in distributions, with most occurring in single islands (e.g., Anixa siquijorensis in Siquijor Is. and Helicostyla (Calocochlea) chrysocheila in Luzon Is.) and some occurring in multiple adjacent islands (e.g., Leytia fragilis in Samar and Leyte islands and Trachystyla cryptica in the islands of Samar, Leyte, and Mindanao). There are about 245 species (Batomalaque n/p, Faustino 1930, Richardson 1983, Abbott 1989) belonging to

1

23 genera (Schileyko 2004, Bouchet et al. 2017). The current taxonomy of the helicostylines is based on shell morphology, although the reproductive anatomy for some species has been described (Schileyko 2004). No molecular work has been done to evaluate their current classification, and phylogenetic relationships among the species are unknown.

The mitochondrial cytochrome c oxidase subunit 1 (COI) gene has been the gene of choice for DNA barcoding in animals (Hebert et al. 2003, Meyer and Paulay, 2005, Park et al. 2011, Siddall et al. 2012, Perez et al. 2014). However, its utility in species discrimination in low-vagility species (Davison et al. 2009, Virgilio et al. 2010) appears to be fraught with high error rates due to lack of baseline differences established through morphology and a DNA sequence database. In land snails, several studies have shown high levels of mtDNA sequence divergence in intraspecific populations (Watanabe and Chiba 2001, Pfenniger and Posada 2002, Davison et al. 2009).

In this paper, we present the first COI profiles of the Philippine helicostyline land snails, and we test the utility of 463-bp COI barcodes in distinguishing among morphological species.

MATERIALS AND METHODS

Taxon Sampling and IdentificationA total of 134 specimens attributed to 35 camaenid species were collected from 27 localities across the Philippines (Table 1), representing approximately 15% of the total nominal species of Helicostylinae. The 41 camaenid species comprised 35 species under subfamily Helicostylinae and three under subfamily Bradybaeninae. Cuttings of foot tissue were preserved in 95% (v/v) ethanol, while the vouchers were preserved in 70% (v/v) ethanol. Identification of species was based on shell morphology, using literature (Springsteen and Leobrera 1986, Abbott 1989), and by examination of reference collections in the University of the Philippines Diliman Invertebrate Museum (UPDIM), Quezon City, Philippines.

DNA Extraction and SequencingDNA was extracted using the relatively rapid and inexpensive modified NaOH-lysis method (Fontanilla et al. 2017). In this method, tissue slices were ground using glass beads with 200 μL of 0.1 N NaOH and centrifuged with 300 μL chloroform-isoamyl alcohol (24:1). The upper phase was then collected and centrifuged with ~300 μL isopropanol. The pellets were washed with ethanol, air-dried, and finally re-suspended in 150 μL TE buffer. DNA extracts were subjected to PCR

amplification using Taq DNA Polymerase and dNTPack (Roche, USA), and universal (forward LCO 1490 GGTCAACAAATCATAAACATATTGG, reverse HCO 2198 TAAACTTCAGGGTGACCAAAAAATCA; Folmer et al. 1994) and stylommatophoran-specific (forward STY_LCOii ACGAATCATAAGGATATTGGTAC, reverse STY_HCO GAATTAAAATATATACTTCTGGGTG; Fontanilla et al. 2017) primers for the mitochondrial cytochrome c oxidase subunit I (COI) gene. A 50 μL PCR mix consisted of the following components: 5 μL of 10X PCR buffer; 1 μL of 10 mM dNTP; 2.5 μL each of 10 mM forward and reverse primers; 22.75 μL distilled water; 0.25 μL Taq-polymerase (5 units/μL); 10 μL Q-buffer (Qiagen, USA); 2 μL of 15 mM MgCl2; and 4 μL of 10 mM DNA. Amplification protocol consisted of 2 min at 94°C followed by 38 cycles of 30 sec at 94°C, 30 sec at 45°C, 60 sec at 65°C, and a final extension of 5 min at 72°C. PCR products were visualized in a 1% agarose gel using EtBr UV illumination.

Amplified PCR products were extracted using QIAquick® Gel Extraction Kit (Qiagen, USA). Purified samples were sent to 1stBASE, Malaysia for sequencing.

Sequence Alignment and DNA Barcoding AnalysisSequences were assembled using the STADEN package v.1.5.3 (Staden et al. 2000), and aligned using BioEdit v.5.0.5 (Hall 1999). Only unambiguously aligned nucleotide sites were included in the analyses. All sequences were deposited in GenBank (Table 1).

An additional 292 stylommatophoran COI sequences from GenBank were analyzed together with those from this study for a total of 423 sequences to test their utility in species discrimination. Sequences of species under family Polygyridae were used as outgroups, following the recent molecular helicoid phylogeny of Sei et al. (2017). Sequences were viewed and trimmed to 463 nucleotides common to all taxa using BioEdit v.7.0.9 (Hall 1999) and aligned using the ClustalW (Thompson et al. 1994) accessory program. Haplotypes were counted using DnaSP v. 6.12.01 (Rozas et al. 2017).

The substitution model was determined using ModelTest-NG v.0.1.5 (Darriba et al. 2015), and the model with the best log-likelihood score was chosen using the Akaike Information Criterion (Akaike 1973, 1974; Hurvich and Tsai 1993). The Xia Test (Xia et al. 2003, Xia and Lemey 2009) for substitution saturation was also performed in DAMBE v. 6.4.81 (Xia 2013, 2017). Pairwise comparisons of likelihood scores were performed on the dataset using uncorrected p-distances and GTR+Γ corrected distances generated by PAUP* v4.10b (Swofford 2003), with GTR+Γ (Tavare 1986) determined as an optimal model by ModelTest-NG. Comparisons of pairwise distances

Special Issue on Genomics Batomalaque et al.: Philippine Helicostylinae DNA Barcodes

2

Table 1. Species of Philippine camaenids collected with their corresponding GenBank accession numbers.

Subfamily Species name Locality Collector/s GenBank accession

no.

Helicostylinae Chloraea amoena (Pfeiffer, 1845) Alaminos, Pangasinan, Luzon

I.K.C. Fontanilla, G.A. Batomalaque, E. de Vera

KM279469

KM279470

KM279471

KM279472

KM279473

Chloraea hennigiana Moellendorff, 1893 Alaminos, Pangasinan, Luzon

I.K.C. Fontanilla, G.A. Batomalaque, E. de Vera

KM279464

KM279465

KM279466

KM279467

KM279468

Chloraea fibula Not Uploaded

to GenBank

Chrysallis chrysalidiformis (Sowerby, 1833) Puerto Galera, Mindoro

A.U. Luczon KM056693

KM056694

KM056695

Cochlostyla bicolorata (Lea, 1840) Laguna, Luzon C.P. Española KM056744

Cochlostyla daphnis (Broderip, 1841) Borbon, Cebu R.J.C. Canoy KM056706

Santander, Cebu P. Olvis KM056707

Cochlostyla fauna (Broderip, 1841) Bantayan Is., Cebu P. Olvis KM056713

KM056714

KM056715

Cochlostyla imperator (Pfeiffer, 1848) Sibulan Is., Polillo E.R.C. de Chavez KM056725

KM056726

Cochlostyla intermedia (Quadras and Moellendorff, 1896) Benguet, Luzon D. Constantino-Santos, I.K.C. Fontanilla, A.U. Luczon

KM056728

KM056729

KM056730

KM056731

Cochlostyla marinduquensis (Hidalgo, 1887) Gasan, Marinduque B.O. Sosa III, R.D.C. Pedales

KM279486

KM279487

KM279488

KM279489

KM279490

KM279491

KM279492

KM279493

KM279494

Cochlostyla pithogaster (Férussac, 1821) Sta. Cruz, Marinduque

B.O. Sosa III, R.D.C. Pedales

KM279495

KM279496

KM279497

KM279498


3

KM279499

KM279500

KM279501

KM279502

KM279503

KM279504

Torrijos, Marinduque KM279505

KM279506

Cochlostyla portei (Pfeiffer, 1861) Polillo Is., Polillo E.R.C. de Chavez, I.K.C. Fontanilla, G.A. Batomalaque, J.F. Halili

KM056727

KM056739

KM056740

KM056741

KM056742

KM056743

Cochlostyla ticaonica (Broderip, 1841) Balamban, Cebu T.A.B. Itong KM279485

Cochlostyla ventricosa (Bruguière, 1792) Medellin, Cebu P. Olvis KM056751

KM056750

Cochlostyla woodiana (Lea, 1840) Amaga, Polillo E.R.C. de Chavez KM056753

Cochlostyla worcesteri Bartsch, 1909 Bantayan Is., Cebu P. Olvis KM056711

KM056710

Corasia puella (Broderip, 1841) Balamban, Cebu T.A.B. Itong KM279479

KM279480

KM279481

KM279482

KM279483

KM279484

KM279478

KM279477

Corasia reginae (Grateloup, 1840) Kidapawan, Mindanao

D.A.E. Ramos KM056692

Dryocochlias metaformis (Férussac, 1821) Rizal, Luzon G.A. Batomalaque KM056756

KM056757

Helicostyla amagaensis de Chavez, 2015 Amaga, Polillo E.R.C. de Chavez KM056719

KM056720

KM056721

Helicostyla butleri (Pfeiffer, 1842) Benguet, Luzon D. Constantino-Santos KM056705

Helicostyla corticolor Kobelt, 1911 Mountain Province, Luzon

G.A. Batomalaque KM056712

Helicostyla (Calocochlea) generalis (Pfeiffer, 1854) Anawan, Polillo E.R.C. de Chavez KM056690

KM056691

Helicostyla (Calocochlea) pan (Broderip, 1841) Batoan, Bohol P. Olvis KM056683

KM056684

Helicostyla (Calocochlea) polillensis (Pfeiffer, 1861) Laguna, Luzon E.R.C. de Chavez KM056732

Polillo Is., Polillo E.R.C. de Chavez KM056737

KM056738

Table 1. continuation . . . .


4

Helicostyla (Calocochlea) speciosa (Jay, 1839) Laguna, LuzonSibulan Is., Polillo

E.R.C. de Chavez KM056733

KM056734

KM056735

KM056736

E.R.C. de Chavez, I.K.C. Fontanilla, G.A. Batomalaque, J.F. Halili

KM056689

KM056716

KM056717

KM056718

Helicostyla (Calocochlea) valenciennesii (Eydoux, 1838) Laguna, Luzon E.R.C. de Chavez KM056688

Helicostyla (Opalliostyla) aegle (Broderip, 1841) Agusan, Mindanao G. Galan KM056749

Helicostyla (Opallioastyla) mearnsi Bartsch, 1905 Kidapawan, Mindanao

D.A.E. Ramos KM056723

KM056745

Kidapawan, Mindanao

J.A. Anticamara KM056746

KM056747

Agusan, Mindanao G. Galan KM056748

Hypselostyla camelopardalis (Broderip, 1841) Argao, Cebu P. Olvis KM056708

KM056709

Hypselostyla carinata (Lea, 1840) Anawan, Polillo E.R.C. de Chavez KM056722

Hypselostyla subcarinata (Pfeiffer, 1842) Gasan, Marinduque B.O. Sosa III, R.D.C. Pedales

KM279507

KM279508

KM279509

KM279510

KM279511

KM279512

Leytia fragilis (Sowerby, 1841) Ormoc, Leyte E.R.C. de Chavez, I.K.C. Fontanilla, M. Hayashi

KM056724

KM056696

KM056697

KM056698

KM056699

KM056700

Phoenicobius brachyodon (Sowerby, 1841) Puerto Galera, Mindoro

A.U. Luczon KM056754

KM056755

Rhymbocochlias grandis (Pfeiffer, 1845) Cagayan, Luzon C.P. Española KM056752

Trachystyla cryptica (Broderip, 1841) Agusan, Mindanao G. Galan KM056704

Ormoc, Leyte G.A. Batomalaque, F.S. Magbanua, D.A.E. Ramos

KM056701

KM056702

KM056703

Bradybaeninae Bradybaena similaris (Rang, 1831) Baguio, Benguet, Luzon

G.A. Batomalaque KM056685

KM056686

KM056687



5

were done for scores within species and between species following the methods of Meyer and Paulay (2005) in order to detect the presence of a barcoding gap.

A Neighbor Joining (NJ) tree (Saitou and Nei 1987) was constructed in PAUP* following the parameters of the optimal model (GTR+Γ as determined by ModelTest-NG. A Maximum Likelihood (ML) tree (Felsenstein 1981) was also generated using the parallel (MPI) version RAxML v. 8.2.11 (Stamatakis 2014) with 1000 bootstraps (Felsenstein 1985, Stamatakis et al. 2008) and the GTR+Γ model with substitution rates and other parameters determined by RAxML v. 8.2.11 (Stamatakis 2014). A Bayesian (BI) tree was generated using the parallel version of MrBayes v. 3.2.6 (Altekar et al. 2004, Ronquist et al. 2012), also following the GTR+Γ model of nucleotide substitution, using two runs consisting of four chains each. MrBayes was run for 10 million generations and convergence was evaluated using the standard deviation between each run and the Potential Scale Reduction Factor. The trees were visualized and edited using Dendroscope v. 3.5.9 (Huson and Scornavacca 2012), FigTree v. 1.4.3 (Rambaut 2016), and Tree Explorer v. 2.12 (Tamura 1999).

RESULTSMitochondrial COI was sequenced from 119 specimens of Philippine helicostyline land snails, as well as 12 specimens of other Philippine Camaenidae species (Table 1). These and the additional 292 sequences from GenBank comprised the dataset of 423 sequences (463 nucleotides in length) containing 323 haplotypes for the entire dataset, while 63 unique haplotypes are seen for Philippine helicostyline sequences. The Xia test showed little saturation (lss. = 0.281 is significantly lower than both lss.cSym = 0.698 for a completely symmetrical tree and lss.cAsym = 0.372 for a completely asymmetrical tree). The mean intraspecific distance (uncorrected p-distance = 0.056; GTR+Γ-corrected distance = 0.109) is less than

the mean interspecific distance (uncorrected p-distance = 0.212; GTR+Γ-corrected distance = 0.884), although the relative distributions overlap (Figures 1 and 2) such that no barcoding gap is observed. However, the most frequent values for the uncorrected intraspecific (0.000) and interspecific (0.216) distances appeared to be distinct, as seen in Figure 1 as separate modes for the two datasets. Furthermore, around 90% of all uncorrected intraspecific comparisons fall within 14% distance. Taking only the Philippine camaenid sequences generated from this study,

Eulota mighelsiana (Pfeiffer, 1846) Batan, Batanes G.A. Batomalaque, I.K.C. Fontanilla, P.R.L. Sales

JQ582272

JQ582273

JQ582274

JQ582275

JQ582276

Satsuma batanica (Adams and Reeve, 1850) Batan, Batanes G.A. Batomalaque, I.K.C. Fontanilla, P.R.L. Sales

JQ582280

JQ582281

JQ582282

JQ582283


Figure 1. Distribution of intraspecific and interspecific pairwise uncorrected distances.

Figure 2. Distribution of intraspecific and interspecific pairwise corrected distances based on the GTR+Γ model of DNA substitution.


6

the mean intraspecific distance (uncorrected p-distance = 0.014; GTR+Γ-corrected distance = 0.026) was less than the mean interspecific (uncorrected p-distance = 0.181; GTR+Γ-corrected distance = 0.698) but a similar overlap in relative distributions of the distances was observed (Figures 3 and 4). For the Philippines samples, 98% of all uncorrected intraspecific comparisons fall within 12% genetic distance.

terminal nodes for conspecific groupings, the deeper nodes are not well-supported.

A majority of the helicostyline samples grouped with their conspecifics with a few exceptions, which constituted three groups (Figure 5). Group 1 is composed of Chloraea amoena and C. hennigiana (NJ/ML/BI: 100/99/0.89), which interfinger with very high sequence similarity (0–0.65% for both corrected and uncorrected interspecific distances). C. amoena has one unique COI haplotype while C. hennigiana has two unique haplotypes; another haplotype is shared between both species. Group 2 is composed of Helicostyla (Calocochlea) speciosa, H. (C.) generalis, H. (C.) polillensis, and H. (C.) valenciennesii and forms a well-supported clade (NJ/ML/BI:100/100/1.00) with very little interspecific genetic distance (0–7.2% for both corrected and uncorrected distances). H. (C.) speciosa and H. (C.) polillensis have three and two haplotypes, respectively. Two of H. (C.) speciosa’s haplotypes and one of H. (C.) polillensis’ haplotypes are shared with other members of Group 2. H. (C.) generalis and H. (C.) valenciennesii do not have any unique haplotypes and share their COI sequence with other members of Group 2. Finally, Cochlostyla ventricosa and C. worcesteri comprise Group 3 (NJ/ML/BI: 99/100/1.00), with little interspecific sequence divergence (0.2–1.78% for both corrected and uncorrected distances). One unique COI haplotype is present for each species in Group 3; a third haplotype is shared between both species. Aside from these species, well-supported conspecific groupings were obtained.

DISCUSSIONDNA barcoding has become a routine method for identifying species and detecting cryptic diversity (Hebert et al. 2003, 2004; Scheffer et al. 2006). Threshold values for discriminating species are approximated from the barcoding gap and may vary for different taxa. Hebert et al. (2003) set the threshold value to 3% for characterizing different species, and then set a threshold value of 2.7% for birds (Hebert et al. 2004). For fish, Ward et al. (2008) set it at 3–3.5%, while Meyer and Paulay (2005) set a threshold value of 1.99–2.85% for cowries (marine gastropods). No evidence of a barcoding gap was observed in this study due to the overlap in relative distributions of intraspecific and interspecific distances. Such overlaps have also been observed in several mollusk groups such as the marine gastropod family Cypraeidae (Meyer and Paulay 2005) and stylommatophoran land snails (Davison et al. 2009). In their analysis of different stylommatophoran families, Davison et al. (2009) observed that intraspecific variations ranged from 10% to 30% depending on the species and the

Figure 3. Distribution of intraspecific and interspecific pairwise uncorrected distances for sequences original to this study (Table 1).

Figure 4. Distribution of intraspecific and interspecific pairwise corrected distances based on the GTR+Γ model of DNA substitution for sequences original to this study (Table 1).

All tree-construction methods yielded similar tree topologies (Figure 5; Appendix Figure I). Helicostylinae was rendered non-monophyletic, forming a polytomy with other camaenid species. Two clades fall outside the majority of helicostylines: the Chloraea clade and the genera Phoenicobius and Chrysallis – here on referred to as the Palawan-Mindoro (PM) clade since these species are restricted to the islands of Palawan and Mindoro. The Chloraea clade is sister to species of subfamily Aegistinae (sensu Schileyko, 2004; see Appendix Figure II), while the PM clade is sister to Nesiohelix swinhoe and Satsuma batanica, although these relationships are not well-supported. The clade containing a majority of the Helicostylinae is here on referred to as the crown Helicostylinae. Although there is high support at the


7

Figure 5. Maximum likelihood tree of the Philippine Camenidae based on 463 bp of the mitochondrial cytochrome oxidase subunit I (COI) gene under the GTR+Γ model. The tree is rooted on polygrid Vespericola columbiana depressa. The trifurcating node is indicated by the red star. Helicostylinae is shown to be non-monophyletic, having three separate clades – the Chloraea clade that is sister to Aegistinae species, the crown Helicostylinae that contains most of the helicostyline species, and the PM clade that consists of Chrysallis and Phoenicobius. The highlighted groups consist of sequences from more than one morphospecies but are very similar or almost identical. Photos of representative specimens are not to scale: a – Chloraea hennigiana KM279468 (shell height = 10.3 mm); b – C. amoena KM279471 (shell height = 8.8 mm); c – Helicostyla (Calocochlea) speciosa juvenile KM056735 (shell height = 26.4 mm); d – H. (C.) polillensis KM056738 (standard shell height = 42.7 mm); e – H. (C.) valenciennesii juvenile KM056688 (shell height = 22.2 mm); f – Cochlostyla ventricosa KM056751 (shell height = 42.4 mm); g – C. worcesteri KM056711 (shell height = 34.5 mm). Tips marked with an asterisk (*) represent sequences that were downloaded from GenBank. Values on nodes represent NJ and ML bootstraps, respectively, based on 1000 bootstrap samples; values less than 50 % are not shown. The scale bar represents five substitutions for every ten nucleotides.


8

gene used. No barcoding gap was observed in species of Polygyridae, and the mean genetic distance within species ranged from 0.9% to 19.1% (Perez et al. 2014). The camaenid Camaena cicatricosa had 0–6.725 nucleotide differences between populations, but no correlation was found between genetic distance and geographical distance (Zhou et al. 2017). Although no barcoding gap was observed in the Philippine camaenids, it should be noted that a majority (90%) of the uncorrected intraspecific comparisons in this study yielded distances of 14% and lower. On the other hand, 99% of the uncorrected interspecific comparisons yielded distances above 14%. Most species within the Camaenidae could therefore be distinguished within 14% sequence divergence using the COI gene as a marker.

The tree topology obtained in this study, which is based on the mitochondrial COI, can be interpreted as a preliminary phylogenetic framework for the Helicostylinae, although most of the deeper nodes are not well-supported. Our result showed that the Helicostylinae is not monophyletic, but this topology might change with the addition of more loci. The Chloraea and PM clades represent entirely different evolutionary histories from the rest of the Helicostylinae. Among the genera whose reproductive anatomies have been described and illustrated by Schileyko (2004), Chloraea, Chrysallis, and Phoenicobius are the only helicostylines whose accessory glands (mucus glands in Schileyko 2004) are not globular or sub-globular. They are instead elongated (as in Chloraea and Phoenicobius) like those of Guamampa and Tricheulota (of subfamily Aegistinae sensu Schileyko, 2004) or divided into several tubules (as in Chrysallis) like those of Nesiohelix and Plectotropis (of subfamily Aegistinae sensu Schileyko, 2004). It has been shown that the love dart and dart-related organs (accessory glands included) were lost independently in some camaenid species (Hirano et al. 2014). However, whether these accessory gland morphologies are synapomorphic characters or not is yet to be tested. Aside from reproductive anatomy, the separation of the PM clade may be reflective of the Philippines’ geologic history. The islands of Palawan and Mindoro were part of the continental block, while the rest of the Philippine islands emerged through tectonic-volcanic activity (Hall 2002). This is not to say that a biogeographic boundary exists between these islands (Palawan and Mindoro) and the rest of the Philippines since some helicostylines occur in the oceanic islands as well as Mindoro (e.g., Cochlostyla pithogaster and Helicostyla speciosa, which are both under the crown Helicostylinae). It must be noted that the phylogeny presented here is only based on the mitochondrial COI. Gene trees generated from other mitochondrial loci or nuclear loci would have a different topology due to different evolutionary rates and histories. A wider taxonomic sampling and more genetic loci would

be necessary to resolve the polytomy.

Three groups contained species interfingering with very high sequence similarity. The first group, Chloraea amoena and C. hennigiana, might also represent a single species. Both species share the same shell shape, size, and thickness, but C. amoena has both banded and unbanded forms while C. hennigiana does not have any banding pattern. The second is composed of Helicostyla (Calocochlea) speciosa, H. generalis, H. polillensis, and H. valenciennesii. These species are co-distributed in Luzon and Polillo Is. and may represent at least three closely related species or possible cases of hybridization. Although they share the same semi-globular shell shape and ground color (yellow to tan/ light brown), their banding patterns, shell thickness, and microsculpture differ. The third group is composed of Cochlostyla ventricosa and C. worcesteri – both occurring in Cebu Is. and having turriform shell shape but differing in banding pattern (C. ventricosa has thin brown bands that are visible even on eroded shells). This group could possibly represent a single polymorphic species. Furthermore, the specimens were collected from the same locality and therefore could exhibit polymorphisms of a single species. We have not observed cases of possible cryptic diversity, where individuals of a single species occurred in different parts of the tree, thus representing two morphologically similar but genetically different species.

A wide range of intraspecific polymorphisms is not uncommon in land snails (Goodfriend 1986; Chiba 1993, 1996; Davison and Chiba 2006; Perez et al. 2014). For example, Cepaea nemoralis exhibits different color morphs (yellow, pink, or brown) and banding patterns (unbanded, midbanded, many-banded), which vary with habitat (Cameron and Cook 2012). The occurrence of highly-supported clusters and low sequence divergence of different species could mean either one or all of three things. First, these species could be results of natural hybridization between sympatric species, as exhibited by their similarity in general shell color and form, and the occurrence of seemingly intermediate forms. Woodruff and Gould (1987) documented a controlled interspecific hybridization of two species of the land snail Cerion in the Florida Keys. They observed the intermediacy of forms and enhanced variation in the hybrids, noting that such phenomena could occur naturally between sympatric species. Second, the morphologically different species that clustered together may be a single species – or a collection of closely related species – with very plastic shell morphology. Such was observed by Chiba (1999) on the land snail Mandarina, which is endemic to the oceanic Bonin Islands off the coast of Japan. These snails were found in the same site but had morphological features that appeared to be more correlated with the type


9

of microhabitat they were in. Thus, the diversification in shell color and shell shape was possibly caused by microhabitat differentiation (Chiba 1999, 2009). Third, these species may simply have clustered together because there is not enough species or individuals that would cause them to separate in the tree. In these cases, the utility of the mitochondrial COI as a species discrimination tool is limited. The species that interfingered in the tree must be re-examined in other aspects, such as targeting more genes (both mitochondrial and nuclear) and examining their reproductive anatomy and ecology.

Including more loci will be worth pursuing to come up with a phylogenetic framework for the Helicostylinae. Furthermore, anatomical and ecological characteristics could also provide valuable information in elucidating relationships in this less understood group. We therefore recommend exploring these avenues in greater detail for a comprehensive phylogenetic framework of the subfamily.

ACKNOWLEDGMENTSThis research was funded by the Natural Sciences Research Institute (NSRI) of the University of the Philippines (UP) Diliman (Grant numbers: BIO-11-2-02 and BIO-13-1-05). We thank the Institute of Biology, UP Diliman for the logistical support. We thank the local government units and local offices of the Department of Environment and Natural Resources for granting us permits, and private landowners for allowing us to collect samples.

NOTES ON APPENDICESThe complete appendices section of the study is accessible at http://philjournsci.dost.gov.ph

REFERENCESABBOTT RT. 1989. Compendium of landshells: A full-

color guide to more than 2,000 of the world’s terrestrial shells. Melbourne, FL: American Malacologist, Inc. 240p.

AKAIKE H. 1973. Information theory and an extension of the maximum likelihood principle. In: Petrov BN, Csaki F eds. 2nd International Symposium on Information Theory. Budapest, Hungary: Akademia Kiado.

AKAIKE H. 1974. A new look at the statistical model

identification. IEEE Trans Automat Contr 19(6): 716–723.

ALTEKAR G, DWARKADAS S, HUELSENBECK JP, RONQUIST F. 2004. Parallel Metropolis-coupled Markov chain Monte Carlo for Bayesian phylogenetic inference. Bioinformatics 20: 407–415.

BOUCHET P, ROCROI J, HAUSDORF B, KAIM A, KANO Y, NÜTZEL A, PARKHAEV P, SCHRÖDL M, STRONG EE. 2017. Revised classification, nomenclator and typification of gastropod and monoplacophoran families. Malacologia 61(1–2): 1–526.

CAMERON RAD, COOK LM. 2012. Habitat and the shell polymorphism of Ceparea nemoralis (L.): Interrogating the Evolution Megalab database. J Moll Stud 78: 179–184.

CHIBA S. 1993. Modern and historical evidence of natural hybridization between sympatric species in Mandarina (Pulmonata: Camaenidae). Evolution 47(5): 1539–1556.

CHIBA S. 1996. Ecological and morphological diversification within single species and character displacement in Mandarina, endemic land snails of the Bonin Islands. J Evol Bio 9: 277–291.

CHIBA S. 1999. Character displacement, frequency-dependent selection, and divergence of shell colour in land snails Mandarina (Pulmonata). Biol J Linn Soc 66: 465–479.

CHIBA S, 2009. Morphological divergence as a result of common adaptation to a shared environment in land snails of the genus Hirasea. J Molluscan Stud 75: 253–259.

DARRIBA D, POSADA D, STAMATAKIS A. 2015. ModelTest-NG. Retrieved from https://github.com/ddarriba/modeltest

DAVISON A, CHIBA S. 2006. Labile ecotypes accompany rapid cladogenesis in an adaptive radiation of Mandarina (Bradybaenidae) land snails. Biol J Linn Soc 88: 269–282.

DAVISON A, BLACKIE RLE, SCOTHERN GP. 2009. DNA barcoding of stylommatophoran land snails: A test of existing sequences. Mol Ecol Resour 9(4): 1092–1101.

D E C H AV E Z E R C , F O N TA N I L L A I K C , BATOMALAQUE GA, CHIBA S. 2015. A new Helicostyla species (Bradybaenidae: Helicostylinae) from Patnanungan Island, Philippines. Asia Life Sci 24(1): 37–49.

FAUSTINO LA. 1930. Summary of Philippine land shells.


10

Philipp J Sci 42(1): 85–198.

FELSENSTEIN J. 1981. Evolutionary trees from DNA sequences: A maximum likelihood approach. J Mol Evol 17(6): 368–376.

FELSENSTEIN J. 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evol. 39(4): 783–791.

FOLMER O, BLACK M, HOEH W, LUTZ R, VRIJENHOEK R. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3(5): 294–299.

FONTANILLA IKC, NAGGS F, WADE CM. 2017. Molecular phylogeny of the Achatinoidea (Mollusca: Gastropoda). Mol Phylogenet Evol 114: 382–385.

GOODFRIEND GA. 1986. Variation in land-snail shell form and size and its causes: A review. Syst Zool 35(2): 204–223.

HALL TA. 1999. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41: 95–98.

HALL R. 2002. Conozoic geological and plate tectonic evolution of SE Asia and the SW Pacific: Computer-based reconstructions, model and animations. J. Asian Earth Sci. 20: 353–431.

HEBERT PDN, CYWINSKA A, BALL SL, DEWAARD JR. 2003. Biological identifications through DNA barcodes. Proc R Soc Britain 270: 313–321.

HEBERT PDN, STOECKLE MY, ZEMLAK TS, FRANCIS CM. 2004. Identification of birds through DNA barcodes. PLoS Biol 2: e312.

HIRANO T, KAMEDA Y, KIMURA K, CHIBA S. 2014. Substantial incongruence among the morphology, taxonomy, and molecular phylogeny of the land snails Aegista, Landouria, Trishoplita, and Pseudobulimus (Pulmonata: Bradybaenidae) occurring in East Asia. Mol Phylogenet Evol 70: 171–181.

HURVICH C, TSAI C. 1993. A corrected Akaike information criterion for vector autoregressive model selection. J Time Ser Anal 14(3): 271–279.

HUSON DH, SCORNAVACCA C. 2012. Dendroscope 3: An interactive tool for rooted phylogenetic trees and networks. Syst Biol 61(6): 1061–1067.

MEYER CP, PAULAY G. 2005. DNA barcoding: Error rates based on comprehensive sampling. PLoS Biol 3(12): e422. Available from: http://journals.plos.org/plosbiology/article?id=10.1371/journal.pbio.0030422

PARK DS, FOOTTIT R, MAW E, HEBERT PDN. 2011. Barcoding bugs: DNA-based identification of the true bugs (Insecta: Hemiptera: Heteroptera). PLoS ONE 6: e18749.

PARKINSON B, HEMMEN J, GROH K. 1987. Tropical land shells of the world. Berlin, Germany: Verlag. 279p.

PEREZ KE, DEFREITAS N, SLAPCINSKY J, MINTON RL, ANDERSON FE, PEARCE TA. 2014. Molecular phylogeny, evolution of shell shape, and DNA barcoding in Polygyridae (Gastropoda: Pulmonata), an endemic North American clade of land snails. Am Malacol Bull 32(1): 1–31.

PFENNIGER M, POSADA D. 2002. Phylogeographic history of the land snail Candidula unifasciata (Helicellinae, Stylommatophora): fragmentation, corridor migration, and secondary contact. Evolution 56: 1776–1788.

RAMBAUT A. 2016. FigTree: Tree figure drawing tool, version 1.4.3. Retrieved from http://tree.bio.ed.ac.uk/software/figtree/

RICHARDSON L. 1983. Bradybaenidae: Catalogue of Species: Tryonia. Philadelphia, PA: Academy of Natural Sciences – Department of Malacology. 253p.

RONQUIST F, TESLENKO M, VAN DER MARK P, AYRES D, DARLING A, HÖHNA S, LARGET B, LIU L, SUCHARD M, HUELSENBECK J. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst Biol 61(3): 539–542.

ROZAS J, FERRER-MATA A, SÁNCHEZ-DELBARRIO JC, GUIRAO-RICO S, LIBRADO P, RAMOS-ONSINS SE, SÁNCHEZ-GRACIA A. 2017. DnaSP 6: DNA sequence polymorphism analysis of large datasets. Mol Biol Evol 34: 3299–3302.

SAITOU N, NEI M. 1987. The neighbor-joining method: A new method for reconstructing evolutionary trees. Mol Biol Evol 4: 406–425.

SCHEFFER SJ, LEWIS ML, JOSHI RC. 2006. DNA barcoding applied to invasive leafminers (Diptera: Agromyzidae) in the Philippines. Ann Entomol Soc Am 99(2): 204–210.

SCHILEYKO AA. 2004. Treatise on recent terrestrial pulmonated molluscs, Part 12: Bradybaenidae, Ruthenica 2(Supp.): 138.

SCHILTHUIZEN M, LIEW TS, LIEW TH, BERLIN P, KING JP, LAKIM M. 2013. Species diversity patterns in insular land snail communities of Borneo. J Geol Soc London 170: 539–545.


11

SEI M, ROBINSON DG, GENEVA AJ, ROSENBERG G. 2017. Double helix: Sagdoidea is the overlooked sister group of Helicoidea (Mollusca: Gastropoda: Pulmonata). Biol J Linn Soc 20: 1–32.

SIDDALL ME, KVIST S, PHILLIPS A, OCEGUERA-FIGUERO A. 2012. DNA barcoding parasitic nematodes: Is it kosher? J Parasitol 98: 692–684.

SPRINGSTEEN FJ, LEOBRERA FM. 1986. Shells of the Philippines. Manila, Philippines: Carfel Seashell Museum. 377p.

STADEN R, BEAL KF, BONFIELD JK. 2000. The Staden package, 1998. Methods Mol Biol 132: 115–130.

STAMATAKIS A, HOOVER P, ROUGEMONT J. 2008. A rapid bootstrap algorithm for the RAxML web servers. Syst Biol 57(5): 758–771.

STAMATAKIS A. 2014. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30(9): 1312–1313.

SWOFFORD DL. 2003. PAUP*: Phylogenetic Analysis Using Parsimony (*and Other Methods), Version 4. Sunderland, MA: Sinauer Associates.

TAMURA K. 1999. TreeExplorer. Retrieved from: http://evol.gen.biol.metro-u.ac.jp/TE/TE_man.html

TAVARE S. 1986. Some probabilistic and statistical problems in the analysis of DNA sequences. In: Some mathematical questions in biology – DNA sequence analysis. Providence, RI: American Mathematical Society. p. 57–86.

THOMPSON J, HIGGINS D, GIBSON T. 1994. Clustal W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22(22): 4673–4680.

VIRGILIO M, BACKELJAU T, NEVADO B, MEYER MD. 2010. Comparative performances of DNA barcoding across insect orders. BMC Bioinformatics 11: 206.

WARD RD, COSTA FO, HOLMES BH, STEINKE D. 2008. DNA barcoding of shared fish species from North Atlantic and Australasia: minimal divergence for most taxa, but Zeus faber and Lepidopus caudatus each probably constitute two species. Aquat. Biol. 3: 71–78.

WATANABE Y, CHIBA S. 2001. High within-population mitochondrial DNA variation due to microvariance and population mixing in the land snail Euhadra quaesita (Pulmonata: Bradybaenidae). Mol Ecol 10: 2635–2645.

WOODRUFF DS, GOULD SJ. 1987. Fifty years of interspecific hybridization: Genetics and morphometrics of a controlled experiment on the land snail Cerion in the Florida Keys. Evolution 41(5): 1022–1045.

XIA X. 2013. DAMBE5: A comprehensive software package for Data Analysis in Molecular Biology and Evolution. Mol Biol Evol 30(7): 1720–1728.

XIA X. 2017. DAMBE6: New tools for microbial genomics, phylogenetics, and molecular evolution. J Hered 108(4): 431–437.

XIA X, LEMEY P. 2009. Assessing substitution saturation with DAMBE. In: The phylogenetic handbook: a practical approach to DNA and protein phylogeny, 2nd ed. Lemey P, Salemi M, Vandamme A eds. Cambridge: Cambridge University Press. p. 615–630.

XIA X, XIE Z, SALEMI M, CHEN L, WANG Y. 2003. An index of substitution saturation and its application. Mol Phylogenet Evol 26(1): 1–7.


12

Figure II. Maximum likelihood tree showing the species of Aegistinae sister to the Chloraea clade. Values on nodes represent ML bootstraps based on 1000 bootstrap samples; values less than 50% are not shown. The scale bar represents five substitutions for every 10 nucleotides.

Figure I. Maximum likelihood tree with GenBank numbers of all novel sequences in this study. Values on nodes represent ML bootstraps based on 1000 bootstrap samples; values less than 50 % are not shown. The scale bar represents five substitutions for every ten nucleotides.

APPENDIX


13

cytochrome c oxidase subunit 1 (coi) profile of the...

Documents