cytokine gene polymorphisms associated with...

CYTOKINE GENE POLYMORPHISMS ASSOCIATED WITH RESISTANCE VS.

SUSCEPTIBILITY TO REINFECTION WITH SCHISTOSOMA MANSONI

by

MICHAEL R. GATLIN

(Under the Direction of Daniel G. Colley)

ABSTRACT

The immunologic findings that most consistently correlate with resistance in human

schistosomiasis are high levels of IgE and low levels of IgG4. We have genotyped gene and

promoter polymorphisms of cytokines associated with regulation of these isotypes in a cohort of

men occupationally exposed to Schistosoma mansoni in western Kenya and evaluated their

patterns with respect to resistance and susceptibility to reinfection after treatment and cure with

praziquantel (PZQ).

In this cohort, polymorphisms in IL-4 (−590T high IgE), IL-13 (−1055T high producer)

and IFN-γ (+874A high producer) demonstrated several correlations with resistance to

reinfection. Resistance to reinfection was significantly correlated with the heterozygous IL-4

−590 genotype C/T (OR 3.5, [CI 1.2, 10.2]) compared to T/T. Among men with a homozygous

IL-13 genotype CC/TT, having a T allele at the IFN-γ +874 position increased the odds of

resistance relative to individuals with the IFN-γ +874 A/A genotype (OR=17.5 [CI 3.0, 101.5]).

Among men with homozygous A/A IFN-γ genotype, the heterozygous IL-13 genotype C/T was

associated with resistance relative to the homozygous C/C or T/T genotypes (OR=22.5 [CI 3.5,

144.4]). No increases in odds of resistance were found in relation to the IL-13 genotype among

those with a T allele in the IFN-γ gene or in relation to the IFN-γ genotype among those with a

heterozygous IL-13 genotype. Calculation of the attributable proportion of resistance showed a

significant synergistic interaction between IL-13 −1055 C/T and IL-4 −590 C/T.

The identified polymorphisms do not by themselves confer resistance or susceptibility,

but we propose that these genotypes allow the resistant phenotype to be developed and expressed

upon suitable immune exposure. Based on the literature, these polymorphisms contribute to the

regulation of their respective cytokines, likely leading to downstream differences in the

production and interrelationships of critical defense mechanisms.

INDEX WORDS: Schistosoma mansoni, polymorphism, resistance, cytokine



by

MICHAEL R. GATLIN

B.S., University of Georgia, 2002

A Dissertation Submitted to the Graduate Faculty of The University of Georgia in Partial

Fulfillment of the Requirements for the Degree

DOCTOR OF PHILOSOPHY

ATHENS, GEORGIA

2009

© 2009

Michael R. Gatlin

All Rights Reserved



by

MICHAEL R. GATLIN

Major Professor: Daniel G. Colley

Committee: Anna Karls Rick Tarleton Duncan Krause Rob Maier

Electronic Version Approved: Maureen Grasso Dean of the Graduate School The University of Georgia May 2009

iv

DEDICATION

To my wife, Pamela for her patience, love, understanding, and support.

v

ACKNOWLEDGEMENTS

I would like to thank Dr. Daniel Colley for the guidance, support, and patience he offered

throughout my graduate career. I would also like to thank my committee, Dr. Anna Karls, Dr.

Rob Maier, Dr. Rick Tarleton, and Dr. Duncan Krause for their guidance, constructive criticism,

and support. Additionally, thanks to my lab group for their help in the countless everyday

endeavors needed to complete this project. Furthermore, I would like to thank Dr. Karanja and

Dr. Mwinzi at Kenya Medical Research Institute for the great work they do with the study site

and the help they provided me. Dr. Carla Black had the unenviable task of teaching me the

statistics used in this project for which I am indebted to her. And finally, I would like to thank

my wife, my mother, and my father for their sacrifices, love and support.

vi

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS .............................................................................................................v

LIST OF TABLES ....................................................................................................................... viii

LIST OF FIGURES ....................................................................................................................... ix

CHAPTER

1 Introduction and Literature Review ...............................................................................1

History .......................................................................................................................1

Life-cycle ...................................................................................................................1

Control .......................................................................................................................2

Immunology and pathology of schistosomiasis ........................................................3

Resistance ..................................................................................................................5

Polymorphisms in cytokine genes and promoter regions ........................................10

Purpose ....................................................................................................................12

References ...............................................................................................................13

2 Association of Gene Polymophisms IFN-γ +874, IL-13 -1055, and IL-4 -590 with

Patterns of Reinfection with Schistosoma masoni ..................................................26

Abstract ...................................................................................................................27

Author summary ......................................................................................................28

Introduction .............................................................................................................28

vii

Materials and Methods ............................................................................................31

Results .....................................................................................................................36

Discussion ...............................................................................................................39

References ...............................................................................................................44

3 Additional Immunological Relationships ....................................................................52

Methods ...................................................................................................................52

Results .....................................................................................................................58

References ...............................................................................................................66

4 Conclusions and Potential Future Works .....................................................................68

References ...............................................................................................................75

viii

LIST OF TABLES

Page

Table 2.1: IFN-γ +874, IL-13 -1055, IL-13 +130, IL-13 -591, IL-4 -590, IL-10 -1082, IL-10 -

819 and IL-10 -592 genotype distributions and percentage of resistance .....................41

Table 2.2: Odds ratios for the associations between individual genotypes and resistance to

reinfection by univariate and multivariate analysis .......................................................42

Table 2.3: Odds ratios for the associations between genotype and resistance within categories of

genotype interaction ......................................................................................................43

ix

LIST OF FIGURES

Page

Figure 1.1: Possible mechanisms of schistosome immunity ..........................................................8

Figure 3.2: SWAP specific stimulation of IL-13 separated by genotypes for the IL-13 -1055

SNP ............................................................................................................................... 61

Figure 3.3: SWAP specific stimulation of IL-13 separated by genotypes for the IL-13 -1055

SNP ................................................................................................................................62

Figure 3.4: Linear regression of levels of SWAP-specific IgG3 and SWAP specific stimulation

of IFN-γ .........................................................................................................................63

Figure 3.5: PHA stimulated IL-10 production by predicted phenotypes ......................................64

Figure 3.6: PHA stimulated IL-10 production by predicted phenotypes ......................................65

Figure 4.7: Possible mechanisms of resistance including SNPs ...................................................73

1

Chapter 1

Introduction and Literature Review

History Human schistosomiasis, originally named bilharzias after Theodore Bilharz who

purportedly first described the disease in 1851 in Cairo, Egypt (62), is a parasitic disease of

humans caused by five different species of blood flukes of the genus Schistosoma that belong to

the class Trematoda. However, schistosomiasis is a quite ancient disease. Schistosome eggs

have been found in Chinese and Egyptian mummies that date back thousands of years (53, 70).

In fact, Katayama syndrome (acute schistosomiasis) was described in 1847 by a group of

Japanese workers (70). Most human schistosomiasis is caused by Schistosoma mansoni,

Schistosoma haematobium, or Schistosoma japonicum, while Schistosoma intercalatum and

Schistosoma mekongi can infect humans but are much less prevelant. S. mansoni, S. japonicum,

S. intercalatum and S. mekongi reside in the mesenteric venules as adult worms, while S.

heamatobium adults live in the venous plexus surrounding the urinary bladder (16). Over 200

million individuals are affected by schistosomiasis around the world, but it is mostly found in

tropical regions of Africa, with some cases still in South America, China, the Philippines, the

Middle East and the Caribbean (16). Schistosoma mansoni infects more than 83 million humans

making it one of the more prevalent infecting species of the genus (20). Five to ten percent of

those infected develop the life-threatening symptoms of the disease, while tens of millions more

suffer more subtle morbidity (42).

Life-cycle

2

In 1915 Leiper showed that Biomphalaria snails transmit S. mansoni (63) and the life

cycles were fully described around 1920 (86). The infectious form of S. mansoni (cercaria) is

shed from Biomphalaria spp. during the peak hours of daylight into fresh water where the

cercariae swim about for up to 24 hours in search of its human host. The infection is acquired in

humans during contact with fresh water through penetration of the skin by the cercariae. The

cercariae burrow through the skin and enter the blood. The immature worms (called

schistosomules) circulate and proceed to the hepatic portal system where they mature in about 4

to 6 weeks. Male and female schistosomes mate in the mesenteric venules; the female fitting

into the male’s gynecophoric canal. En copula in the blood stream, they feed and produce fertile

eggs which leave the human host by defecation. Once in fresh water the eggs hatch and the

miracidia infect the appropriate snail species, where they undergo asexual replication producing

cercariae. The cercariae exit the snail 4 to 6 weeks after initial infection. On average, the S.

mansoni adults will live in the mesenteric venules for 5 to 10 years (16, 35).

Control

Chemotheraputic drug research for schistosomiasis began in the 1920’s (41, 59, 66).

Early strategies for control focused on snail elimination although Tartar emetic was used for

therapeutic treatment from the 1920’s until the 1970’s (70). However, this treatment was

administered in long, painful courses of injections with side effects that made its use only

appropriate in severe disease. In the 1950’s molluscicides began to be used for intervention.

Molluscicides were used as a means of control in South America, Asia and Africa but proved

only to minimize transmission (69), and were both toxic to the environment and expensive.

In 1984 Praziquantel (antiparasitic drug developed for veterinary use in the 1970’s)

became widely available, albeit expensive, and WHO passed a resolution to move toward

3

chemotherapy as a means of control (59). Praziquantel has been shown to interfere with calcium

homeostasis and disrupt the schistosomal tegument (7, 32, 51). Praziquantel is presently the

drug of choice for control of schistosomiasis and is now down in price to about $0.25 per

treatment. Now, WHO’s primary aim is to reduce morbidity through keeping lower burdens of

infection by mass drug administrations. Combination of large scale chemotherapy and

socioeconomic improvement have helped to reduce schistosomiasis and its impact in several

locations such as Egypt, China, Puerto Rico, and Saudi Arabia (35). Through the

Schistosomiasis Control Initiative and the Partners for Parasite Control Consortium as well as

others, mass treatment as a means of control now has been extended to sub-Saharan Africa with

a target set at providing 75% of at-risk school children by 2010 (35). This program is in now

operative in Mali, Tanazania, Uganda, Niger and Burkina Faso presently and provides curative

annual doses of praziquantel as a means of reducing morbitity. It seems the best strategy to date

has been the effort in Japan. Schistosomiasis transmission has been eliminated due to treatment,

sanitation improvements, safe water supplies, education, and (probably just as importantly) the

will of the government to participate.

Immunology and Pathology of Schistosomiaisis

As stated previously, male and female worms of S. mansoni live in the mesenteric

venules where they feed and produce several hundred eggs per day. These eggs normally pass

through the vessel wall and the gut wall into the feces of the infected individual. However some

of the eggs go via the portal system and impact in the presinusoidal capillaries of the liver, while

others can be shunted into the lungs. When deposited in the tissues, these eggs and their

secretions provoke a granulomatous response that leads to fibrosis in the portal vein and its

tributaries, hypertension, organomegaly, and ultimately bleeding from esophageal varices.

4

Consequently, it is the eggs not the worms themselves to which most of the chronic pathology

associated with S. mansoni infection is attributed. While the aforementioned conditions in

chronic infection are the most severe sequela, there are other more “subtle morbidities” that are

now receiving more attention from researchers in the field. These include but are not limited to:

fatigue, anaemia, malnutrition, and impaired cognitive development (65). Much research has

been undertaken to study the immunopathology of chronic schistosomiasis in murine models and

in humans.

Schistosomiasis mansoni can be classified into two “types” of the disease; acute

schistosomiasis and chronic schistosomiasis. Acute schistosomiasis usually occurs in individuals

who travel to an endemic area with no prior exposure and is generally characterized by fever,

diarrhea, coughing, joint pain, eosinophilia and high cellular immune responses to schistosome

antigens (12). Chronic schistosomiasis occurs more often in people resident in endemic areas

and has a more regulated immune response. The humoral response to worm and egg antigen

offer no distinguishing characteristics other than high levels of IgG and IgM to keyhole limpet

haemocyanin (KLH). The level of antibody production to KLH can be used as a diagnostic to

differentiate between acute (high) and chronic (low) schistosomiasis (4, 58). Greater

distinquishing characteristics between acute and chronic schistosomiasis rest in the cellular

responses.

Acute schistosomiasis is characterized by a high peripheral blood mononuclear cell

response to soluble egg antigens (SEA) in vitro when compared to chronic schistosomiasis.

Furthermore, it was shown that in 16 patients with acute schistosomiasis studied 2 to 3 months

after exposure to cercariae, peripheral blood eosinophilias and total leukocyte levels were

elevated when compared to chronic patients (28). However, these eosinophilias were decreased

5

in acute patients when compared to chronic patients after chemotherapy. Total T and B cell

population percentages were not altered during acute infection. However, acute patients were

shown to have lymphoid subsets CD4+ and CD8+ at elevated levels in a lymphoid subset analysis

(28). Cytokine profiles also show a marked difference when comparing acute and chronic

schistosmiasis. Patients with acute infection have been shown to produce significantly higher

levels of IFN-γ to stimulation with SEA and soluble worm antigen preparation (SWAP) than

patients with chronic infections (52). Acute patients show higher levels of IL-5 production when

stimulated with SEA in comparison to lower levels of IL-5 production in chronic individuals

(52). The acute phase seems to be a mixed expression of both Th1 (robust expression early) and

Th2 cytokines (12). Early in acute infection there is a robust expression of IFN-γ and TNF-α

that diminishes in production over time. Conversely, expression of IL-4 and IL-10 shows weak

expression early on but becomes more robust later in the infection (12).

Resistance

With the exception of travelers acquiring schistosomiasis when visiting endemic areas,

infection is usually acquired during early childhood by those living in those areas. The infection

generally persists for many years due to frequent reinfections or chronicity. Intensity and

prevalence of infection seems to be highest in adolescence and decline thereafter. Treatment

with praziquantel is highly efficacious in curing schistosomiasis, but reinfection is very common

due to continued exposure in high risk areas. However, after successful treatment and cure, the

length of time to and intensity of reinfection varies markedly. Longer periods of time to

reinfection and lower levels of infection intensity upon reinfection are generally considered

indicators of resistance (39, 74). Furthermore, one of the more common findings with regard to

resistance is that there is a marked age-related difference between resistant and susceptible

6

individuals (9, 10, 54, 82, 83). While debate continues, most literature suggests that there is an

immunologic basis for this phenomenon (36, 44, 61, 74, 85), as opposed to just an epidemiologic

explanation.

There have been many studies of resistance to schistosomes in humans that have

followed the most common protocol of the treatment/reinfection design. This protocol involves

a documented case of schistosomiasis, treatment and cure, and examination at a later date to see

if reinfection occurred (10, 25, 46, 54, 82). These studies vary in examination over time vs. a

final examination at a given time, and evaluation of positives vs. negatives, as opposed to

measuring the intensity of infection by the number of eggs per gram of feces. Another protocol

used in these studies follows the infection status and the exposure pattern of people in a

community that are exposed, but do not have a detectable infection. These people (termed

“endemic normals”) are then compared to people with comparable epidemiologic settings who

have a detectable infection (8, 19, 25, 38, 76, 77). Both of these protocols require water exposure

documentation; this is usually accomplished by questionnaire or observation of the water

exposure of these people at a certain site at certain times. Because of the difficulties associated

with acquiring comprehensive water exposure data and its necessity to adequately interpret the

data generated from these study designs, a method of acquiring exposure data that assures a

higher level of confidence would be desirable.

There is evidence that both Th1 and Th2 type responses play a role in development of

resistance to reinfection with schistosomes in both human and mouse studies (5, 11, 30, 68).

There is strong evidence in both rats and humans that antibody-dependent cell-mediated

cytotoxicity (ADCC) plays a pivotal role in killing schistosmules in vitro (11, 15). Given that

IgE (30) and eosinophils (21) are important in schistosomular killing and the influence of IL-4

7

and IL-5 on development eosinophils and IgE (17, 18, 45), these studies suggest a role for Th2

type responses in contributing to resistance to reinfection. Studies using irradiated cercariae

show that mice receiving one exposure with these cercariae establish a partial immunity to

subsequent challenges. This partial immunity is abrogated by neutralization of IFN-γ (68) and

impaired by the absence of IL-12 (5). Furthermore, it has been reported that activated

macrophages and endothelial cells can kill schistosomula by release of nitric oxide (55, 87).

These studies suggest a role for Th1 type responses in contributing to resistance to reinfection.

Overall, it is more plausible that both Th1 and Th2 play roles in increasing the time to reinfection

and/or decreasing the intensities of infection after curative treatment. Some possible

mechanisms are shown in figure 1.

8

Fig. 1.1. Possible mechanisms of schistosome immunity. Mice studies suggest that CD4+ T helper Th1-cell-mediated effector mechanisms involving IgG and interferon γ–tumor necrosis factor-activated macrophages (Mø) and/or endothelial cells (EC) dominate the protective response induced by the irradiated cercariae vaccine and may participate in parasite elimination via production of nitric oxide. In contrast, rat and epidemiological human populations studies suggest that Th2-mediated effector mechanisms involving IgA, IgE and eosinophils (EOS) can lead to the development of acquired immunity. Here, antibody-dependent cellular cytotoxicity (ADCC) mechanisms are likely contributors in parasite elimination. Figure and caption modified from (87)

CD-4+ CD-4+

Th1 mechanisms Th2 mechanisms

9

Of all the immunologic findings associated with such studies, the most agreed upon

finding is that resistance (usually lower levels of infection) often correlates with high IgE and

low IgG4 antibodies against a variety of schistosome antigens (13, 23, 29, 30, 33, 34, 36, 47, 61,

64, 72, 79, 80, 88). Also, in most of these treatment/reinfections studies, production of IFN-γ

and IL-5 to schistosome antigens was also shown to correlate with this partial resistance (8, 27,

60, 77), although some studies suggest only IL-4 and IL-5 correlate with resistance (50).

Over a six-year period Karanja et al. established a study of the epidemiology of

schistosomiasis with a cohort in Kisumu, Kenya (39). The ability to collect water contact (i.e.

exposure) data throughout this study was unique, and allowed differential exposure to be ruled

out as a confounding variable. The number of potential exposures to S. mansoni could be

accounted for because records are kept as to the number of times an individual enters the water

to wash a car for payment purposes. This coupled with frequent (every 4 weeks) stool

examinations, allows a unique opportunity to study incidence and the intensities of reinfection

(39). Karanja et al. found that the number of reinfections increased with the number of cars

washed or water exposure, but leveled off at thirty exposures per week (39). Furthermore, since

it has been hypothesized that praziquantel-induced worm death is associated with development

of resistance to reinfection (25, 67, 84), the investigators also examined the effect of reinfection

and retreatment on the time to reinfection (39). They found that persons who acquired no or one

reinfection after initial treatment had an average of 91 weeks to reinfection. Persons having 2 to

5 reinfections had the much shorter time of only 15 weeks to their initial reinfection, but their

average time to reinfection was 38 weeks for their 2nd to 5th reinfection (39). Also, persons with

6 to 10 reinfections had a short time to initial reinfection, but had a mean time to reinfection of

29 weeks for their 6 to 10 reinfection (39).

10

Genetic studies have also been performed on resistance and susceptibility to

schistosomiasis in humans. A genetic region (called SM1) has been identified that correlates

strongly to the level of infection in humans (24). SM1 maps to chromosome 5 in the 5q31-q33

region that contains several known immune response regulating genes (48, 49). These genes

code for proteins that are associated with the regulation of Th1/Th2 differential responses and

serum IgE levels such as IL-3, IL-4, IL-5, IL-9, IL-13, and immune regulatory factor1 (IRF-1)

(48, 49). IL-4 and IL-13 are associated with IgE production and are required for IgG4 switching

(22, 31, 57). IFN-γ promotes IgG4 production and down regulates production of IgE (1, 3). IL-

10 leads to a decrease in IgE levels and an increase in IgG4 levels (2).

Polymorphisms in cytokine genes and promoter regions

There have been contradictory reports on the effect the IL-4 -590C/T (rs 2243250)

polymorphism has on IgE levels in different settings. One group found that infants with a IL-4

-590 C allele had a higher risk of elevated IgE in their cord blood (81). However, it was also

reported that total IgE levels were significantly elevated in children with severe malaria carrying

the -590T allele (75). It is well known that IL-4 plays an important role in IgE class switching (6)

and reports that the -590 C/T polymorphism are associated with differing amounts of IgE made it

a candidate for this study.

Kouriba, et al. reported that IL-13 -1055C (rs 1800925) and -591A (rs 2069743) were

associated with the upper 10% infection levels in individuals infected with S. haematobium

(susceptibility) (43). Van der Pouw Kraan et al. described an NF-AT binding site at IL-13 -1055

that showed increased binding of nuclear proteins with the T allele (73). Furthermore, it was

reported that transcription of the IL-13 -1055T allele was enhanced in Th2 polarized CD4+ cells,

11

but not in nonpolarized (i.e., Th0) CD4+ T cells (14). Thus, the IL-13-1055 polymorphism, and

possibly -591, could be important in resistance to S. mansoni. The R130Q SNP (G/A) (rs 20541)

in IL-13 causes a replacement of arginine with glutamine in α helix D, a region involved in IL-13

interactions with IL-13 receptors (78). The glutamine variant has been associated with increased

levels of total serum IgE (31) and atopy (37). It has also been shown that soluble IL-13Rα2 (an

IL-13 decoy receptor) neutralizes the arginine variant more effectively than the glutamine variant

(78). This may suggest a possible feedback mechanism that could account for increased total

serum IgE in the glutamine variant.

While most studies have found that Th2 responses are associated with resistance to

reinfection with schistosomiasis, other studies found that IFN-γ production correlates to

resistance (8, 27, 60). Pravica et al. showed that the + 874T (rs 2430561) allele corresponds with

high production of IFN-γ and that the A/T site coincides with a putative NF-kappa B binding site

(56). These studies prompted us to include the IFN-γ +874 polymorphism in our study.

IL-10 has been shown to influence IgE and IgG4 production (1). Differential production

of IL-10 has been shown to be associated with different allelic variants of the IL-10 promoter (-

1082 A/G [rs 1800896], -819 T/C [rs 1800871], and -592 A/C [rs 1800872]). The different

haplotypes that have been associated with production of IL-10 are as follows: “high” IL-10

producer haplotype (GCC/GCC), “intermediate” producer haplotypes (GCC/ACC, GCC/ATA),

and “low” producer haplotypes (ATA/ATA, ACC/ATA, ACC/ACC) (26). Indeed, the

ATA/ATA haplotype has been associated with increased eosinophil counts and circulating IgE in

adult asthma when compared to the other possible haplotypes (40). However, the group that first

described these polymorphisms conclude that high IL-10 production was dependant on having a

12

G in the -1082 position independent of the -819 and -592 polymorphisms (71). Furthermore,

Ruess et al. has shown that -1082A binds PU.1, which can inhibit gene transcription.

Purpose

The purpose of this project was to test the relationships of genetic polymorphisms likely

to be associated with resistance or susceptibility to reinfection in the well-characterized resistant

and susceptible cohort of carwashers originally studied by Karanja et al (39). These

polymorphisms include single nucleotide polymorphisms (SNPs) in the gene or promoter region

of cytokines that have been found to be associated with resistance and that are pivotal in

controlling development and expression of IgE and IgG4. First, we wanted to see if these

polymorphisms were different between men who were resistant to reinfection versus those that

were not. Next, we were interested in evaluating the different polymorphisms and any possible

relationships with production of the cytokine that the polymorphism resides in upon stimulation

with various schistosomal antigens and mitogens. We also were interested in SWAP-specific

antibody isotypes and any possible relationship between isotype levels and SNPs in cytokine

genes/promoters that are important in development of IgE and IgG4 in an immune response. This

study allowed us to evaluate these polymorphisms in relation to reinfection by S. mansoni with a

study design that afforded remarkably reliable exposure data which, as mentioned previously, is

an aspect of these types of studies that usually presents a confounding variable.

13

References

1. Akdis, C. A., T. Blesken, M. Akdis, S. S. Alkan, B. Wuthrich, C. H. Heusser, and K.

Blaser. 1997. Induction and differential regulation of bee venom phospholipase A2-

specific human IgE and IgG4 antibodies in vitro requires allergen-specific and

nonspecific activation of T and B cells. J Allergy Clin Immunol 99:345-53.

2. Akdis, C. A., T. Blesken, M. Akdis, B. Wuthrich, and K. Blaser. 1998. Role of

interleukin 10 in specific immunotherapy. J Clin Invest 102:98-106.

3. Akdis, M., C. A. Akdis, L. Weigl, R. Disch, and K. Blaser. 1997. Skin-homing, CLA+

memory T cells are activated in atopic dermatitis and regulate IgE by an IL-13-dominated

cytokine pattern: IgG4 counter-regulation by CLA- memory T cells. J Immunol

159:4611-9.

4. Alves-Brito, C. F., A. J. Simpson, L. M. Bahia-Oliverira, A. L. Rabello, R. S. Rocha,

J. R. Lambertucci, G. Gazzinelli, N. Katz, and R. Correa-Oliveira. 1992. Analysis of

anti-keyhole limpet haemocyanin antibody in Brazilians supports its use for the diagnosis

of acute schistosomiasis mansoni. Trans R Soc Trop Med Hyg 86:53-6.

5. Anderson, S., V. L. Shires, R. A. Wilson, and A. P. Mountford. 1998. In the absence

of IL-12, the induction of Th1-mediated protective immunity by the attenuated

schistosome vaccine is impaired, revealing an alternative pathway with Th2-type

characteristics. Eur J Immunol 28:2827-38.

6. Bacharier, L. B., and R. S. Geha. 2000. Molecular mechanisms of IgE regulation. J

Allergy Clin Immunol 105:S547-58.

14

7. Becker, B., H. Mehlhorn, P. Andrews, and H. Thomas. 1981. Ultrastructural

investigations on the effect of praziquantel on the tegument of five species of cestodes. Z

Parasitenkd 64:257-69.

8. Brito, C. F., I. R. Caldas, P. Coura Filho, R. Correa-Oliveira, and S. C. Oliveira.

2000. CD4+ T cells of schistosomiasis naturally resistant individuals living in an endemic

area produce interferon-gamma and tumour necrosis factor-alpha in response to the

recombinant 14KDA Schistosoma mansoni fatty acid-binding protein. Scand J Immunol

51:595-601.

9. Butterworth, A. E. 1998. Immunological aspects of human schistosomiasis. Br Med

Bull 54:357-68.

10. Butterworth, A. E., M. Capron, J. S. Cordingley, P. R. Dalton, D. W. Dunne, H. C.

Kariuki, G. Kimani, D. Koech, M. Mugambi, J. H. Ouma, and et al. 1985. Immunity

after treatment of human schistosomiasis mansoni. II. Identification of resistant

individuals, and analysis of their immune responses. Trans R Soc Trop Med Hyg 79:393-

408.

11. Butterworth, A. E., R. F. Sturrock, V. Houba, A. A. Mahmoud, A. Sher, and P. H.

Rees. 1975. Eosinophils as mediators of antibody-dependent damage to schistosomula.

Nature 256:727-9.

12. Caldas, I. R., A. C. Campi-Azevedo, L. F. Oliveira, A. M. Silveira, R. C. Oliveira,

and G. Gazzinelli. 2008. Human schistosomiasis mansoni: immune responses during

acute and chronic phases of the infection. Acta Trop 108:109-17.

13. Caldas, I. R., R. Correa-Oliveira, E. Colosimo, O. S. Carvalho, C. L. Massara, D. G.

Colley, and G. Gazzinelli. 2000. Susceptibility and resistance to Schistosoma mansoni

15

reinfection: parallel cellular and isotypic immunologic assessment. Am J Trop Med Hyg

62:57-64.

14. Cameron, L., R. B. Webster, J. M. Strempel, P. Kiesler, M. Kabesch, H.

Ramachandran, L. Yu, D. A. Stern, P. E. Graves, I. C. Lohman, A. L. Wright, M.

Halonen, W. T. Klimecki, and D. Vercelli. 2006. Th2 cell-selective enhancement of

human IL13 transcription by IL13-1112C>T, a polymorphism associated with allergic

inflammation. J Immunol 177:8633-42.

15. Capron, M., H. Bazin, M. Joseph, and A. Capron. 1981. Evidence for IgE-dependent

cytotoxicity by rat eosinophils. J Immunol 126:1764-8.

16. Chitsulo, L., P. Loverde, and D. Engels. 2004. Schistosomiasis. Nat Rev Microbiol

2:12-3.

17. Coffman, R. L., J. Ohara, M. W. Bond, J. Carty, A. Zlotnik, and W. E. Paul. 1986. B

cell stimulatory factor-1 enhances the IgE response of lipopolysaccharide-activated B

cells. J Immunol 136:4538-41.

18. Coffman, R. L., B. W. Seymour, S. Hudak, J. Jackson, and D. Rennick. 1989.

Antibody to interleukin-5 inhibits helminth-induced eosinophilia in mice. Science

245:308-10.

19. Correa-Oliveira, R., E. J. Pearce, G. C. Oliveira, D. B. Golgher, N. Katz, L. G.

Bahia, O. S. Carvalho, G. Gazzinelli, and A. Sher. 1989. The human immune response

to defined immunogens of Schistosoma mansoni: elevated antibody levels to paramyosin

in stool-negative individuals from two endemic areas in Brazil. Trans R Soc Trop Med

Hyg 83:798-804.

16

20. Crompton, D. W. 1999. How much human helminthiasis is there in the world? J

Parasitol 85:397-403.

21. David, J. R., M. A. Vadas, A. E. Butterworth, P. A. de Brito, E. M. Carvalho, R. A.

David, J. C. Bina, and Z. A. Andrade. 1980. Enhanced helminthotoxic capacity of

eosinophils from patients with eosinophilia. N Engl J Med 303:1147-52.

22. Del Prete, G., E. Maggi, P. Parronchi, I. Chretien, A. Tiri, D. Macchia, M. Ricci, J.

Banchereau, J. De Vries, and S. Romagnani. 1988. IL-4 is an essential factor for the

IgE synthesis induced in vitro by human T cell clones and their supernatants. J Immunol

140:4193-8.

23. Demeure, C. E., P. Rihet, L. Abel, M. Ouattara, A. Bourgois, and A. J. Dessein.

1993. Resistance to Schistosoma mansoni in humans: influence of the IgE/IgG4 balance

and IgG2 in immunity to reinfection after chemotherapy. J Infect Dis 168:1000-8.

24. Dessein, A. J., C. Chevillard, S. Marquet, S. Henri, D. Hillaire, and H. Dessein. 2001.

Genetics of parasitic infections. Drug Metab Dispos 29:484-8.

25. Dunne, D., Mountford, A. 2001. Resistance to infection in humans and animal models,

p. 133-212. In A. Mahmoud (ed.), Schistosomiasis. Imperial College Press, London, UK.

26. Edwards-Smith, C. J., J. R. Jonsson, D. M. Purdie, A. Bansal, C. Shorthouse, and E.

E. Powell. 1999. Interleukin-10 promoter polymorphism predicts initial response of

chronic hepatitis C to interferon alfa. Hepatology 30:526-30.

27. El Ridi, R., F. Farouk, M. Sherif, M. Al-Sherbiny, A. Osman, N. El Gengehi, and C.

B. Shoemaker. 1998. T and B cell reactivity to a 42-kDa protein is associated with

human resistance to both schistosomiasis mansoni and haematobium. J Infect Dis

177:1364-72.

17

28. Gazzinelli, G., J. R. Lambertucci, N. Katz, R. S. Rocha, M. S. Lima, and D. G.

Colley. 1985. Immune-Responses during Human Schistosomiasis Mansoni .11.

Immunological Status of Patients with Acute Infections and after Treatment. Journal of

Immunology 135:2121-2127.

29. Gomes, Y. M., F. C. Gomes, V. C. Furtado, K. M. Teixeira, W. V. Souza, and F. G.

Abath. 1998. IgE and IgG4 antibodies in subjects reinfected with Schistosoma mansoni

in an endemic area of northeast Brazil. Mem Inst Oswaldo Cruz 93 Suppl 1:183-4.

30. Gounni, A. S., B. Lamkhioued, K. Ochiai, Y. Tanaka, E. Delaporte, A. Capron, J. P.

Kinet, and M. Capron. 1994. High-affinity IgE receptor on eosinophils is involved in

defence against parasites. Nature 367:183-6.

31. Graves, P. E., M. Kabesch, M. Halonen, C. J. Holberg, M. Baldini, C. Fritzsch, S. K.

Weiland, R. P. Erickson, E. von Mutius, and F. D. Martinez. 2000. A cluster of seven

tightly linked polymorphisms in the IL-13 gene is associated with total serum IgE levels

in three populations of white children. J Allergy Clin Immunol 105:506-13.

32. Greenberg, R. M. 2005. Are Ca2+ channels targets of praziquantel action? Int J

Parasitol 35:1-9.

33. Grogan, J. L., P. G. Kremsner, G. J. van Dam, A. M. Deelder, and M.

Yazdanbakhsh. 1997. Anti-schistosome IgG4 and IgE at 2 years after chemotherapy:

infected versus uninfected individuals. J Infect Dis 176:1344-50.

34. Grogan, J. L., P. G. Kremsner, G. J. van Dam, W. Metzger, B. Mordmuller, A. M.

Deelder, and M. Yazdanbakhsh. 1996. Antischistosome IgG4 and IgE responses are

affected differentially by chemotherapy in children versus adults. J Infect Dis 173:1242-

7.

18

35. Gryseels, B., K. Polman, J. Clerinx, and L. Kestens. 2006. Human schistosomiasis.

Lancet 368:1106-18.

36. Hagan, P., U. J. Blumenthal, D. Dunn, A. J. Simpson, and H. A. Wilkins. 1991.

Human IgE, IgG4 and resistance to reinfection with Schistosoma haematobium. Nature

349:243-5.

37. He, J. Q., M. Chan-Yeung, A. B. Becker, H. Dimich-Ward, A. C. Ferguson, J.

Manfreda, W. T. Watson, and A. J. Sandford. 2003. Genetic variants of the IL13 and

IL4 genes and atopic diseases in at-risk children. Genes Immun 4:385-9.

38. James, S., Colley, DG. 2001. Progress in vaccine developement, p. 469-495. In A.

Mahmoud (ed.), Schistosomiasis. Imperial College Press, London, UK.

39. Karanja, D. M., A. W. Hightower, D. G. Colley, P. N. Mwinzi, K. Galil, J. Andove,

and W. E. Secor. 2002. Resistance to reinfection with Schistosoma mansoni in

occupationally exposed adults and effect of HIV-1 co-infection on susceptibility to

schistosomiasis: a longitudinal study. Lancet 360:592-6.

40. Karjalainen, J., J. Hulkkonen, M. M. Nieminen, H. Huhtala, A. Aromaa, T.

Klaukka, and M. Hurme. 2003. Interleukin-10 gene promoter region polymorphism is

associated with eosinophil count and circulating immunoglobulin E in adult asthma. Clin

Exp Allergy 33:78-83.

41. Kikuth, W., and R. Gonnert. 1948. Experimental studies on the therapy of

schistosomiasis. Ann Trop Med Parasitol 42:256-67.

42. King, C. H., K. Dickman, and D. J. Tisch. 2005. Reassessment of the cost of chronic

helmintic infection: a meta-analysis of disability-related outcomes in endemic

schistosomiasis. Lancet 365:1561-9.

19

43. Kouriba, B., C. Chevillard, J. H. Bream, L. Argiro, H. Dessein, V. Arnaud, L.

Sangare, A. Dabo, A. H. Beavogui, C. Arama, H. A. Traore, O. Doumbo, and A.

Dessein. 2005. Analysis of the 5q31-q33 locus shows an association between IL13-

1055C/T IL-13-591A/G polymorphisms and Schistosoma haematobium infections. J

Immunol 174:6274-81.

44. Kurtis, J. D., J. F. Friedman, T. Leenstra, G. C. Langdon, H. W. Wu, D. L. Manalo,

L. Su, M. Jiz, B. Jarilla, A. O. Pablo, S. T. McGarvey, R. M. Olveda, and L. P.

Acosta. 2006. Pubertal development predicts resistance to infection and reinfection with

Schistosoma japonicum. Clin Infect Dis 42:1692-8.

45. Lebman, D. A., and R. L. Coffman. 1988. Interleukin 4 causes isotype switching to IgE

in T cell-stimulated clonal B cell cultures. J Exp Med 168:853-62.

46. Li, Y. S., A. C. Sleigh, A. G. Ross, Y. Li, G. M. Williams, S. J. Forsyth, M. Tanner,

and D. P. McManus. 1999. A 2-year prospective study in China provides

epidemiological evidence for resistance in humans to re-infection with Schistosoma

japonicum. Ann Trop Med Parasitol 93:629-42.

47. Li, Z., C. L. King, J. O. Ogundipe, L. S. Licate, and R. E. Blanton. 1995. Preferential

recognition by human IgE and IgG4 of a species-specific Schistosoma haematobium

serine protease inhibitor. J Infect Dis 171:416-22.

48. Marquet, S., L. Abel, D. Hillaire, and A. Dessein. 1999. Full results of the genome-

wide scan which localises a locus controlling the intensity of infection by Schistosoma

mansoni on chromosome 5q31-q33. Eur J Hum Genet 7:88-97.

20

49. Marquet, S., L. Abel, D. Hillaire, H. Dessein, J. Kalil, J. Feingold, J. Weissenbach,

and A. J. Dessein. 1996. Genetic localization of a locus controlling the intensity of

infection by Schistosoma mansoni on chromosome 5q31-q33. Nat Genet 14:181-4.

50. Medhat, A., M. Shehata, K. Bucci, S. Mohamed, A. D. Dief, S. Badary, H. Galal, M.

Nafeh, and C. L. King. 1998. Increased interleukin-4 and interleukin-5 production in

response to Schistosoma haematobium adult worm antigens correlates with lack of

reinfection after treatment. J Infect Dis 178:512-9.

51. Mehlhorn, H., B. Becker, P. Andrews, H. Thomas, and J. K. Frenkel. 1981. In vivo

and in vitro experiments on the effects of praziquantel on Schistosoma mansoni. A light

and electron microscopic study. Arzneimittelforschung 31:544-54.

52. Montenegro, S. M., P. Miranda, S. Mahanty, F. G. Abath, K. M. Teixeira, E. M.

Coutinho, J. Brinkman, I. Goncalves, L. A. Domingues, A. L. Domingues, A. Sher,

and T. A. Wynn. 1999. Cytokine production in acute versus chronic human

Schistosomiasis mansoni: the cross-regulatory role of interferon-gamma and interleukin-

10 in the responses of peripheral blood mononuclear cells and splenocytes to parasite

antigens. J Infect Dis 179:1502-14.

53. Nunn, J. F., and E. Tapp. 2000. Tropical diseases in ancient Egypt. Trans R Soc Trop

Med Hyg 94:147-53.

54. Olveda, R. M., B. L. Daniel, B. D. Ramirez, G. D. Aligui, L. P. Acosta, P. Fevidal, E.

Tiu, F. de Veyra, P. A. Peters, R. Romulo, E. Domingo, P. M. Wiest, and G. R. Olds.

1996. Schistosomiasis japonica in the Philippines: the long-term impact of population-

based chemotherapy on infection, transmission, and morbidity. J Infect Dis 174:163-72.

21

55. Oswald, I. P., T. A. Wynn, A. Sher, and S. L. James. 1994. NO as an effector molecule

of parasite killing: modulation of its synthesis by cytokines. Comp Biochem Physiol

Pharmacol Toxicol Endocrinol 108:11-8.

56. Pravica, V., C. Perrey, A. Stevens, J. H. Lee, and I. V. Hutchinson. 2000. A single

nucleotide polymorphism in the first intron of the human IFN-gamma gene: absolute

correlation with a polymorphic CA microsatellite marker of high IFN-gamma production.

Hum Immunol 61:863-6.

57. Punnonen, J., G. Aversa, B. G. Cocks, A. N. McKenzie, S. Menon, G. Zurawski, R.

de Waal Malefyt, and J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-

independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc Natl

Acad Sci U S A 90:3730-4.

58. Rabello, A. L., M. M. Garcia, R. A. da Silva, R. S. Rocha, A. Chaves, and N. Katz.

1995. Humoral immune responses in acute schistosomiasis mansoni: relation to

morbidity. Clin Infect Dis 21:608-15.

59. Ribeiro-dos-Santos, G., S. Verjovski-Almeida, and L. C. Leite. 2006.

Schistosomiasis--a century searching for chemotherapeutic drugs. Parasitol Res 99:505-

21.

60. Ribeiro de Jesus, A., I. Araujo, O. Bacellar, A. Magalhaes, E. Pearce, D. Harn, M.

Strand, and E. M. Carvalho. 2000. Human immune responses to Schistosoma mansoni

vaccine candidate antigens. Infect Immun 68:2797-803.

61. Rihet, P., C. E. Demeure, A. Bourgois, A. Prata, and A. J. Dessein. 1991. Evidence

for an association between human resistance to Schistosoma mansoni and high anti-larval

IgE levels. Eur J Immunol 21:2679-86.

22

62. Ross, A. G., P. B. Bartley, A. C. Sleigh, G. R. Olds, Y. Li, G. M. Williams, and D. P.

McManus. 2002. Schistosomiasis. N Engl J Med 346:1212-20.

63. RT, L. 1915. Report on the reults of the bilharzia mission in Egypt. JR Army Med Corps

25:1-55

64. Satti, M. Z., P. Cahen, P. S. Skov, S. Joseph, F. M. Jones, C. Fitzsimmons, K. F.

Hoffmann, C. Reimert, C. Kariuki, F. Kazibwe, J. K. Mwatha, G. Kimani, B. J.

Vennervald, J. H. Ouma, N. B. Kabatereine, and D. W. Dunne. 2004. Changes in

IgE- and Antigen-dependent histamine-release in peripheral blood of Schistosoma

mansoni-infected Ugandan fishermen after treatment with praziquantel. BMC Immunol

5:6.

65. Secor, W. E. 2005. Immunology of human schistosomiasis: off the beaten path. Parasite

Immunol 27:309-16.

66. Shekhar, K. C. 1991. Schistosomiasis drug therapy and treatment considerations. Drugs

42:379-405.

67. Silveira, A. M., L. A. Fraga, A. Prata, R. Correa-Oliveira, D. A. Addiss, I. R. Viana,

D. G. Colley, and G. Gazzinelli. 1998. Resistance to infection/reinfection by

Schistosoma mansoni is not augmented by three treatments with 45 days intervals. Mem

Inst Oswaldo Cruz 93:113-4.

68. Smythies, L. E., P. S. Coulson, and R. A. Wilson. 1992. Monoclonal antibody to IFN-

gamma modifies pulmonary inflammatory responses and abrogates immunity to

Schistosoma mansoni in mice vaccinated with attenuated cercariae. J Immunol 149:3654-

8.

23

69. Sturrock, R., G. Barnish, and E. S. Upatham. 1974. Snail findings from an

experimental mollusciciding programme to control Schistosoma mansoni transmission on

St. Lucia. Int J Parasitol 4:231-40.

70. Sturrock, R. F. 2001. Schistosomiasis epidemiology and control: how did we get here

and where should we go? Mem Inst Oswaldo Cruz 96 Suppl:17-27.

71. Turner, D. M., D. M. Williams, D. Sankaran, M. Lazarus, P. J. Sinnott, and I. V.

Hutchinson. 1997. An investigation of polymorphism in the interleukin-10 gene

promoter. Eur J Immunogenet 24:1-8.

72. van Der Kleij, D., A. G. Tielens, and M. Yazdanbakhsh. 1999. Recognition of

schistosome glycolipids by immunoglobulin E: possible role in immunity. Infect Immun

67:5946-50.

73. van der Pouw Kraan, T. C., A. van Veen, L. C. Boeije, S. A. van Tuyl, E. R. de

Groot, S. O. Stapel, A. Bakker, C. L. Verweij, L. A. Aarden, and J. S. van der Zee.

1999. An IL-13 promoter polymorphism associated with increased risk of allergic

asthma. Genes Immun 1:61-5.

74. Vereecken, K., C. W. Naus, K. Polman, J. T. Scott, M. Diop, B. Gryseels, and L.

Kestens. 2007. Associations between specific antibody responses and resistance to

reinfection in a Senegalese population recently exposed to Schistosoma mansoni. Trop

Med Int Health 12:431-44.

75. Verra, F., G. Luoni, C. Calissano, M. Troye-Blomberg, P. Perlmann, H. Perlmann,

B. Arca, B. S. Sirima, A. Konate, M. Coluzzi, D. Kwiatkowski, and D. Modiano.

2004. IL4-589C/T polymorphism and IgE levels in severe malaria. Acta Trop 90:205-9.

24

76. Viana, I. R., R. Correa-Oliveira, S. Carvalho Odos, C. L. Massara, E. Colosimo, D.

G. Colley, and G. Gazzinelli. 1995. Comparison of antibody isotype responses to

Schistosoma mansoni antigens by infected and putative resistant individuals living in an

endemic area. Parasite Immunol 17:297-304.

77. Viana, I. R., A. Sher, O. S. Carvalho, C. L. Massara, S. M. Eloi-Santos, E. J. Pearce,

D. G. Colley, G. Gazzinelli, and R. Correa-Oliveira. 1994. Interferon-gamma

production by peripheral blood mononuclear cells from residents of an area endemic for

Schistosoma mansoni. Trans R Soc Trop Med Hyg 88:466-70.

78. Vladich, F. D., S. M. Brazille, D. Stern, M. L. Peck, R. Ghittoni, and D. Vercelli.

2005. IL-13 R130Q, a common variant associated with allergy and asthma, enhances

effector mechanisms essential for human allergic inflammation. J Clin Invest 115:747-54.

79. Webster, M., P. G. Fallon, A. J. Fulford, A. E. Butterworth, J. H. Ouma, G. Kimani,

and D. W. Dunne. 1997. IgG4 and IgE responses to Schistosoma mansoni adult worms

after treatment. J Infect Dis 175:493-4.

80. Webster, M., A. J. Fulford, G. Braun, J. H. Ouma, H. C. Kariuki, J. C. Havercroft,

K. Gachuhi, R. F. Sturrock, A. E. Butterworth, and D. W. Dunne. 1996. Human

immunoglobulin E responses to a recombinant 22.6-kilodalton antigen from Schistosoma

mansoni adult worms are associated with low intensities of reinfection after treatment.

Infect Immun 64:4042-6.

81. Wen, H. J., Y. C. Lin, Y. L. Lee, and Y. L. Guo. 2006. Association between cord blood

IgE and genetic polymorphisms of interleukin-4, the beta-subunit of the high-affinity

receptor for IgE, lymphotoxin-alpha, and tumor necrosis factor-alpha. Pediatr Allergy

Immunol 17:489-94.

25

82. Wilkins, H. A., U. J. Blumenthal, P. Hagan, R. J. Hayes, and S. Tulloch. 1987.

Resistance to reinfection after treatment of urinary schistosomiasis. Trans R Soc Trop

Med Hyg 81:29-35.

83. Wilkins, H. A., P. H. Goll, T. F. Marshall, and P. J. Moore. 1984. Dynamics of

Schistosoma haematobium infection in a Gambian community. III. Acquisition and loss

of infection. Trans R Soc Trop Med Hyg 78:227-32.

84. Woolhouse, M. E., and P. Hagan. 1999. Seeking the ghost of worms past. Nat Med

5:1225-7.

85. Woolhouse, M. E., P. Taylor, D. Matanhire, and S. K. Chandiwana. 1991. Acquired

immunity and epidemiology of Schistosoma haematobium. Nature 351:757-9.

86. Wu, G. Y., and M. H. Halim. 2000. Schistosomiasis: progress and problems. World J

Gastroenterol 6:12-19.

87. Wynn, T. A., and K. F. Hoffmann. 2000. Defining a schistosomiasis vaccination

strategy - is it really Th1 versus Th2? Parasitol Today 16:497-501.

88. Zhang, Z., H. Wu, S. Chen, L. Hu, Z. Xie, Y. Qiu, C. Su, J. P. Cao, Y. Wu, S. Zhang,

and G. Wu. 1997. Association between IgE antibody against soluble egg antigen and

resistance to reinfection with Schistosoma japonicum. Trans R Soc Trop Med Hyg

91:606-8.

26

Chapter 2

ASSOCIATION OF THE GENE POLYMORPHISMS IFN-Γ +874, IL-13 −1055 AND IL-4

−590 WITH PATTERNS OF REINFECTION WITH SCHISTOSOMA MANSONI

Gatlin, M.R., C.L. Black, P.N. Mwinzi, W.E. Secor, D.M. Karanja, and D.G. Colley 2009. PloS Neglected Tropical Diseases. 3:e375. Reprinted here with permission of publisher.

27

Abstract Background: The immunologic findings that most consistently correlate with resistance in

human schistosomiasis are high levels of IgE and low levels of IgG4. We have genotyped gene

and promoter polymorphisms of cytokines associated with regulation of these isotypes in a

cohort of men occupationally exposed to Schistosoma mansoni in western Kenya and evaluated

their patterns with respect to resistance and susceptibility to reinfection after treatment and cure

with praziquantel (PZQ).

Methodology/Principal Findings: In this cohort, polymorphisms in IL-4 (−590T high IgE), IL-

13 (−1055T high producer) and IFN-γ (+874A high producer) demonstrated several correlations

with resistance to reinfection. Resistance to reinfection was significantly correlated with the

heterozygous IL-4 −590 genotype C/T (OR 3.5, [CI 1.2, 10.2]) compared to T/T. Among men

with a homozygous IL-13 genotype CC/TT, having a T allele at the IFN-γ +874 position

increased the odds of resistance relative to individuals with the IFN-γ +874 A/A genotype

(OR=17.5 [CI 3.0, 101.5]). Among men with homozygous A/A IFN-γ genotype, the

heterozygous IL-13 genotype C/T was associated with resistance relative to the homozygous C/C

or T/T genotypes (OR=22.5 [CI 3.5, 144.4]). No increases in odds of resistance were found in

relation to the IL-13 genotype among those with a T allele in the IFN-γ gene or in relation to the

IFN-γ genotype among those with a heterozygous IL-13 genotype. Calculation of the

attributable proportion of resistance showed a significant synergistic interaction between IL-13

−1055 C/T and IL-4 −590 C/T.

Conclusions: The identified polymorphisms do not by themselves confer resistance or

susceptibility, but we propose that these genotypes allow the resistant phenotype to be developed

and expressed upon suitable immune exposure. Based on the literature, these polymorphisms

28

contribute to the regulation of their respective cytokines, likely leading to downstream

differences in the production and interrelationships of critical defense mechanisms.

Author Summary

Approximately 200 million people have schistosomiasis in parts of Africa, South America, the

Middle East, the Caribbean and Asia. Several studies of multiple treatments and reinfections

indicate that some people develop resistance to reinfection. Of all the immunologic findings

associated with such studies, the most consistent observation is that resistance (usually defined as

lower levels of infection upon reinfection) correlates with high IgE and low IgG4 antibodies

against schistosome antigens. Our studies test whether single nucleotide polymorphisms residing

in the gene or promoter regions of cytokines pivotal in controlling production of these antibody

isotypes are different amongst those that develop resistance to reinfection as opposed to those

that do not. Through genotyping of these polymorphisms in a cohort of occupationally exposed

car washers, we found that men with certain genotypic patterns of polymorphisms in IL-4, IFN-γ,

and IL-13 were significantly more likely to be resistant to reinfection than those with different

patterns. These data provide initial insights into the potential genetic foundation of propensities

of people to develop resistance to reinfection by schistosomes, and offer a basis for further

molecular studies of how these polymorphisms might work at the transcriptional and gene

product level in cells stimulated by schistosome antigens.

Introduction

There have been many studies of resistance to schistosome infections in humans

following treatment and reinfection. Such studies involve documentation of cases of

schistosomiasis, their treatment and cure, and examinations at a later date to see if reinfections

occurred(6, 11, 29, 46). Of all the immunologic findings associated with these investigations,

29

the most consistent observation is that resistance (usually defined as lower levels of infection)

correlates with high IgE and low IgG4 antibodies against schistosome antigens (7, 9, 14, 15, 17,

18, 20, 30, 36, 37, 39, 44, 47). Other studies have reported that production of IFN-γ and IL-5 to

schistosome antigens are also correlated with resistance (5, 13, 35, 42).

A genetic region (SM1) has been identified that shows a strong positive correlation to the

level of infection in humans (10). SM1 maps to chromosome 5 in the 5q31-q33 region that

contains several genes associated with immune responses (31, 32). These genes code for proteins

that are associated with the regulation of Th2-type responses such as IL-3, IL-4, IL-5, IL-9, and

IL-13 and IgE. Polymorphisms in these cytokines that lead to an increase or decrease in cytokine

levels could influence the antibody isotypes and cellular interactions that in turn may contribute

to resistance or susceptibility of individuals to reinfection with schistosomiasis.

There have been contradictory reports on the effect the IL-4 -590C/T (rs 2243250)

polymorphism has on IgE levels in different settings. One group found that infants with a IL-4

-590 C allele had a higher risk of elevated IgE in their cord blood (45). However, it was also

reported that total IgE levels were significantly elevated in children with severe malaria carrying

the -590T allele (41). It is well known that IL-4 plays an important role in IgE class switching (4)

and reports that the -590 C/T polymorphism are associated with differing amounts of IgE made it

a candidate for this study.

Kouriba, et al. reported that IL-13 -1055C (rs 1800925) and -591A (rs 2069743) were

associated with the upper 10% infection levels in individuals infected with S. haematobium

(susceptibility) (28). Van der Pouw Kraan et al. described an NF-AT binding site at IL-13 -1055

that showed increased binding of nuclear proteins with the T allele (40). Furthermore, it was

reported that transcription of the IL-13 -1055T allele was enhanced in Th2 polarized CD4+ cells,

30

but not in nonpolarized (i.e., Th0) CD4+ T cells (8). Thus, the IL-13-1055 polymorphism, and

possibly -591, could be important in resistance to S. mansoni. The R130Q SNP (G/A) (rs 20541)

in IL-13 causes a replacement of arginine with glutamine in α helix D, a region involved in IL-13

interactions with IL-13 receptors (43). The glutamine variant has been associated with increased

levels of total serum IgE (16) and atopy (21). It has also been shown that soluble IL-13Rα2 (an

IL-13 decoy receptor) neutralizes the arginine variant more effectively than the glutamine variant

(43). This may suggest a possible feedback mechanism that could account for increased total

serum IgE in the glutamine variant.

While most studies have found that Th2 responses are associated with resistance to

reinfection with schistosomiasis, other studies found that IFN-γ production correlates to

resistance (5, 13, 35). Pravica et al. showed that the + 874T (rs 2430561) allele corresponds with

high production of IFN-γ and that the A/T site coincides with a putative NF-kappa B binding site

(34). These studies prompted us to include the IFN-γ +874 polymorphism in our study.

IL-10 has been shown to influence IgE and IgG4 production (2). Differential production

of IL-10 has been shown to be associated with different allelic variants of the IL-10 promoter (-

1082 A/G [rs 1800896], -819 T/C [rs 1800871], and -592 A/C [rs 1800872]). The different

haplotypes that have been associated with production of IL-10 are as follows: “high” IL-10

producer haplotype (GCC/GCC), “intermediate” producer haplotypes (GCC/ACC, GCC/ATA),

and “low” producer haplotypes (ATA/ATA, ACC/ATA, ACC/ACC) (12). Indeed, the

ATA/ATA haplotype has been associated with increased eosinophil counts and circulating IgE in

adult asthma when compared to the other possible haplotypes (27). However, the group that first

described these polymorphisms conclude that high IL-10 production was dependent on having a

31

G in the -1082 position independent of the -819 and -592 polymorphisms (38). Furthermore,

Ruess et al. has shown that -1082A binds PU.1, which can inhibit gene transcription.

Based on these and other studies, we examined possible relationships between single

nucleotide polymorphisms in the IL-4 (-590C/T), IL-13[(-1055C/T), (-591A/G), (R130Q G/A)],

IL-10 (-1082 A/G; -819 C/T; -592 C/A), and IFN-γ (+874A/T) genes or promoters in relation to

resistance and susceptibility to schistosomiasis of a cohort of occupationally exposed adult men

many of whom we have studied longitudinally for as long as 12 years (26, 33).

Materials and Methods

Study participants

The field site for this study was the western Kenyan city of Kisumu on the shores of Lake

Victoria. S. mansoni-infected Biomphalaria sudanica snails have been identified (data

unpublished) in the area around the exposure site. The study participants were all car washers

occupationally exposed to S. mansoni as they stood in Lake Victoria, using its waters to wash

cars driven into the shallow areas of the lake. This study was performed on a total of 87 car

washers (all adult men). However, it was not possible to use all data from every individual in

every analysis; some epidemiologic data regarding infections, cures or reinfections were

insufficient or incomplete.

This investigation was approved by the Institutional Review Boards of the University of

Georgia and the Centers for Diseases Control and Prevention, the Scientific Steering Committee

of the Kenya Medical Research Institute (KEMRI), and the National Ethics Review Committee

of Kenya. After obtaining written informed consent and enrolling the participants, we examined

their stools for S. mansoni eggs and for other helminth ova by the modified Kato-Katz method

(Vestergaard-Frandsen, Denmark). In most instances, this involved 2 slides per stool specimen

32

from 3 stool specimens over a one week period. The participants who were positive for S.

mansoni were treated with 40mg/kg praziquantel (PZQ); men positive for other soil-transmitted

helminth eggs were treated with 400mg albendazole. Individuals’ stools were checked 6 weeks

after treatment and the men were retreated if still egg positive. Upon becoming egg negative,

they were then followed by stool examination every 4 weeks to determine their time to

reinfection as a means of determining their relative resistance to reinfection (see below).

DNA preparation

White blood cell-containing buffy coats were separated using the Ficoll-hypaque

technique from blood obtained for immunological assays. The buffy coats were stored at -20ºC

and DNA was isolated at KEMRI/CGHR laboratories using the Wizard® Genomic DNA

Purification Kit from Promega. DNA from 300µl of buffy coat for each car washer was isolated

per the manufacturer’s instructions. Dried DNA pellets were then transported to Athens,

Georgia, USA for genotyping.

PCR reactions

PCR reactions of IL-13 and IL-4 SNPs were performed on a PTC-200 DNA Engine from

MJ Research. PCR of the IL-13 -1055 C/T was conducted in a 50µl reaction containing 100ng

DNA, 5µl of 1x Qiagen PCR buffer, 0.5µM of each dNTP, 0.4µM of each primer, 1mM MgCl2,

and 2.5 U of Taq polymerase (Qiagen). The following sequences were used: forward primer, 5’-

ATGCCTTGTGAGGAGGGTCAC; reverse primer, 5’-CCAGTCTCTGCAGGATCAACC (24).

Initial denaturation was performed at 95ºC for 3 min followed by 30 cycles of PCR with the

following conditions: 95ºC for 30 sec, 62ºC for 30 sec for annealing, 72ºC for 1 min, and a final

72ºC for 3 min. PCR of the IL-13 -591 A/G was conducted in a 50µl reaction containing 100ng


33

and 2.5 U of Taq polymerase (Qiagen). Initial denaturation was performed at 94ºC for 5 min

followed by 34 cycles of PCR with the following conditions: 94ºC for 1 min, 61ºC for 45 sec for

annealing, 72ºC for 45 sec, and a final 72ºC for 3 min. The following sequences were used:

forward primer, 5’-CCAGCCTGGCCCAGTTAAGAGTTT; reverse primer, 5’-

CTAATTCCTCCTTGGCCCCACT (28). PCR of the IL-13 +130 G/A was conducted in a 50µl

reaction containing 100ng DNA, 5µl of 1x Qiagen PCR buffer, 0.5µM of each dNTP, 0.4µM of

each primer, 1mM MgCl2, and 2.5 U of Taq polymerase (Qiagen). Initial denaturation was

performed at 94ºC for 5 min followed by 34 cycles of PCR with the following conditions: 94ºC

for 1 min, 60ºC for 45 sec for annealing, 72ºC for 45 sec, and a final 72ºC for 3 min. The

following sequences were used: forward primer, 5’-TGGCGTTCTACTCACGTGCT; reverse

primer, 5’-CAGCACAGGCTGAGGTCTAA (22). PCR of the IL-4 -590 C/T was conducted in

a 50µl reaction containing 100ng DNA, 5µl of 1x Qiagen PCR buffer, 0.5µM of each dNTP,

0.4µM of each primer, 1mM MgCl2, and 2.5 U of Taq polymerase (Qiagen). Initial denaturation

was performed at 95ºC for 5 min followed by 31 cycles of PCR with the following conditions:

94ºC for 30 sec, 59ºC for 30 sec for annealing, 72ºC for 30 sec, and a final 72ºC for 3 min. The

following sequences were used: forward primer, 5’-ACTAGGCCTCACCTGATACG; reverse

primer, 5’-GTTGTAATGCAGTCCTCCTG (19).

Genotyping

Purified PCR products of the IL-13 -1055 C/T and IL-4 -590 C/T PCR reactions were

sequenced using the reverse primers for each and the forward primers for IL-13 +130 G/A and

IL-13 -591 A/G on an ABI 3100 by the Office of Research Services at The University of

Georgia. The polymorphisms IL-10 -1082, IL-10 -819, IL-10 -592, and IFN-γ +874A/T were

34

genotyped using sequence-specific primers (SSP) in The Cytokine Genotyping Tray (One

Lambda; Canoga Park, CA) as per the manufacturer’s instructions.

Resistance

Resistance is based on the number of cars washed from the time of a successful cure until

the next reinfection. For all participants, the number of cars washed between each cure and

reinfection over the entire duration of the study was plotted and the patterns examined. Two

dominant patterns emerged, with participants either becoming reinfected after washing

approximately the same number of cars between each cure and reinfection or participants

washing progressively more cars between successive cure-reinfection intervals. The majority of

those in the former group (classified as “susceptible”) became reinfected after washing

approximately 250-300 cars regardless of how many times they were cured and reinfected. Those

men who demonstrated a pattern of increasing numbers of cars washed before subsequent

reinfections were classified as “developing resistance” during this study. All men classified as

“developing resistance” eventually washed at least 450 cars before reinfection after being

followed for at least 3 cure-to-reinfection intervals. Some men (classified as “initially resistant”)

washed at least 450 cars after the initial cure and continued to wash a high number of cars before

each reinfection. For analysis purposes, men classified as “developing resistance” and “initially

resistant” were grouped into a single “resistant” category because frequencies of genotypes did

not differ significantly between these two groups, and conceptually these groups indicate either

the existence of established resistance or the ability to develop resistance. Resistance data are

based on a mean follow-up time of 7.5 years (range 0.9-12.2 yrs) months and a mean of 7 cure-

to-reinfection intervals. Men were excluded from the analysis when the number of cars washed

35

between each cure and reinfection could not be classified into a particular pattern (3 men) or they

had insufficient follow up data (16 men) for accurate classification.

Statistical methods

Odds ratios (ORs) and corresponding 95% confidence intervals (CIs) for the association

between resistance and each genotype were calculated using univariate analyses and in a

multivariate logistic regression model containing variables for all three genotypes. To test for

interactions between genotypes, categorical interaction terms with 4 levels were created for each

possible two-way interaction between the 3 dichotomized genotypes. The combination of alleles

with the lowest frequency of resistant subjects was considered the referent category in each set of

terms. Separate logistic regression models were run for each series of two-way interaction

terms. Inclusion of a term for the third genotype did not appreciably change the results of any of

the interaction models and was thus ultimately not included in any of the reported analyses of

interactions.

Interactions were assessed on both a multiplicative and additive scale. Multiplicative

interactions are indicative of the need to estimate stratum-specific effects for the combination of

two genotypes, rather than a single estimate for each genotype, in order to improve the fit of the

model to the data (1). Multiplicative interactions were assessed by testing the significance of an

interaction term between two genotypes in the logistic regression models by the Wald test. As

many researchers believe that departure from additivity is a better indicator of biologic

interaction than departure from multiplicativity (1, 25), we also calculated the attributable

proportion (AP) of resistance due to interactions between two genotypes. A positive AP is

indicative of synergy between the two genotypes, while a negative AP indicates antagonism

[47]. APs and corresponding 95% CIs for each of the two-way interactions between genotypes

36

were calculated based on the output from the logistic regression models using the code provided

by Andersson et al (3) based on the methodology described by Hosmer and Lemeshow (23). All

analyses were performed with SAS version 9.1.

Results

Distribution of genotypes and resistance

The distribution of genotypes for each polymorphism and frequency of resistance in each

genotype are given in Table 1. A higher percentage of car washers with a T allele (T/T or T/A)

at IFN-γ +874 are resistant (T/A 65.2% and T/T 77.8%) than men that are A/A homozygous

(38.9%). For subsequent analyses, men with T/A and T/T at the IFN-γ +874 position were

grouped as the occurrence of resistance for each was significantly higher when compared to

homozygous individuals (A/A) and they did not differ from each other. Among men

heterozygous (C/T) at the IL-13 -1055 position, 76.0% were resistant to reinfection; whereas

only 41.9% of C/C and only 42.9% of T/T individuals were resistant to reinfection (Table 1).

Both homozygous genotypes for IL-13 -1055 were grouped for the univariate analysis as the

occurrences of resistance in either of those genotypes were substantially lower than in the

heterozygous group and they did not differ from each other. The frequency of homozygous C/C

at IL-4 -590 was not high enough in our cohort of men to allow analysis. However, men

heterozygous (C/T) at IL-4 -590 represent a higher percentage of resistance (70.8%) than men

that are T/T homozygous (40.9%). No overt differences are seen in the proportions of the

different genotypes of IL-10 (-1082; -819; -592) promoter SNPs in relationship to resistance or

susceptibility to reinfection, and as expected due to linkage disequilibrium, SNPs at IL-10 -819

and IL-10 -592 segregate together.

37

Polymorphisms in IL-13, IFN-γ, IL-4, and IL-10 and resistance

Resistance was significantly associated with the T allele at IFN-γ +874 (TT and TA)

when compared to the homozygous A/A individuals (OR 3.5 [CI 1.3, 9.4]) (Table 2). Car

washers heterozygous (C/T) at the IL-13 -1055 position also showed a significant correlation

with resistance to reinfection when compared to homozygous (C/C and T/T) car washers (OR 4.4

[CI 1.4, 13.4]) (Table 2), and heterozygousity (C/T) at the IL-4 -590 position correlated

significantly with resistance when compared to homozygous (T/T) car washers (OR 3.5 [CI 1.2,

10.2]) (Table 2). These associations remained significant when all three genotypes were

included in a multivariate analysis, indicating an independent association between resistance and

each of the 3 genotypes (Table 2). For IL-13 -591, there was no significant difference in

resistance between the A/A and A/G genotypes (Table 1, p=0.2399). Having an A allele at the

IL-13 +130 position was associated with a modest increase in resistance relative to the

homozygous G/G genotype (OR=2.4 [0.9, 6.7]). However, when IL-13 +130 and IL-13 -1055

were evaluated simultaneously in a logistic regression model, the association between resistance

and IL-13 +130 disappeared (OR=1.4 [0.4, 4.5]), while IL-13 -1055 remained significantly

associated with resistance. This suggests that the observed relationship between resistance and

IL-13 +130 was spurious and likely due to the close association between IL-13 +130 and IL-13 -

1055. Therefore, we only included the IL-13 -1055 polymorphism in further analyses.

We found a relationship of borderline significance with IL-10 -819 or -592 (any C versus

homozygous G/G or A/A): (OR = 3.1 [0.9, 10.2], p=0.0577) and resistance to reinfection. These

two (-819 and -592) polymorphisms are in tight linkage disequilibrium; hence the results are

interchangeable between the two. The OR remained virtually unchanged in a model controlling

for the other three significant genotypes, indicating that this possible low-grade association

38

between resistance and the IL-10 polymorphism was not confounded by its association with

another genotype. There were no significant additive or multiplicative interactions between IL-

10 -819 or -592 and any of the IL-4, IL-13 or IFN-γ polymorphisms. No significant associations

were found with IL-10 -1082 with resistance or susceptibility (data not shown).

Associations between genotype and resistance within categories of genotype interactions

Combination of the IL-13 -1055 and IFN-γ +874 genotypes that were independently

associated with resistance did not increase the odds of being resistant over having either one of

these genotypes alone. However, although all combinations of IL-13 and IFN-γ genotypes had

comparable odds of resistance when compared to the reference group (Table 3), effect

modification was seen between the IL-13 and IFN-γ genotypes. Among men with a homozygous

IL-13 genotype, having a T allele at the IFN-γ +874 position increased the odds of resistance

relative to those with the A/A genotype (OR=17.5 [CI 3.0, 101.5]) (Table 3). There was no

association between IFN-γ genotype and resistance among men with the heterozygous C/T IL-13

genotype. Likewise, among men with homozygous A/A IFN-γ genotype, the heterozygous IL-13

genotype was associated with resistance relative to the homozygous C/C or T/T genotypes

(OR=22.5 [CI 3.5, 144.4]) (Table 3), while no association between IL-13 and resistance was seen

among men with a T allele in the IFN-γ gene.

Men with a combination of the heterozygous C/T alleles for IL-13 -1055 and IL-4 -590

genes had more than a 20-fold increased odds of resistance relative to those with homozygous

alleles at both genes (OR=20.1 [CI 2.3, 176.0]) (Table 3). Men who were heterozygous for only

one of the IL-13 or IL-4 genes were not more likely to be resistant compared to men with both

homozygous alleles (Table 3). A significant additive interaction between IL-13 and IL-4

genotypes was detected, with 90% of the resistance among those with heterozygous alleles at

39

both genes attributable to the interaction between the two genes (AP=0.90 [0.64, 1.15]). In

contrast, no significant additive or multiplicative interactions were detected between IL-4 -590

and IFN-γ +874 (Table 3).

Discussion

The car washers in this study are part of a longitudinal study that dates back 12 years

(26). Their exposure (water contact) to infection with S. mansoni is documented by the number

of cars washed for payment purposes, providing us with a unique, reliable means to quantify an

individual’s exposure in an active transmission site over time. This longitudinal field setting

allows us to account for water contact as a variable and pose some interesting immunologic and

genetic questions with regard to what influences may play a role in determining resistance to

reinfection after treatment.

We found significant correlates between resistance to reinfection with S. mansoni and the

heterozygous (C/T) IL-13 -1055 genotype, any T allele in the IFN-γ +874 genotype, and the

heterozygous (C/T) in the IL-4 -590 genotype by univariate analysis. Furthermore, these

associations remained significant when all three genotypes were included in a multivariate

analysis, indicating independent associations between resistance and each of the 3 genotypes.

However, our data suggest that having a combination of the IL-13 C/T and an IFN-γ T allele at

+874 does not provide increased odds of being resistant over having just one of these genotypes.

Instead, both IL-13 C/T and any IFN-γ T allele demonstrated very high odds of being resistant

when compared to the reference group. Our data did, however, show a significant synergistic

effect between the IL-13 –1055 C/T and IL-4 -590 C/T genotypes. Thus, the proportion of

resistant men seen with a combination of these two cytokine genotypes was much greater than

that seen with the sum of the separate effects of IL-13 –1055 C/T and IL-4 -590 C/T on

40

resistance. We interpret these data to indicate that individuals heterozygous at the IL-13 -1055

and IL-4 -590 position are more likely to require fewer reinfections and treatments to become

resistant to reinfection than individuals who are homozygous at either position.

Due to our small sample size, our interaction analysis resulted in wide confidence

intervals and we were unable to evaluate 3-way interactions between groups. Also, because car

washing is an exclusively male profession at this study site, the associations in this study apply

to men and cannot necessarily be generalized to women. However, these analyses provide

interesting findings in a situation that provides exceptional exposure data that are not generally

available in studies of resistance to reinfection. Clearly our findings need to be investigated

further in larger cohorts. However, the current data provide initial insights into the potential

genetic foundation of propensities of people to develop resistance to reinfection by schistosomes,

and they offer a basis for further molecular studies of how these polymorphisms might work at

the transcriptional and gene product level.

41

Table 2.1. IFN-γ +874, IL-13 -1055, IL-13 +130, IL-13 -591, IL-4 -590, IL-10 -1082, IL-10 -

819 and IL-10 -592 genotype distributions and percentage of resistance.

Genotype Total N N (% susceptible) N (% resistant) IFN-γ +874

A/A 36 22 (61.1%) 14 (38.9%) T/A 23 8 (34.8%) 15 (65.2%) T/T 9 2 (22.2%) 7 (77.8%)

IL-13 -1055 C/C 31 18 (58.1%) 13 (41.9%) C/T 25 6 (24%) 19 (76%) T/T 7 4 (57.1%) 3 (42.9%)

IL-13 +130 A/A 7 2 (28.6%) 5 (71.4%) A/G 23 8 (34.8%) 15 (65.2%) G/G 33 18 (54.5%) 15 (45.5 %)

IL-13 -591 A/A 55 26 (47.3%) 29 (52.7%) A/G 8 2 (25%) 6 (75.0%)

IL-4 -590 C/C 1 0 1 (100%) C/T 24 7 (29.2%) 17 (70.8%) T/T 44 26 (59.1%) 18 (40.9%)

IL-10 -1082 A/A 38 21 (52.6%) 18 (47.4%) A/G 27 12 (44.4%) 15 (55.6%) G/G 4 1 (25%) 3 (75.0%)

IL-10 -819 C/C 14 5 (35.7%) 9 (64.3%) C/T 39 17 (43.6%) 22 (56.4%) T/T 16 11 (68.7%) 5 (31.3%)

IL-10 -592 C/C 14 5 (35.7%) 9 (64.3%) C/A 39 17 (43.6%) 22 (56.4%) A/A 16 11 (68.7%) 5 (31.3%)

42

Table 2.2. Odds ratios for the associations between individual genotypes and resistance to

reinfection by univariate and multivariate analysis

Genotype Univariate Multivariate*

OR (95% CI) p-value OR (95% CI) p-value

IL-13 -1055 (C/T vs CC/TT)

4.4 (1.4, 13.4) 0.0086 6.3 (1.5, 26.0) 0.0109

IFN-γ +874 (TT/TA vs A/A)

3.5 (1.2, 9.4) 0.0145 9.0 (2.0, 38.3) 0.0030

IL-4 -590 (C/T vs T/T) 3.5 (1.2, 10.2) 0.0192 4.3 (1.1, 17.4) 0.0419

*adjusted for the other 2 genotypes

43

Table 2.3. Odds ratios for the associations between genotype and resistance within

categories of genotype interaction.

+ AP = attributable proportion

* Wald test for interaction term in logistic regression model

Interaction categories Odds Ratio (95% CI) Measures of

interaction

n (%) resistant

IL-13 and IFN-γ

IL-13 CT, IFN-γ TA/TT 26.3 (3.0, 226.6) AP + = -0.49 (-3.09, 2.12)

Wald p-value* = 0.047

7 (77.8)

IL-13 CT, IFN-γ AA 22.5 (3.5, 144.4) 12 (75.0)

IL-13 CC/TT,

IFN-γ TA/TT

17.5 (3.0, 101.5) 14 (70.0)

IL-13 CC/TT, IFN-γ AA Ref 2 (11.8)

IL-13 and IL-4

IL-13 CT, IL-4 CT 20.1 (2.3, 176.0) AP + = 0.90 (0.64, 1.15)


13 (92.9)

IL-13 CT, IL-4 TT 1.9 (0.5, 7.6) 6 (54.5)

IL-13 CC, IL-4 CT 1.3 (0.3, 5.6) 4 (44.4)

IL-13 CC/TT, IL-4 TT Ref 11 (39.3)

IL-4 and IFN-γ

IL-4 CT, IFN-γ TA/TT 14.9 (2.2, 100.7) AP + = 0 (-1.75, 1.75)


7 (77.8)

IL-4 TT, IFN-γ TA/TT 7.4 (1.9, 30.0) 14 (63.6)

IL-4 CT, IFN-γ AA 8.5 (1.8, 39.2) 10 (66.7)

IL-4 TT, IFN-γ AA Ref 4 (19.1)

44

References

1. Ahlbom, A., and L. Alfredsson. 2005. Interaction: A word with two meanings creates

confusion. Eur J Epidemiol 20:563-4.

2. Akdis, C. A., T. Blesken, M. Akdis, S. S. Alkan, B. Wuthrich, C. H. Heusser, and K.

Blaser. 1997. Induction and differential regulation of bee venom phospholipase A2-

specific human IgE and IgG4 antibodies in vitro requires allergen-specific and

nonspecific activation of T and B cells. J Allergy Clin Immunol 99:345-53.

3. Andersson, T., L. Alfredsson, H. Kallberg, S. Zdravkovic, and A. Ahlbom. 2005.

Calculating measures of biological interaction. Eur J Epidemiol 20:575-9.

4. Bacharier, L. B., and R. S. Geha. 2000. Molecular mechanisms of IgE regulation. J

Allergy Clin Immunol 105:S547-58.





51:595-601.

6. Butterworth, A. E., M. Capron, J. S. Cordingley, P. R. Dalton, D. W. Dunne, H. C.

Kariuki, G. Kimani, D. Koech, M. Mugambi, J. H. Ouma, and et al. 1985. Immunity

after treatment of human schistosomiasis mansoni. II. Identification of resistant

individuals, and analysis of their immune responses. Trans R Soc Trop Med Hyg 79:393-

408.

45

7. Caldas, I. R., R. Correa-Oliveira, E. Colosimo, O. S. Carvalho, C. L. Massara, D. G.

Colley, and G. Gazzinelli. 2000. Susceptibility and resistance to Schistosoma mansoni

reinfection: parallel cellular and isotypic immunologic assessment. Am J Trop Med Hyg

62:57-64.

8. Cameron, L., R. B. Webster, J. M. Strempel, P. Kiesler, M. Kabesch, H.

Ramachandran, L. Yu, D. A. Stern, P. E. Graves, I. C. Lohman, A. L. Wright, M.

Halonen, W. T. Klimecki, and D. Vercelli. 2006. Th2 cell-selective enhancement of

human IL13 transcription by IL13-1112C>T, a polymorphism associated with allergic

inflammation. J Immunol 177:8633-42.




10. Dessein, A. J., C. Chevillard, S. Marquet, S. Henri, D. Hillaire, and H. Dessein. 2001.

Genetics of parasitic infections. Drug Metab Dispos 29:484-8.

11. Dunne, D., Mountford, A. 2001. Resistance to infection in humans and animal models,

p. 133-212. In A. Mahmoud (ed.), Schistosomiasis. Imperial College Press, London, UK.







177:1364-72.

46

14. Gomes, Y. M., F. C. Gomes, V. C. Furtado, K. M. Teixeira, W. V. Souza, and F. G.

Abath. 1998. IgE and IgG4 antibodies in subjects reinfected with Schistosoma mansoni

in an endemic area of northeast Brazil. Mem Inst Oswaldo Cruz 93 Suppl 1:183-4.

15. Gounni, A. S., B. Lamkhioued, K. Ochiai, Y. Tanaka, E. Delaporte, A. Capron, J. P.

Kinet, and M. Capron. 1994. High-affinity IgE receptor on eosinophils is involved in

defence against parasites. Nature 367:183-6.

16. Graves, P. E., M. Kabesch, M. Halonen, C. J. Holberg, M. Baldini, C. Fritzsch, S. K.

Weiland, R. P. Erickson, E. von Mutius, and F. D. Martinez. 2000. A cluster of seven

tightly linked polymorphisms in the IL-13 gene is associated with total serum IgE levels

in three populations of white children. J Allergy Clin Immunol 105:506-13.

17. Grogan, J. L., P. G. Kremsner, G. J. van Dam, A. M. Deelder, and M.

Yazdanbakhsh. 1997. Anti-schistosome IgG4 and IgE at 2 years after chemotherapy:

infected versus uninfected individuals. J Infect Dis 176:1344-50.

18. Grogan, J. L., P. G. Kremsner, G. J. van Dam, W. Metzger, B. Mordmuller, A. M.

Deelder, and M. Yazdanbakhsh. 1996. Antischistosome IgG4 and IgE responses are

affected differentially by chemotherapy in children versus adults. J Infect Dis 173:1242-

7.

19. Gyan, B. A., B. Goka, J. T. Cvetkovic, J. L. Kurtzhals, V. Adabayeri, H. Perlmann,

A. K. Lefvert, B. D. Akanmori, and M. Troye-Blomberg. 2004. Allelic

polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria

severity in Ghanaian children. Clin Exp Immunol 138:145-50.

47

20. Hagan, P., U. J. Blumenthal, D. Dunn, A. J. Simpson, and H. A. Wilkins. 1991.

Human IgE, IgG4 and resistance to reinfection with Schistosoma haematobium. Nature

349:243-5.

21. He, J. Q., M. Chan-Yeung, A. B. Becker, H. Dimich-Ward, A. C. Ferguson, J.

Manfreda, W. T. Watson, and A. J. Sandford. 2003. Genetic variants of the IL13 and

IL4 genes and atopic diseases in at-risk children. Genes Immun 4:385-9.

22. Heinzmann, A., X. Q. Mao, M. Akaiwa, R. T. Kreomer, P. S. Gao, K. Ohshima, R.

Umeshita, Y. Abe, S. Braun, T. Yamashita, M. H. Roberts, R. Sugimoto, K. Arima,

Y. Arinobu, B. Yu, S. Kruse, T. Enomoto, Y. Dake, M. Kawai, S. Shimazu, S.

Sasaki, C. N. Adra, M. Kitaichi, H. Inoue, K. Yamauchi, N. Tomichi, F. Kurimoto,

N. Hamasaki, J. M. Hopkin, K. Izuhara, T. Shirakawa, and K. A. Deichmann. 2000.

Genetic variants of IL-13 signalling and human asthma and atopy. Hum Mol Genet

9:549-59.

23. Hosmer, D. W., and S. Lemeshow. 1992. Confidence interval estimation of interaction.

Epidemiology 3:452-6.

24. Howard, T. D., G. H. Koppelman, J. Xu, S. L. Zheng, D. S. Postma, D. A. Meyers,

and E. R. Bleecker. 2002. Gene-gene interaction in asthma: IL4RA and IL13 in a Dutch

population with asthma. Am J Hum Genet 70:230-6.

25. Kalilani, L., and J. Atashili. 2006. Measuring additive interaction using odds ratios.

Epidemiol Perspect Innov 3:5.

26. Karanja, D. M., A. W. Hightower, D. G. Colley, P. N. Mwinzi, K. Galil, J. Andove,

and W. E. Secor. 2002. Resistance to reinfection with Schistosoma mansoni in

48

occupationally exposed adults and effect of HIV-1 co-infection on susceptibility to

schistosomiasis: a longitudinal study. Lancet 360:592-6.

27. Karjalainen, J., J. Hulkkonen, M. M. Nieminen, H. Huhtala, A. Aromaa, T.

Klaukka, and M. Hurme. 2003. Interleukin-10 gene promoter region polymorphism is

associated with eosinophil count and circulating immunoglobulin E in adult asthma. Clin

Exp Allergy 33:78-83.





Immunol 174:6274-81.

29. Li, Y. S., A. C. Sleigh, A. G. Ross, Y. Li, G. M. Williams, S. J. Forsyth, M. Tanner,

and D. P. McManus. 1999. A 2-year prospective study in China provides

epidemiological evidence for resistance in humans to re-infection with Schistosoma

japonicum. Ann Trop Med Parasitol 93:629-42.

30. Li, Z., C. L. King, J. O. Ogundipe, L. S. Licate, and R. E. Blanton. 1995. Preferential

recognition by human IgE and IgG4 of a species-specific Schistosoma haematobium

serine protease inhibitor. J Infect Dis 171:416-22.

31. Marquet, S., L. Abel, D. Hillaire, and A. Dessein. 1999. Full results of the genome-

wide scan which localises a locus controlling the intensity of infection by Schistosoma

mansoni on chromosome 5q31-q33. Eur J Hum Genet 7:88-97.

49

32. Marquet, S., L. Abel, D. Hillaire, H. Dessein, J. Kalil, J. Feingold, J. Weissenbach,

and A. J. Dessein. 1996. Genetic localization of a locus controlling the intensity of

infection by Schistosoma mansoni on chromosome 5q31-q33. Nat Genet 14:181-4.

33. Mwinzi, P. N., D. M. Karanja, D. G. Colley, A. S. Orago, and W. E. Secor. 2001.

Cellular immune responses of schistosomiasis patients are altered by human

immunodeficiency virus type 1 coinfection. J Infect Dis 184:488-96.








36. Rihet, P., C. E. Demeure, A. Bourgois, A. Prata, and A. J. Dessein. 1991. Evidence

for an association between human resistance to Schistosoma mansoni and high anti-larval

IgE levels. Eur J Immunol 21:2679-86.

37. Satti, M. Z., P. Cahen, P. S. Skov, S. Joseph, F. M. Jones, C. Fitzsimmons, K. F.

Hoffmann, C. Reimert, C. Kariuki, F. Kazibwe, J. K. Mwatha, G. Kimani, B. J.

Vennervald, J. H. Ouma, N. B. Kabatereine, and D. W. Dunne. 2004. Changes in

IgE- and Antigen-dependent histamine-release in peripheral blood of Schistosoma

mansoni-infected Ugandan fishermen after treatment with praziquantel. BMC Immunol

5:6.

50

38. Turner, D. M., D. M. Williams, D. Sankaran, M. Lazarus, P. J. Sinnott, and I. V.

Hutchinson. 1997. An investigation of polymorphism in the interleukin-10 gene

promoter. Eur J Immunogenet 24:1-8.

39. van Der Kleij, D., A. G. Tielens, and M. Yazdanbakhsh. 1999. Recognition of

schistosome glycolipids by immunoglobulin E: possible role in immunity. Infect Immun

67:5946-50.

40. van der Pouw Kraan, T. C., A. van Veen, L. C. Boeije, S. A. van Tuyl, E. R. de

Groot, S. O. Stapel, A. Bakker, C. L. Verweij, L. A. Aarden, and J. S. van der Zee.

1999. An IL-13 promoter polymorphism associated with increased risk of allergic

asthma. Genes Immun 1:61-5.

41. Verra, F., G. Luoni, C. Calissano, M. Troye-Blomberg, P. Perlmann, H. Perlmann,

B. Arca, B. S. Sirima, A. Konate, M. Coluzzi, D. Kwiatkowski, and D. Modiano.

2004. IL4-589C/T polymorphism and IgE levels in severe malaria. Acta Trop 90:205-9.





43. Vladich, F. D., S. M. Brazille, D. Stern, M. L. Peck, R. Ghittoni, and D. Vercelli.

2005. IL-13 R130Q, a common variant associated with allergy and asthma, enhances

effector mechanisms essential for human allergic inflammation. J Clin Invest 115:747-54.

44. Webster, M., P. G. Fallon, A. J. Fulford, A. E. Butterworth, J. H. Ouma, G. Kimani,

and D. W. Dunne. 1997. IgG4 and IgE responses to Schistosoma mansoni adult worms

after treatment. J Infect Dis 175:493-4.

51

45. Wen, H. J., Y. C. Lin, Y. L. Lee, and Y. L. Guo. 2006. Association between cord blood

IgE and genetic polymorphisms of interleukin-4, the beta-subunit of the high-affinity

receptor for IgE, lymphotoxin-alpha, and tumor necrosis factor-alpha. Pediatr Allergy

Immunol 17:489-94.

46. Wilkins, H. A., U. J. Blumenthal, P. Hagan, R. J. Hayes, and S. Tulloch. 1987.

Resistance to reinfection after treatment of urinary schistosomiasis. Trans R Soc Trop

Med Hyg 81:29-35.

47. Zhang, Z., H. Wu, S. Chen, L. Hu, Z. Xie, Y. Qiu, C. Su, J. P. Cao, Y. Wu, S. Zhang,

and G. Wu. 1997. Association between IgE antibody against soluble egg antigen and

resistance to reinfection with Schistosoma japonicum. Trans R Soc Trop Med Hyg

91:606-8.

52

Chapter 3

Additional Immunologic Relationships

As was stated in chapter one, our primary purpose was to examine possible relationships

with SNPs and resistance or susceptibility to reinfection with schistosomiasis. This was

analyzed and discussed in chapter 2. This chapter reports the additional findings that did not

correlate with resistance but involve relationships and patterns that we observed when evaluating

cytokine production categorized in relationship to the various SNP genotypes, relationships

between cytokine production and SWAP-specific isotypes with resistant and susceptible

phenotypes. What follows are the methods used to evaluate these immunologic relationships

and the results of those comparisons.

Methods: Study participants

The field site for this study was the western Kenyan city of Kisumu on the shores of Lake

Victoria. S. mansoni-infected Biomphalaria sudanica snails have been identified (data

unpublished) in the area around the exposure site. The study participants were all car washers

occupationally exposed to S. mansoni as they stood in Lake Victoria, using its waters to wash

cars driven into the shallow areas of the lake. This study was performed on a total of 87 car

washers (all adult men). However, complete data for all assays were not available and therefore,

it was not possible to include every individual in every analysis because some epidemiologic

data regarding infections, cures or reinfections were insufficient or incomplete.

53

This investigation was approved by the Institutional Review Boards of the University of

Georgia and the Centers for Diseases Control and Prevention, the Scientific Steering Committee

of the Kenya Medical Research Institute (KEMRI), and the National Ethics Review Committee

of Kenya and the University of Georgia IRB. After obtaining written informed consent and

enrolling the participants, we examined their stools for S. mansoni eggs and for other helminth

ova by the modified Kato-Katz method (Vestergaard-Frandsen, Denmark). In most instances,

this involved 2 slides per stool specimen from 3 stool specimens over a one week period. The

participants who were positive for S. mansoni were treated with 40mg/kg praziquantel (PZQ);

men positive for other soil-transmitted helminth eggs were treated with 400mg albendazole.

Individuals’ stools were checked 6 weeks later and men were retreated if still egg positive. Upon

becoming egg negative, they were then followed by stool examination every 4 weeks to

determine their time to reinfection as a means of determining their relative resistance to

reinfection (see below).

DNA preparation

White blood cell-containing buffy coats were obtained using the Ficoll-hypaque

technique from blood obtained for immunological assays in October 2003. The buffy coats were

stored at -20ºC and DNA was isolated at KEMRI/CGHR laboratories using the Wizard®

Genomic DNA Purification Kit from Promega. DNA from 300 µl of buffy coat for each car

washer was isolated per the manufacturer’s instructions. Dried DNA pellets were then

transported to Athens, Georgia, USA for genotyping.

PCR reactions

PCR reactions of IL-13 and IL-4 SNPs were performed on a PTC-200 DNA Engine from

MJ Research. PCR of the IL-13 -1055 C/T was conducted in a 50µl reaction containing 100ng

54


and 2.5 U of Taq polymerase (Qiagen). The following sequences were used: forward primer, 5’-

ATGCCTTGTGAGGAGGGTCAC; reverse primer, 5’-CCAGTCTCTGCAGGATCAACC (7).

Initial denaturation was performed at 95ºC for 3 min followed by 30 cycles of PCR with the

following conditions: 95ºC for 30 sec, 62ºC for 30 sec for annealing, 72ºC for 1 min, and a final

72ºC for 3 min. PCR of the IL-13 -591 A/G was conducted in a 50µl reaction containing 100ng


and 2.5 U of Taq polymerase (Qiagen). Initial denaturation was performed at 94ºC for 5 min

followed by 34 cycles of PCR with the following conditions: 94ºC for 1 min, 61ºC for 45 sec for

annealing, 72ºC for 45 sec, and a final 72ºC for 3 min. The following sequences were used:

forward primer, 5’-CCAGCCTGGCCCAGTTAAGAGTTT; reverse primer, 5’-

CTAATTCCTCCTTGGCCCCACT (8). PCR of the IL-13 +130 G/A was conducted in a 50µl

reaction containing 100ng DNA, 5µl of 1x Qiagen PCR buffer, 0.5µM of each dNTP, 0.4µM of

each primer, 1mM MgCl2, and 2.5 U of Taq polymerase (Qiagen). Initial denaturation was

performed at 94ºC for 5 min followed by 34 cycles of PCR with the following conditions: 94ºC

for 1 min, 60ºC for 45 sec for annealing, 72ºC for 45 sec, and a final 72ºC for 3 min. The

following sequences were used: forward primer, 5’-TGGCGTTCTACTCACGTGCT; reverse

primer, 5’-CAGCACAGGCTGAGGTCTAA (6). PCR of the IL-4 -590 C/T was conducted in a

50µl reaction containing 100ng DNA, 5µl of 1x Qiagen PCR buffer, 0.5µM of each dNTP,

0.4µM of each primer, 1mM MgCl2, and 2.5 U of Taq polymerase (Qiagen). Initial denaturation

was performed at 95ºC for 5 min followed by 31 cycles of PCR with the following conditions:

94ºC for 30 sec, 59ºC for 30 sec for annealing, 72ºC for 30 sec, and a final 72ºC for 3 min. The

55

following sequences were used: forward primer, 5’-ACTAGGCCTCACCTGATACG; reverse

primer, 5’-GTTGTAATGCAGTCCTCCTG (5).

Genotyping

Purified PCR products of the IL-13 -1055 C/T and IL-4 -590 C/T PCR reactions were

sequenced using the reverse primers for each and the forward primers for IL-13 +130 G/A and

IL-13 -591 A/G on an ABI 3100 by the Office of Research Services at The University of

Georgia. The polymorphisms IL-10 -1082, IL-10 -819, IL-10 -592, and IFN-γ +874A/T were

genotyped using sequence-specific primers (SSP) in The Cytokine Genotyping Tray (One

Lambda; Canoga Park, CA) as per the manufacturer’s instructions.

Blood samples

Total heparinized blood taken from carwashers for isotyping, cytokine ELISAs and DNA

preparation totaled 10 ml. The 10 ml samples were then separated into 6 ml and 4 ml samples

for whole blood cultures and plasma (for isotyping assays) and DNA extraction respectively.

The 4 ml sample was centrifuged at 1100g for 10 minutes in polypropylene Falcon tubes.

Approximately 2 ml of plasma was collected and stored at -20 ºC until isotyping assays could be

run. The 6 ml sample remaining was used in whole blood cultures for measuring cytokine

production. There were 41 carwashers that participated in these studies in 2007. Blood was also

taken at enrollment before initial treatment by Lauren Sasser in October 2003 and used for

ELISAs (as well as DNA purification explained previously) that were used in some of the

comparisons to be reported in subsequent sections.

Whole blood cultures and cytokine ELISAs

Whole blood cultures were made by gently adding 330 µl of blood to six 10 ml Falcon

tubes containing 1.42 ml Complete Media without normal human sera. Complete Media

56

contains 1.25% L-Glutamine, 1.25% Penicillin-Streptomycin, and 97.5% RPMI. Three antigens

were used and two mitogens to potentially stimulate the cultures. For antigenic stimulation:

SWAP was added to a final concentration of 10 µg/ml, SEA to a final concentration of 5 µg/ml,

and glutathione S-transferase to a final concentration of 1 µg/ml. For mitogenic stimulation:

Phytohemagglutinin (PHA) was added to a final concentration of 20 µg/ml and anti-CD3 to a

final concentration of 1 µg/ml. A Complete Media control whole blood culture was also done

that contained no exogenous stimuli. Each whole blood culture had a total volume of 2 ml with

330 µl whole blood, 250 µl antigen/mitogen at working concentration, and 1420 µl Complete

Media. Cultures were incubated for 5 days at 37ºC at 5% CO2 and supernatant fluids were

harvested on day 5. Cytokine ELISAs were run for IL-13, IL-4, IL-10, IFN-γ, TGF-β and TNF-α

using DuoSet® ELISA Development System from R&D Systems as per the manufactures

instructions. Plates were read using SoftMax Pro 4.3.1 LS software and a microplate reader on

location at KEMRI.

Isotyping

Isotyping was performed for anti-SWAP IgE, IgG1, IgG2, IgG3, IgG4, and IgM.

Immulon II 96 well plates were incubated with 100 µl/well of 25 µg/ml SWAP in 0.1M NaHCO3

(pH 9.6) overnight at 4ºC. Plates were then washed with 1xPBS + 0.005% Tween 20 5 times,

and blocked with 200 µl per well of 5% non-fat dry milk in PBS + 0.3% Tween 20 for 1 hour at

room temperature. Plates were washed again as before and 100 µl/well of serum dilutions made

with PBS were added. Plates were incubated again overnight at 4 ºC, washed as before and an

experimentally determined dilution of anti-Ig antibodies was added. These were then incubated

for 1 hour at room temperature. Plates were washed again and room temperature TMB

Peroxidase Substrate and Peroxidase Substrate Solution B were added in equal parts for a total of

57

100 µl/well. The reaction was stopped with 100 µl/well of 1M H2PO4 after 1 minute or initial

strong color change. Anti-Ig and serum dilutions were made in 1xPBS and are as follows: anti-

IgE 1/400 with serum at 1/20, anti-IgG1 at 1/500 with serum at 1/800, anti-IgG2 at 1/500 with

serum at 1/20, anti-IgG3 at 1/500 with serum at 1/100, anti-IgG4 at1/1000 with serum at 1/800,

and anti-IgM at1/1000 with serum at 1/400.

SWAP preparation

SWAP was prepared by thawing frozen worms and adding 1-2 mL of Dulbecco’s

Phosphate Buffered Saline to the thawed worms. Worms were homogenized using a Tri-R

stirrer for 10 minutes in an ice bath and left overnight at 4ºC. Homogenized worms were the

subjected to one freeze and thaw cycle then centrifuged at 10,000 rpm for 1 hour using a Sorval

high speed centrifuge. Supernatants were then collected and centrifuged for 1 hour at 100,000g

in an ultracentrifuge and then filtered through a 0.2μ syringe mounted filter. Protein

concentration was determined by bicinchoninic acid assay (BCA) and stored at -80 ºC.

Resistance

Resistance is based on the number of cars washed from the time of a successful cure until

the next reinfection. For all participants, the number of cars washed between each cure and

reinfection over the entire duration of the study was plotted and the patterns examined. Two

dominant patterns emerged, with participants either becoming reinfected after washing

approximately the same number of cars between each cure and reinfection or participants

washing progressively more cars between successive cure-reinfection intervals. The majority of

those in the former group (classified as “susceptible”) became reinfected after washing

approximately 250-300 cars regardless of how many times they were cured and reinfected. Those

men who demonstrated a pattern of increasing numbers of cars washed before subsequent

58

reinfections were classified as “developing resistance” during this study. All men classified as

“developing resistance” eventually washed at least 450 cars before reinfection after being

followed for at least 3 cure-to-reinfection intervals. Some men (classified as “initially resistant”)

washed at least 450 cars after the initial cure and continued to wash a high number of cars before

each reinfection. For analysis purposes, men classified as “developing resistance” and “initially

resistant” were grouped into a single “resistant” category because frequencies of genotypes did

not differ significantly between these two groups, and conceptually these groups indicate either

the existence of established resistance or the ability to develop resistance. Resistance data are

based on a mean follow-up time of 7.5 years (range 0.9-12.2 yrs) months and a mean of 7 cure-

to-reinfection intervals. Men were excluded from the analysis when the number of cars washed

between each cure and reinfection could not be classified into a particular pattern (3 men) or they

had insufficient follow up data (16 men) for accurate classification.

Statistics

All statistics were performed using the GraphPad InStat and GraphPad Prism 4 software.

One way ANOVAs were used to evaluate statistical differences between genotype and cytokine

production followed by test for linear trend. Linear regressions were performed for comparisons

between cytokine production and isotype levels. Where there were only 2 groups, the student’s

T test was used to evaluate significant differences between groups.

Results

In 1993, Demeure et al. showed a negative association between levels of IgG2 and

resistance to reinfection after chemotherapy (2). Other than this work, there does not seem to be

any other correlative studies that involve IgG2. When we examined the carwashers SWAP-

specific IgG2 versus their phenotypic status with regards to resistance (which includes the group

59

changing to resistant) or susceptible status we observed the same association. We found that

individuals in the resistant group made significantly less IgG2 than those in the susceptible group

(P=0.04) (Figure 2). While Demeure et al. propose that this finding is consistent with the view

that anti-carbohydrate antibodies may facilitate reinfection, we would add that IgG2 could be

serving as a blocking antibody as well.

The IL-13 – 1055 C/T polymorphism has been shown to correlate with resistance to

reinfection by us and has been shown to correlate (the C allele) with the upper 10% infection

levels in S. haematobium infections (8). Homozygous T/T has also been shown to have

increased gene transcription in previous studies on asthma. We examine SWAP-specific

production of IL-13 in our cohort of carwashers by IL-13 -1055 genotype and found that

homozygous T/T individuals produced significantly more IL-13 than homozygous C/C (P<0.05)

(Figure 3). Our data seem to support previous reports of higher transcription levels for

homozygous T/T.

The presence of serum IgG1, IgA, and IgG3 antibodies to Glyceraldehyde 3-phosphate

dehydrogenase generally characterized individuals that were resistant to reinfection (4). TSP-2

was recognized strongly by IgG3 in endemic normals but is not recognized by chronically

infected or unexposed individuals (9). We have shown that polymorphisms in IFN-γ correlate

with resistance and other studies have shown the correlation of IFN-γ with resistance to

reinfection (1, 10). We examined potential relationship between SWAP-induced IFN-γ

production and levels of SWAP-specific IgG3 by linear regression and found that as levels of

SWAP-specific IFN-γ increased so too did levels of SWAP-specific IgG3 (Figure 4). While we

did not find SWAP-specific IgG3 levels correlated with resistance or susceptibility at this time

60

point, we hypothesize that given the appropriate antigen (possibly Glyceraldehyde 3-phosphate

dehydrogenase or TSP-2) a correlation could perhaps emerge.

As stated in chapter 1, differential production of IL-10 has been shown to be associated

with different allelic variants of the IL-10 promoter (-1082 A/G [rs 1800896], -819 T/C [rs

1800871], and -592 A/C [rs 1800872]). The different haplotypes that have been associated with

production of IL-10 are as follows: “high” IL-10 producer haplotype (GCC/GCC),

“intermediate” producer haplotypes (GCC/ACC, GCC/ATA), and “low” producer haplotypes

(ATA/ATA, ACC/ATA, ACC/ACC) (3). When we examined IL-10 production upon PHA

exposure at enrollment by predicted IL-10 producer phenotype, we found that the phenotypes

that are characterized as high, intermediate, and low producers did indeed follow that pattern of

expression. The high predicted phenotype produced significantly more IL-10 upon stimulation

with PHA than either the intermediate or low phenotypes (p<0.05 for both comparisons) (Figure

5). Furthermore, when we evaluated this relationship again much later in the study we found that

the same pattern held true although statistical significance had been lost, perhaps due to lower n

values at this time point.

We found no associations between the resistance to reinfection and the following anti

SWAP Isotypes : IgE, IgG1, IgG3, IgG4, IgM,and IgE/IgG4 ratio. Futhermore, we found no

associations between resistance to reinfection and polymorphisms related to the following

cytokine genes: IL-10, TNF-α, and TGF-β. Finally, we found no associations with production of

the following cytokines to SWAP, SEA, PHA, anti-CD3, and GST stimulation in whole blood

cultures with resistance to reinfection: IFN-γ, IL-10, TGF-β, TNF-α, IL-4, and IL-13. This data

is not shown herein.

61

Figure 3.2. SWAP-specific IgG2 separated by resistant and susceptible phenotypes.

62

Figure 3.3. SWAP specific stimulation of IL-13 separated by genotypes for the IL-13 -1055 SNP.

P=0.005 for linear trend

P<0.05

63

Figure 3.4. Linear regression of levels of SWAP-specific IgG3 and SWAP specific stimulation of IFN-γ. r2=0.2352

64

Figure 3.5. PHA stimulated IL-10 production by predicted phenotypes at enrollment into the study.

65

IL-10 Production to PHA by Predicted Phenotype

High Med Low0

500

1000

1500

2000

2500

Figure 3.6. PHA stimulated IL-10 production by predicted phenotypes measured in 2007.

N=3

N=11

N=24

P=0.581

66

References





51:595-601.







4. El Ridi, R., C. B. Shoemaker, F. Farouk, N. H. El Sherif, and A. Afifi. 2001. Human

T- and B-cell responses to Schistosoma mansoni recombinant glyceraldehyde 3-

phosphate dehydrogenase correlate with resistance to reinfection with S. mansoni or

Schistosoma haematobium after chemotherapy. Infect Immun 69:237-44.

5. Gyan, B. A., B. Goka, J. T. Cvetkovic, J. L. Kurtzhals, V. Adabayeri, H. Perlmann,

A. K. Lefvert, B. D. Akanmori, and M. Troye-Blomberg. 2004. Allelic

polymorphisms in the repeat and promoter regions of the interleukin-4 gene and malaria

severity in Ghanaian children. Clin Exp Immunol 138:145-50.

6. Heinzmann, A., X. Q. Mao, M. Akaiwa, R. T. Kreomer, P. S. Gao, K. Ohshima, R.

Umeshita, Y. Abe, S. Braun, T. Yamashita, M. H. Roberts, R. Sugimoto, K. Arima,

67

Y. Arinobu, B. Yu, S. Kruse, T. Enomoto, Y. Dake, M. Kawai, S. Shimazu, S.

Sasaki, C. N. Adra, M. Kitaichi, H. Inoue, K. Yamauchi, N. Tomichi, F. Kurimoto,

N. Hamasaki, J. M. Hopkin, K. Izuhara, T. Shirakawa, and K. A. Deichmann. 2000.

Genetic variants of IL-13 signalling and human asthma and atopy. Hum Mol Genet

9:549-59.

7. Howard, T. D., G. H. Koppelman, J. Xu, S. L. Zheng, D. S. Postma, D. A. Meyers,

and E. R. Bleecker. 2002. Gene-gene interaction in asthma: IL4RA and IL13 in a Dutch

population with asthma. Am J Hum Genet 70:230-6.





Immunol 174:6274-81.

9. Tran, M. H., M. S. Pearson, J. M. Bethony, D. J. Smyth, M. K. Jones, M. Duke, T.

A. Don, D. P. McManus, R. Correa-Oliveira, and A. Loukas. 2006. Tetraspanins on

the surface of Schistosoma mansoni are protective antigens against schistosomiasis. Nat

Med 12:835-40.





68

Chapter 4

Conclusions and Potential Future Works

Schistosomiasis was first described in 1851 (9) but is an ancient disease. The

transmission cycle from snail to human to water to snail again would seem to be easily

interruptible and yet schistosomiasis is still very much with us today. In fact, over 200 million

people are infected worldwide (3, 10). Of that 200 million, 20 million exhibit the most severe

form of the disease which leads to approximately 20,000 deaths per year. While 20,000 deaths

per year is not comparable to death rates of infectious diseases such as HIV and malaria, the

impact of having schistosomiasis for the estimated 100 million people that display the more

moderate morbidity and 80 million that show the “asymptomatic” forms of schistosomiasis has

some very substantial consequences on their daily lives. It is known to cause anemia and affect

growth and cognitive development, and likely impacts the productivity in the local economies

(4). Clearly, schistosomiasis is an infectious disease that warrants continued study, continued

efforts to control and/or eliminate transmission, and continued efforts to develop effective

vaccinations to prevent infection. Furthermore, study of the immunology of this chronic

antigenic exposure represented by life-long schistosomiasis may shed light on other chronic

immunologic diseases.

69

To effectively reach the goals of elimination of transmission and development of

effective vaccinations, basic immunologic studies are clearly needed. Many studies of the

immune response for resistant and susceptible individuals have been undertaken. While not all

of the data are in agreement with one another, many of the possible immunologic players have

been identified in association studies as well as in vitro mechanistic studies in mice and humans.

Expanding on these studies and providing data to support these previous findings, as well as

elucidating new immunologic mechanisms will help to develop more effective strategies to

accomplish the goals listed above. It is to this aim that this project was undertaken.

Studies of resistance to reinfection and immune responses associated with resistance to

reinfection generally have one common confounding variable that is very difficult to circumvent.

This variable is well documented exposure data. Our study at the carwash is unique in that it

systematically collects reliable water exposure based on record keeping of the number of cars

washed for payment purposes. Most immunologic studies of reinfection focus on cytokine

and/or antibody isotype levels or proliferative responses as a means of evaluating potential

mechanisms for resistance. In addition, we looked for associations with resistance to reinfection

from a genotypic approach, which has not been undertaken in regards to schistosomiasis. We

sought to evaluate relationships with resistance that could signify control at a transcriptional

level by evaluating single nucleotide polymorphisms (SNPs) in cytokine genes and promoter

regions of those cytokines that had been themselves associated by others with higher or lower

levels of cytokine production or associated with higher or lower levels of IgE and IgG4

antibodies. In some cases, these polymophisms are known to differentially bind transcription

factors that might explain their associations with higher/lower productions of cytokines. We

then evaluated those SNPs we found to be associated with resistance with production of

70

cytokines exposed to various schistosome antigens or mitogens with the aim of trying to find

associations from the gene level (SNPs) to the translational level (cytokine production). Finally,

we looked for associations between cytokine production and levels of different anti-SWAP

isotypes. Although we were not able to find direct associations from SNP to cytokine

production, cytokine production to isotype levels, isotype levels to resistance in this “linear

fashion”, we did find several significant associations between various components of the project.

The findings that having any T allele at IFN-γ +874 was interesting in that IFN-γ is a Th1

cytokine. The prvailing opinion of resistance to helminthic infections is that the immunologic

responses associated with resistance to reinfection are primarily Th2 type responses.

Nevertheless, several studies have also shown IFN-γ to be associated with resistance, including a

study of naturally resistant individuals who, though they live in endemic area and have exposure

to infection, never acquire an infection (1, 2, 8). The IFN-γ +874 allele we found to correlate

with resistance (T allele) has been associated with higher production of IFN-γ (7). Based on this

finding, it is interesting to speculate on what effects this polymorphism could have on

downstream immunologic events that could explain its correlation to resistance. We propose that

having a T allele at IFN-γ +874 causes an increase in macrophage killing, complement fixation,

and production of opsonizing IgG antibodies through the ability to produce more of the cytokine

upon proper antigen stimulation. We were not able to find correlates between cytokine

production and the IFN-γ +874 polymorphism by stimulation with SWAP, GST, or SEA.

However, the possibility remains that stimulation with an appropriate purified schistosomal

antigen could perhaps yield such an association between production and genotype. Furthermore,

we did not find correlations with IFN-γ production or SWAP-specific IgG3 levels and resistance.

This is not to say that a correlation does not exist; it may be that we did not use the appropriate

71

antigen for stimulation. Also, measuring IgG3 specific levels for a singular schistosomal protein

in order to find potential correlations may have yielded better results as SWAP is a large

collection of schistosomal proteins.

While there are some contradictory reports on which allelic make up is associated with

higher IgE production, we found heterozygosity at IL-4 -590 to be associated with resistance.

Explanation for this association is a bit more difficult. The frequency of homozygous C/C at IL-

4 -590 was too low in our cohort to evaluate its potential contribution to resistance. However we

did find that men with a combination of the heterozygous C/T alleles for IL-13 -1055 and IL-4 -

590 genes had more than a 20-fold increased odds of resistance relative to those with

homozygous alleles at both genes (OR=20.1 [CI 2.3, 176.0] Thus, it may be important to

consider the effects of both IL-13 -1055 and IL-4 -590 together. We found heterozygosity at IL-

13 -1055 to be associated with resistance, while most studies report that the T allele is associated

with higher production of IgE. However, IL-13 has two binding units. The IL-13 receptor α1

chain transduces the IL-13 signal as a heterodimer with the IL-4R α chain, while the IL-13

receptor α2 chain (IL-13R α2) acts as a decoy receptor. IL-4 and/or IL-13 induced intracellular

expression of IL-13 α2 may be due to over expression of these cytokines. IL-13R α 2 has been

shown to down regulate IL-13 signal in bronchial epithelial cells (5, 14). We hypothesize that

the above scenario may lead to a possible feedback loop down regulating IgE production while

heterozygotes that produce intermediate levels of their respective cytokine would not trigger

such a mechanism.

This work builds on the discussion in the schistosomiasis community of resistance to

reinfection and its immunologic characteristics. We believe that the findings presented in this

project provide data that suggest that resistance to reinfection is a combination of both Th1 and

72

Th2 type immunological responses. We propose that if a certain cytokine/isotype make up

defines resistance immunologically, then polymorphisms in genes that could potentially regulate

that make up could be useful in the definition of resistance as seen in Figure 7. These

polymorphisms do not by themselves confer resistance or susceptibility, but we propose that

these genotypes allow the resistant phenotype to be developed and expressed upon suitable

immune exposure. Based on the literature, these polymorphisms contribute to the regulation of

their respective cytokines, likely leading to downstream differences in the production and

interrelationships of critical defense mechanisms. The data from this project provide initial

insights into the potential genetic foundation of propensities of people to develop resistance to

reinfection by schistosomes, and they offer a basis for further molecular studies of how these

polymorphisms might work at the transcriptional and gene product level.

The data in this project indicate several follow up studies that may potentially be

informative to several different fields of immunology. One would be a functionality study of the

+874 IFN-γ polymorphism that would monitor transcription levels under certain stimulations

(relevant to the disease being studied) for each haplotype. This would allow evaluation at a

transcriptional level whether the T allele (associated with high IFN-γ production) (7) has the

ability to produce more mRNA as well as having an association with high production of the

cytokine. Also, it would be of interest to evaluate whether NF-kappa B does indeed bind at this

locus and to look for other regulatory proteins that may regulate transcription.

73

Figure 4.7. Possible mechanisms for resistance with polymorphisms found to have a significant

association with resistance to reinfection. Modified from (13).

74

In addition, expanding these polymorphism studies to a larger cohort would allow for

many of the lower frequency alleles to be better represented and further evaluations to be made

in regard to multiple interactions between polymorphisms. Due to our small sample size,

although our interaction analysis yielded significant associations it also resulted in wide

confidence intervals and we were unable to evaluate 3-way interactions between groups of the

IL-4, IL-13, and IFN-γ polymorphisms. Furthermore, an evaluation of possible associations with

the IL-4 and the IL-13 polymorphism on IL-13α2 expression could help elucidate potential

mechanisms for the associations found in our current study. Such expansions of these studies

should also be performed in a setting that includes women, because car washing is an exclusively

male profession at our study site and the associations in our study apply to men only and cannot

necessarily be generalized to women.

Finally, glyceraldehyde 3-phosphate dehydrogenase(11), Sm 22.6 (6), TSP-2 (12) or

other schistosome antigens stimulated IL-4, IFN-γ, and IL-13 production in the present cohort of

carwashers could be evaluated for possible relationships with resistance to reinfection with

schistosomiasis. These are all possible vaccine candidates and may have associations we were

unable to find using SWAP and SEA as stimuli for our cytokine analyses.

75

References





51:595-601.




177:1364-72.

3. Engels, D., L. Chitsulo, A. Montresor, and L. Savioli. 2002. The global

epidemiological situation of schistosomiasis and new approaches to control and research.

Acta Trop 82:139-46.

4. King, C. H., K. Dickman, and D. J. Tisch. 2005. Reassessment of the cost of chronic

helmintic infection: a meta-analysis of disability-related outcomes in endemic

schistosomiasis. Lancet 365:1561-9.

5. Mentink-Kane, M. M., and T. A. Wynn. 2004. Opposing roles for IL-13 and IL-13

receptor alpha 2 in health and disease. Immunol Rev 202:191-202.

6. Pacifico, L. G., C. T. Fonseca, L. Chiari, and S. C. Oliveira. 2006. Immunization with

Schistosoma mansoni 22.6 kDa antigen induces partial protection against experimental

infection in a recombinant protein form but not as DNA vaccine. Immunobiology

211:97-104.

76








9. Ross, A. G., P. B. Bartley, A. C. Sleigh, G. R. Olds, Y. Li, G. M. Williams, and D. P.

McManus. 2002. Schistosomiasis. N Engl J Med 346:1212-20.

10. Steinmann, P., J. Keiser, R. Bos, M. Tanner, and J. Utzinger. 2006. Schistosomiasis

and water resources development: systematic review, meta-analysis, and estimates of

people at risk. Lancet Infect Dis 6:411-25.

11. Tallima, H., M. Montash, P. Veprek, J. Velek, J. Jezek, and R. El Ridi. 2003.

Differences in immunogenicity and vaccine potential of peptides from Schistosoma

mansoni glyceraldehyde 3-phosphate dehydrogenase. Vaccine 21:3290-300.

12. Tran, M. H., M. S. Pearson, J. M. Bethony, D. J. Smyth, M. K. Jones, M. Duke, T.

A. Don, D. P. McManus, R. Correa-Oliveira, and A. Loukas. 2006. Tetraspanins on

the surface of Schistosoma mansoni are protective antigens against schistosomiasis. Nat

Med 12:835-40.

13. Wynn, T. A., and K. F. Hoffmann. 2000. Defining a schistosomiasis vaccination

strategy - is it really Th1 versus Th2? Parasitol Today 16:497-501.

14. Yasunaga, S., N. Yuyama, K. Arima, H. Tanaka, S. Toda, M. Maeda, K. Matsui, C.

Goda, Q. Yang, Y. Sugita, H. Nagai, and K. Izuhara. 2003. The negative-feedback

77

regulation of the IL-13 signal by the IL-13 receptor alpha2 chain in bronchial epithelial

cells. Cytokine 24:293-303.

cytokine gene polymorphisms associated with...

Documents