D-Alanine Modification of a Protease-Susceptible Outer MembraneComponent by the Bordetella pertussis dra Locus Promotes Resistanceto Antimicrobial Peptides and Polymorphonuclear Leukocyte-Mediated Killing

Neetu Kumra Taneja,a Tridib Ganguly,a Lauren O. Bakaletz,b Kimberly J. Nelson,c Purnima Dubey,d Leslie B. Poole,c Rajendar Deoraa

Department of Microbiology and Immunology,a Department of Biochemistry,c and Department of Pathology,d Wake Forest School of Medicine, Winston-Salem, NorthCarolina, USA; Center for Microbial Pathogenesis, The Research Institute at Nationwide Children’s Hospital, and The Ohio State University College of Medicine, Columbus,Ohio, USAb

Bordetella pertussis is the causative agent of pertussis, a highly contagious disease of the human respiratory tract. Despitevery high vaccine coverage, pertussis has reemerged as a serious threat in the United States and many developing coun-tries. Thus, it is important to pursue research to discover unknown pathogenic mechanisms of B. pertussis. We have inves-tigated a previously uncharacterized locus in B. pertussis, the dra locus, which is homologous to the dlt operons of Gram-positive bacteria. The absence of the dra locus resulted in increased sensitivity to the killing action of antimicrobialpeptides (AMPs) and human phagocytes. Compared to the wild-type cells, the mutant cells bound higher levels of cationicproteins and peptides, suggesting that dra contributes to AMP resistance by decreasing the electronegativity of the cell sur-face. The presence of dra led to the incorporation of D-alanine into an outer membrane component that is susceptible toproteinase K cleavage. We conclude that dra encodes a virulence-associated determinant and contributes to the immuneresistance of B. pertussis. With these findings, we have identified a new mechanism of surface modification in B. pertussiswhich may also be relevant in other Gram-negative pathogens.

Whooping cough, or pertussis, a highly communicable infec-tion, is caused by the Gram-negative bacterium Bordetella

pertussis. The incidence of pertussis is increasing steadily in theUnited States, leading the CDC to classify pertussis as a reemerg-ing disease (1–4). In 2012, pertussis epidemics were declared inWisconsin, Vermont, and Colorado, and multiple states wit-nessed an increased incidence of pertussis higher than the nationalincidence. Overall, in the United States, more than 41,000 casesand 18 pertussis-related deaths have been reported for 2012 (3;www.cdc.gov). Globally, in 2008, 16 million cases of pertussis and195,000 deaths were estimated to have occurred by the WorldHealth Organization. Although infants are the primary targets ofpertussis, adolescents and adults constitute 60% of the reportedcases in the United States (5). It is now broadly accepted that theseindividuals serve as sources of transmission to infants and youngchildren (6–9). The reemergence of pertussis calls for intensifiedresearch efforts to discover new pathogenic mechanisms of B. per-tussis. Specifically, identification and comprehension of addi-tional immune resistance determinants are essential for a detailedunderstanding of its virulence and for the development of novelvaccines and other therapeutic agents.

Antimicrobial peptides (AMPs) are one group of innate im-mune effectors produced by myeloid-derived host defense cells,such as macrophages and neutrophils, and by the skin and muco-sal epithelia (10, 11). AMPs are broad-spectrum antimicrobialsand display potent microbicidal activities against bacterial patho-gens (11–14). AMPs largely exert their antimicrobial activities bydamaging bacterial membranes and forming pores, thereby re-sulting in the efflux of essential ions and nutrients and disruptionof membrane potential (15).

B. pertussis displays differential susceptibilities to AMPs iso-lated from different organisms (16–18). While cecropins and por-

cine AMPs (pBD-1 and PG-1) are highly effective in killing of B.pertussis, human AMPs HNP-1 and hBD-2 are relatively less ef-fective. BrkA and BapC, two autotransporter proteins of B. pertus-sis, have been implicated in providing resistance to killing by asingle AMP, cecropin P1 (17, 19). In both these studies, neither thebrkA nor the bapC mutant strain was found to be more susceptibleto any other AMPs tested. A B. pertussis factor that promotes re-sistance to human AMPs is not known. Additionally, the mecha-nisms by which BrkA or BapC confer resistance to cecropin P1-mediated killing are also not known.

Of the multiple ways employed by bacteria to resist the actionof AMPs, surface alteration by enzymatic chemical modificationsis a common theme in both Gram-positive and Gram-negativebacteria (12, 20). In many Gram-positive bacteria, D-alanyl ester-ification of teichoic acid by the genes of the dlt operons leads to adecreased negative charge on the bacterial cell surface (12, 20).This change in surface charge results in diminution of the inter-action of innate immune effectors like cationic AMPs.

In this article, we report the investigation of a previously un-characterized B. pertussis locus, the dra locus, which is homolo-gous to the dlt loci of Gram-positive bacteria. We constructed adra-deficient mutant of B. pertussis and compared the mutant andthe wild-type (WT) strains with respect to cell morphology,

Received 6 May 2013 Accepted 31 August 2013

Published ahead of print 6 September 2013

Address correspondence to Rajendar Deora, rdeora@wakehealth.edu.

N.K.T. and T.G. contributed equally to this article.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JB.00510-13

5102 jb.asm.org Journal of Bacteriology p. 5102–5111 November 2013 Volume 195 Number 22

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

growth characteristics, and susceptibility to innate immune com-ponents and cells. The mutant strain was more susceptible to kill-ing by several human AMPs and by human polymorphonuclearlymphocytes (PMNs). We show that the dra locus is involved inthe incorporation of D-alanine into an outer membrane (OM)component that is susceptible to proteinase K cleavage. Our find-ings uncover a unique mechanism of surface modification in B.pertussis which is distinct from the amino acid modification ofpolysaccharides by the homologous dlt loci.

MATERIALS AND METHODSBacterial strains, plasmids, and culture conditions. Bacterial strains andplasmids used in this study are listed in Table 1. B. pertussis strains weremaintained on Bordet-Gengou agar (BG) supplemented with 10% defi-brinated sheep blood. Liquid cultures were grown in Stainer-Scholte (SS)broth with heptakis (2,6-di-O-methyl-�-cyclodextrin) (21, 22). Esche-richia coli strains were grown in Luria-Bertani medium. As necessary, thevarious growth media were supplemented with the appropriate antibiot-ics: chloramphenicol (Cm; 10 �g ml�1), kanamycin (Km; 25 �g ml�1),and streptomycin (Sm; 50 �g ml�1).

Molecular biology and bioinformatics. Standard procedures wereused for plasmid isolation, restriction digestion, cloning, and transforma-tion. Conjugal transfer of plasmids to B. pertussis strains was performedwith the E. coli SM10�pir strain (23, 24). Bordetella transconjugants wereselected on BG agar containing the appropriate antibiotics. Sequenceanalysis was performed and homology was investigated by using the BLAST(available from the NCBI website and PATRIC) and Clustal W (available atthe Biology Workbench at the San Diego Supercomputing Center) programs,and pairwise alignments were conducted at uniprot.org.

Deletion of the dra locus. An in-frame nonpolar deletion in the dralocus in the B. pertussis Bp536 WT strain was constructed using a previ-ously published allelic exchange method (25). A 378-bp MfeI-HindIIIfragment spanning regions 5= to and including the first 25 codons of draDwas amplified from Bp536 genomic DNA using the primers dra5AMfeIand dra3AHindIII (Table 2). A 509-bp fragment containing regions 3= toand including the last 17 codons of draA was similarly amplified usingprimers dra5BHindIII and dra3BBglII. A three-way ligation containingthe MfeI-HindIII- and HindIII-BglII-digested PCR fragments along withthe EcoRI-BamHI-digested allelic exchange vector pSS4245 (25) (a gen-erous gift from Scott Stibitz, Center for Biologics Evaluation and Re-search, FDA) was carried out, resulting in plasmid pNKT4. This plasmidwas then introduced into the Bp536 chromosome by mating withSM10�pir cells on BG agar containing 50 mM MgSO4 (Bvg�-phase con-ditions) for 6 to 8 h. Cointegrants were selected and colony purified on

BG-Sm-Km agar containing 50 mM MgSO4. To allow secondary cross-over events to occur, cointegrants were streaked on BG plates withoutMgSO4 (Bvg�-phase conditions) and grown for 2 to 3 days at 37°C. Dou-ble-crossover recombinants were then restreaked on BG-Km and BG-Sm.Colonies that were streptomycin resistant but kanamycin sensitive con-tained putative deletions. The identity of the deletions was verified byPCR, followed by DNA sequencing of the PCR products.

Genetic complementation of the dra locus. A 4,611-bp fragmentcontaining the entire dra locus plus 38 bp upstream of the putative trans-lational start site of draC and 458 bp downstream of the terminationcodon of draA was amplified from Bp536 chromosomal DNA with prim-ers cdltAFKpn1 and cdltARXba1 by PCR utilizing Pfu DNA polymerase.The resulting PCR fragment containing flanking KpnI and XbaI restric-tion sites was cloned into the corresponding sites of plasmid pBBR1MCS(26), resulting in the complementation plasmid pNKT7. This plasmid wastransformed into DH5��pir and subsequently mobilized into the �drastrain as described above.

Antimicrobial peptide killing assays. B. pertussis strains were grownto logarithmic phase (optical density at 600 nm [OD600], �1.0) in SSmedium at 37°C under shaking conditions. The bacterial cells were thenharvested by centrifugation (5 min, 5,000 rpm), washed with 10 mMsodium phosphate buffer (pH 7.0), and resuspended in the same buffer.For AMP killing assays under physiological conditions, SS medium andDulbecco modified Eagle medium (DMEM) were used instead of the so-dium phosphate buffer. Serial dilutions of antimicrobial peptides wereprepared in 10 mM sodium phosphate buffer. Bacteria (106) were incu-bated with the concentrations of AMPs indicated below for 2 h at 37°C ona rotator, and appropriate dilutions were plated on BG agar plates con-taining Sm for colony counting. Percent survival was determined by di-viding the number of CFU recovered after AMP treatment by the numberof CFU recovered from nontreated controls. Each experiment was per-formed in triplicate.

Binding of cationic proteins and peptides. The ability of B. pertussisstrains to bind positively charged proteins and peptides was determinedon the basis of the method previously reported (26). Briefly, stationary-phase bacteria were harvested by centrifugation, washed twice with phos-phate-buffered saline (PBS), and resuspended in 0.1 M HEPES buffer, pH7.0, to an OD600 of 1.0. Cytochrome c (Sigma) was added to a final con-centration of 500 �g/ml, whereas fluorescein-labeled LL-37 and fluores-cein isothiocyanate (FITC)-labeled poly-L-lysine (Sigma) were added at aconcentration of 20 �g/ml. After incubation for 10 min at room temper-ature, bacteria were centrifuged at 13,000 rpm for 5 min, washed twicewith PBS, and then resuspended in PBS. To assess the relative amount ofcytochrome c bound to each B. pertussis strain, the absorbance at 530 nmof the cell suspension was measured. The fraction of fluorescein-labeledLL-37 and FITC-labeled poly-L-lysine associated with the bacterial sus-pension was determined by measuring the fluorescence (excitation at 480nm and emission at 520 nm for LL-37 and excitation at 500 nm andemission at 530 nm for poly-L-lysine).

To obtain LL-37 peptide with a single fluorescein at the N terminus,LL-37 (AnaSpec) was dissolved in distilled H2O at 1 mg/ml, and 100 �lwas incubated with 0.5 mM 5 (and 6)-carboxyfluorescein succinimidylester (Molecular Probes) for 1 h at room temperature in 50 mM potas-sium phosphate, pH 7.0. Fresh 5 (and 6)-carboxyfluorescein succinimidylester was then added to a final concentration of 1 mM and the reaction wasallowed to proceed for another hour. Fluorescein-labeled LL-37 precipi-

TABLE 1 Bacterial strains and plasmids

Strain or plasmid CharacteristicsReference orsource

StrainsB. pertussisBp536 WT reference strain Laboratory stock�dra Bp536 derivative containing an in-frame deletion

in the draABUDC locusThis study

�dravec �dra strain containing vector plasmid pBBR1MCS This study�dracomp �dra strain containing pNKT7, the draABUDC

complementation plasmidThis study

E. coli DH5��pir F� 80lacZ�M15 �(lacZYA-argF)U169 deoRrecA1 endA1 hsdR17(rK

� mK�) phoA supE44

thi-1 gyrA96 relA1 � pir

62

SM10�pir Conjugation strain 24

PlasmidspBBR1MCS Broad-host-range plasmid; Cmr 26pSS4245 Allelic exchange vector; Kmr Ampr 25pNKT4 draABUDC locus of Bp536 cloned in the pSS4245

vectorThis study

pNKT7 draABUDC locus cloned in pBBR1MCS This study

TABLE 2 Primers

Primer Sequence (5= to 3=)

dra5AMfe I CCCGCAATTGTATATGCCTGACGAGGCAAdra3AHindIII CCCAAGCTTCGGGTGCACCAACGCACTGAGdra5BHindIII CCCAAGCTTGACCGCAAGAAGCTGCTGGAAdra3BBglII CGGGGTACCGCTGGCACGCGCCATCTACCAcdltAFKpnI CGGGGTACCGTATATGCCTGACGAGGCAAcdltARXbaI TGCTCTAGAGCTGGCACGCGCCATCTACCA

Bordetella pertussis Resistance to AMPs and Phagocytes

November 2013 Volume 195 Number 22 jb.asm.org 5103

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

tated out of solution and was collected by centrifugation for 5 min at14,000 rpm. The peptide was washed 3 to 4 times with 25 mM potassiumphosphate, pH 7, and resolubilized in 150 �l 50% ethanol-water. Thepeptide molecular weight was determined using a Bruker Autoflex ma-trix-assisted laser desorption ionization–time of flight mass spectrometerusing sinapinic acid as the matrix and indicated that 50 to 80% of theLL-37 peptide was singly labeled with fluorescein.

Preparation of total membranes for D-alanine incorporation assay.Stationary-phase cultures of B. pertussis strains were centrifuged at 6,000rpm for 20 min, and the cell pellets were resuspended in cell disruptionbuffer (10 mM Tris-HCl [pH 8.0], 20% sucrose, 1 mM EDTA, 0.1 mg/mllysozyme, 1 mM phenylmethylsulfonyl fluoride). After incubation on icefor 10 min, the samples were frozen in dry ice and then thawed in coldwater. The bacterial suspension was sonicated on ice and centrifuged at12,000 rpm for 10 min to pellet unlysed cells. The clarified suspensionobtained after the first centrifugation step was centrifuged at 25,000 rpmfor 1 h, and the pellet (total membrane fraction) was resuspended in cold10 mM Tris-HCl (pH 8.0). The protein content was estimated using thestandard Bradford assay, and 100 �g of total protein was used for eachsample of the D-alanine incorporation assay.

D-Alanine incorporation assay. Incorporation of D-alanine was per-formed as described previously (27). The reaction mixture contained 25mM MgCl2, 5 mM ATP, 0.07 mM D-[14C]alanine (36 mCi/mmol), 30 mMTris-HCl (pH 7.5), and 100 �g of the total membrane fraction in a finalvolume of 50 �l. The reaction mixtures were incubated at 37°C for 30 min,after which the reaction was terminated by addition of ice-cold buffer (5mM Tris-Cl, pH 7.8, 10 mM MgCl2). Samples were centrifuged at 30,000rpm for 1 h at 4°C. The pellet was washed 3 to 4 times with 10 volumes ofice-cold termination buffer. The final washed membranes were resus-pended in the termination buffer and filtered through a 0.45-�m-pore-size membrane filter, followed by washing of the filter one time withtermination buffer. The filter was dissolved in the scintillation fluid,and radioactivity was measured in a Wallac 1209 Rack beta scintilla-tion counter.

Cellular fractionation and isolation of cellular components. For sep-aration of inner and outer membrane components, the radiolabeledmembranes were incubated with 2% Triton X-100 in the presence of 10mM MgCl2 for 30 min on ice and then centrifuged at 17,000 rpm for 1 h,as described by us earlier (28). The pellet (detergent insoluble) repre-sented the outer membrane fractions, while the supernatant representedthe inner membrane fractions. The relative radioactivity in each fractionwas measured in a scintillation counter.

For extraction of polysaccharides, including lipooligosaccharide(LOS), the radiolabeled membranes were resuspended in 100 �l of 0.5 MEDTA, pH 8.0, and 2% SDS and boiled for 5 min at 100°C, followed byovernight treatment with proteinase K (1 mg/ml) at 37°C. Proteinase Kwas heat inactivated by incubating for 30 min at 90°C. To the aqueoussolution, 2.5 volumes of ethanol and 0.3 M of sodium acetate were added.The mixture was incubated at �80°C for 2 h, followed by centrifugation at16,000 rpm for 30 min. The supernatant was collected. The pellet waswashed with 70% ethanol and air dried. The radioactivity associated withthe pellet and that associated with the supernatant were separately mea-sured in the scintillation counter.

Murein was extracted from the radiolabeled total membranes as theSDS-insoluble material (29). Radiolabeled membranes were resuspendedin 8% SDS, boiled at 100°C for 30 min, and centrifuged at 130,000 rpm for1 h. The insoluble residue was reextracted twice by boiling in 4% SDS. Themurein sacculus prepared in this way was washed twice with water andonce with 2 M NaCl. The final insoluble residue represented the SDS-resistant murine sacculus.

To demonstrate the integrity of the different extraction procedures,assays for specific components were performed. To confirm that pureouter membranes were obtained, the outer membrane pellet was sepa-rated by PAGE, followed by Western blotting to probe for BcfA (an outermembrane protein) and for BvgA (a cytoplasmic protein) (28). While

BcfA was detected in the pellet fractions, BvgA was not detected (data notshown).

For determination of the LOS content in the pellet obtained afterboiling in SDS-EDTA, the Limulus amoebocyte lysate (LAL) assay wasconducted. The endotoxin concentration was found to be 0.35 �g/ml ofculture at an OD600 of the WT and �dra strains.

For quantification of peptidoglycan, we measured the levels of di-aminopimelic acid (DAP), an amino acid present in the cell wall of B.pertussis (30, 31). Briefly, the pellet containing the peptidoglycan fractionwas acid hydrolyzed for 16 h at 95°C, followed by the addition of HCOOHand ninhydrin reagent to the hydrolyzed sample and incubation at 37°Cfor 1.5 h. The A440 was measured and compared with standards to deter-mine the DAP content. The pellet fraction contained 80 ng/ml of cultureat the OD600 of DAP. DAP was undetectable in the supernatant fraction.

PMN killing assay. B. pertussis strains were grown to logarithmicphase (OD600 1) and then harvested by centrifugation (8,000 rpm, 5min at room temperature). Human PMNs were purified from the periph-eral blood of healthy human donors by discontinuous plasma-Percollcentrifugation, in accordance with a Wake Forest School of MedicineInstitutional Review Board-approved protocol. Bacteria (5 � 106) resus-pended in PBS were incubated with PMNs (at multiplicities of infection of1:1 and 1:5) at 37°C for 1.5 h in a 24-well plate. After incubation, PMNswere lysed for 30 min on ice by the addition of 0.01% saponin. Bacterialcells were harvested from the wells by vigorous pipetting in 0.01% saponinand then plated as serial dilutions on BG agar plates containing strepto-mycin. The inoculum unexposed to PMNs served as the control (un-treated bacteria). Percent killing was calculated using the following for-mula: 100 � [(cu � ct)/cu], where cu represents the number of CFU ofuntreated bacteria and ct represents the number of CFU of bacteria treatedwith PMNs.

Microscopy. For determining differences in morphology, the WTand �dra strains were grown to stationary phase (OD600 4). Analiquot of the bacterial suspension was spotted on a glass coverslip,heat fixed, and visualized with either a light or an electron microscope.For light microscopy, a �100 oil immersion lens was used. Electronmicroscopic analysis was carried out by adsorbing bacteria onto car-bon-coated gold grids (Electron Microscopy Sciences, PA) in a humid-ified chamber for 1 h, followed by fixing with 2.5% glutaraldehyde andnegative staining with 2% phosphotungstic acid (pH 6.6). The imageswere analyzed with a Technai transmission electron microscope at amagnification of �30,000.

RESULTSThe Bordetella dra locus. Scanning of the genome sequence of B.pertussis strain Tohama I revealed the presence of homologs(BP2987 to BP2991) of the dlt loci of Gram-positive bacteria (Fig.1). In addition to Tohama I, dlt homologs were also identified inthe genomes of other classical Bordetella spp., B. bronchisepticastrain RB50 (BB4380 to BB4384) and B. parapertussis strain 12822(BPP3907 to BPP3911) (32) (Fig. 1). In Gram-positive bacteria,the dltABCD loci catalyze the incorporation of D-alanine estersinto teichoic acid (32–35). Gram-negative bacteria lack teichoicacid. Thus, the Bordetella loci must modify a different componentof B. pertussis. Based on the phenotypic characterization presentedbelow and to distinguish these loci from the dlt loci of Gram-positive bacteria, we have named these loci dra for their role inD-alanine incorporation and resistance to AMPs.

Sequence analysis of the gene products of the Bordetella dralocus. The Bordetella dra loci consist of five open reading frames(ORFs) and have an identical gene organization. The five dra genesfrom the three species shown at the top of Fig. 1 encode proteins with98 to 100% amino acid sequence identity between homologs. Theorder of the Bordetella dra genes (draCDUBA) differs from that of thedlt genes (dltABCD) generally found in Gram-positive bacteria, ex-

Taneja et al.

5104 jb.asm.org Journal of Bacteriology

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

cept in the case of Clostridium difficile, where the dlt genes are ar-ranged in the order dltDABC (Fig. 1) (36).

On the basis of the activities of some of the proteins from thedlt loci of Gram-positive organisms, putative biochemical func-tions can be attributed to several of the Dra proteins. For example,the Bordetella draA genes are homologous (34 to 37% identity atthe amino acid level for these 477- to 504-residue proteins) to thedltA genes, which code for DltA, an ATP-dependent D-alaninetransferase and ligase. DltA both adenylates D-alanine (activatingit with an AMP group) and transfers the alanyl group to theD-alanyl carrier protein, DltC (37).

draC, corresponding to dltC, is relatively more divergent (with�15% amino acid identity between DraC and DltC from Bacilluscereus) but is always 73 to 79 amino acids in length and aligns wellwith acyl carrier proteins in multiple-sequence alignments (in-cluding conservation around the phosphopantetheinylated Serresidue at position 37, within a DS motif including hydrophobicresidues on each side). Thus, DraA and DraC are expected to playroles analogous to those of DltA and DltC in preparing the D-ala-nyl group for transfer.

draB encodes a 375-amino-acid protein homologous to thedltB gene products (with 28% amino acid identity between DraBand B. cereus DltB and with lengths ranging from 372 to 395 resi-dues across species). On the basis of the proposed function ofDltB, DraB may similarly act as a transmembrane protein sup-

porting the transport of the activated D-alanyl group across theinner membrane (37). DltB/DraB proteins are in some cases an-notated as membrane-bound O-acyltransferases.

draD, encoding a 375-amino-acid protein, is homologous tothe dltD gene products (ranging from 375 to 395 residues acrossspecies). DraD aligns convincingly with DltD proteins (includinga conserved GSSEXXXXD motif near the N terminus) but is moredivergent from its Gram-positive counterparts than DraA andDraB (�19% identity between DraD and DltD proteins). Thismay reflect the difference in the identity of the membrane-associ-ated alanyl acceptor, which in Gram-positive organisms is lipo-teichoic acid.

A distinctive feature of the Bordetella dra operons is the pres-ence of a small, conserved ORF (BP2989/BB4382/Bpp3909) en-coding a hypothetical 41-amino-acid protein. Some Gram-posi-tive bacteria harbor small ORFs (e.g., dltX in C. difficile) near thedlt genes (Fig. 1) (32, 36, 38). The small ORF present in Bordetellaspp. did not display any significant similarity to dltX or to anyother bacterial ORFs. To distinguish it from the dltX genes andbecause of its unknown function, we have designated this ORFdraU.

Deletion of the dra locus and growth characteristics. To in-vestigate the function of the dra locus in B. pertussis, we gener-ated an in-frame deletion by utilizing allelic exchange, whichresulted in the deletion of a 4.6-kb region of the dra locus

FIG 1 Comparison of dra and dlt loci in Bordetella and other Gram-positive and Gram-negative bacteria. Shown are the organizations of the dra and relatedoperons in different bacterial species. The species shown in the figure (in order of relatedness to the B. pertussis dra locus) and used in sequence comparisons areB. pertussis strain Tohama I, B. bronchiseptica strain RB50, B. parapertussis strain 12822, Achromobacter xylosoxidans A8, B. avium 197N, Acidovorax avenae subsp.avenae ATCC 19860, Delftia acidovorans SPH-1, Dickeya dadantii Ech586, Enterobacter cloacae SCF1, Pectobacterium wasabiae WPP163, Bacillus cereus ATCC14579, Clostridium difficile 630, and Vibrio cholerae ATCC 39315. Homologous genes use the same patterns across species. The black arrow for V. choleraerepresents a lipid A transacylase. The region of the dra operon deleted in the �dra strain is shown at the top.

Bordetella pertussis Resistance to AMPs and Phagocytes

November 2013 Volume 195 Number 22 jb.asm.org 5105

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

(Fig. 1). Following construction of the mutant strain, we exam-ined the effect of dra deletion on the phenotypic characteristicsof B. pertussis. There were no notable differences in the growthrate between the WT and �dra mutant when they were grownin SS broth, as the strains reached similar optical densities (datanot shown). Compared to the WT strain, the �dra mutant didnot display any significant alterations in colony size or appear-ance on BG agar plates (data not shown). Aberrant cell shapeswere also not observed either by light microscopy or by elec-tron microscopy (Fig. 2A and B).

The dra locus is required for resistance to human AMPs,proteins, and polymyxin B. The microbicidal activities of humandefense proteins, peptides, and the peptide antibiotic polymyxin Bagainst the Bp536 WT strain of B. pertussis and the �dra mutantwere tested using viable count analysis. HNP-1 and HNP-2 arehuman proteins that belong to the �-defensin family of antimi-crobial peptides. These are abundant in human neutrophils andare also expressed in the respiratory tract (39, 40). The SPLUNC1(short palate, lung, nasal epithelium clone 1) protein is a crucialcomponent of innate immunity and is highly expressed in the oralcavity and respiratory tract of humans and many other mammals(41–43). Human CAP18/LL-37 (hCAP18/LL-37) is a prototypemember of the human cathelicidin family and is produced byneutrophils, macrophages, and various epithelial cells (44).

As shown in Fig. 3, Bp536 was markedly resistant to HNP-1,HNP-2, and human SPLUNC1 (hSPLUNC1). Concentrations ashigh as 50 �g/ml of HNP-1 and HNP-2 and 10 �g/ml ofhSPLUNC1 resulted in little or no killing of Bp536. While higherconcentrations of hSPLUNC1 (25 �g/ml) were effective in killingof Bp536, �34% of the input bacteria still survived (Fig. 3C).Compared to the results for these AMPs, lower relative amounts ofLL-37 and polymyxin B were required to kill Bp536 (Fig. 3D andE). Taken together, these results confirm and expand the previousobservations of B. pertussis displaying various levels of resistanceto structurally different antimicrobial peptides (16–18).

Compared to the WT strain, the �dra mutant was killed ingreater numbers at relatively lower concentrations of all the AMPstested (Fig. 3A to E). Complementation of the dra locus in themutant strain harboring plasmid pNKT4 containing the dra locus(�dracomp) increased the level of resistance of the mutant strain toLL-37 (Fig. 3D) and polymyxin B (Fig. 3E) toward that observedfor the WT strain. As expected, the presence of the vector plasmid(pBBR1MCS) in the �dra strain (�dravec) did not have a signifi-cant effect on the susceptibility of the mutant strain. As expectedfrom the growth experiments described above, there were no dif-ferences in the growth rates between the �dravec and �dracomp

strains (data not shown).

The AMP susceptibility assays described above were conductedusing low salt concentrations (10 mM sodium phosphate), condi-tions typically used for AMP assays. Although several AMPs, in-cluding LL-37, are highly active in phosphate buffer, these displaysignificant reductions in activity or are inactive in the presence ofbiological concentrations of monovalent and divalent cations andin tissue culture medium (45, 46). In an attempt to mimic theseconditions, we tested the activity of LL-37 in DMEM and SS me-dium. DMEM is used as a standard tissue culture medium andcontains physiological concentrations of Na� ion (greater than100 mM), Ca2�, and Mg2�. SS medium is used as an optimalgrowth medium for B. pertussis and has concentrations of Ca2�,Mg2�, and monovalent ions similar to those found in human lungsecretions (16). Compared to 10 mM phosphate buffer (Fig. 3D),where low concentrations of LL-37 were effective in significantkilling of the WT strain, concentrations as high as 5 �g/ml ofLL-37 did not result in any observable killing in DMEM (Fig. 4A).In contrast, only 39%, 21%, and 19% of the mutant strain sur-vived at 0.05, 1, and 5 �g/ml of LL-37, respectively (Fig. 4A).Similarly, larger amounts of LL-37 were needed for significantkilling of the WT strain when incubated in the SS medium. Incomparison, the mutant strain was more sensitive to killing byLL-37 than the WT strain in SS medium (Fig. 4B). Taken together,these results demonstrate that the dra locus promotes the AMPresistance of B. pertussis under low-salt conditions and under invitro conditions which mimic those found in human lungs.

Absence of the dra locus results in increased binding to cat-ionic protein and peptides. One of the mechanisms by whichbacteria resist cationic AMPs is by reducing the net negativecharge of the bacterial cell surface, thereby repelling cationicAMPs (12, 47). To determine if the increased susceptibility of the�dra mutant to AMPs was due to an altered surface charge, theabilities of the WT, �dra, �dravec, and �dracomp strains to bindcationic protein cytochrome c (47) and peptides (poly-L-lysineand LL-37) were compared. As shown in Fig. 5, the �dra mutantbound significantly more of all three cationic molecules than theWT strain. As expected, the binding of these molecules to the�dracomp strain was lower than that of the �dra and �dravec

strains. These results suggest that the dra locus contributes to theAMP resistance of B. pertussis by decreasing the net negative sur-face charge.

The dra locus is important for resistance to killing of B. per-tussis by human PMNs. The antimicrobial potential of PMNsdepends in part on the microbicidal action of AMPs (48). Basedon the in vitro hypersusceptibility of the �dra strain to AMPs, wehypothesized that the dra locus promotes resistance to PMN-me-diated killing. To test this hypothesis, we evaluated the survival of

FIG 2 Deletion of the dra locus has no effect on cell morphology of B. pertussis. Phase-contrast (A) or electron (B) micrographs of bacterial cells after 72 h ofgrowth are shown.

Taneja et al.

5106 jb.asm.org Journal of Bacteriology

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

the WT and �dra strains exposed to human PMNs. Compared tothe WT strain, the �dra strain was killed in greater numbers byPMNs (Fig. 6). Complementation of the dra locus in the mutantstrain (�dracomp) resulted in enhanced survival, whereas the pres-

ence of the vector plasmid in the �dra strain (�dravec) did nothave a significant effect on the survival of the mutant strain. Theseresults suggest that dra promotes the resistance of B. pertussis toPMN-mediated killing.

FIG 3 The dra locus promotes resistance to antimicrobial peptides. The susceptibilities of the WT, �dra, �dravec, and �dracomp strains to various antimicrobialpeptides were assessed. Bacteria (1 � 106 CFU) were incubated in 10 mM sodium phosphate buffer with the indicated concentrations of AMPs for 2 h. Bacterialnumbers were determined by plate counts on BG agar. Each data point represents the mean and standard deviation of triplicates from one of three independentexperiments. *, P � 0.05 compared with the untreated control based on Student’s t test. The number 0 on top of the bars in some panels indicates the lack of anydetectable bacterial growth. PmB, polymyxin B.

FIG 4 Sensitivities of the WT and the �dra strains to LL-37 under physiologically relevant conditions. Bacteria (1 � 106 CFU) were incubated in either DMEM(A) or SS medium (B) with the indicated concentrations of LL-37 for 2 h. Bacterial numbers were determined by plate counts on BG agar. Data represent the meanand standard deviation of triplicates from one of three independent experiments. *, P � 0.05.

Bordetella pertussis Resistance to AMPs and Phagocytes

November 2013 Volume 195 Number 22 jb.asm.org 5107

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

The dra locus is involved in the incorporation of D-alanineinto B. pertussis. Given the homology among gene products ofthe dra and dlt loci, we asked if dra is involved in the incorporationof D-alanine into B. pertussis. To answer this question, we utilizeda previously described assay (27) that measures the incorporationof D-[14C]alanine into purified bacterial membrane fragments.Membrane fragments prepared from the �dra mutant incorpo-rated smaller amounts of D-alanine than membrane fragmentsprepared from the WT strain (Table 3). The Dra-dependent in-corporation of D-alanine into B. pertussis membranes accountedfor 54% of the total D-alanine incorporation (comparing the WTstrain with the �dra mutant). Boiled membranes from either theWT or the �dra strain incorporated very small amounts ofD-[14C]alanine, and the counts per minute incorporated weresimilar to the background levels of radioactivity (Table 3).

Membrane fractionation demonstrates the dra-dependentD-alanylation of a protease-susceptible outer membrane com-ponent of B. pertussis. Four kinds of fractionation of the purifiedmembranes were conducted to clarify the type of molecule thatserves as the D-alanine acceptor in the dra system, as describedbelow.

(i) Triton X-100 (2%) extraction. The total radiolabeled mem-

brane fragments were extracted with 2% Triton X-100, a reagentthat leads to solubilization of the inner membrane components,leaving the remainder of the outer membrane (OM) componentsin the pellet. Comparison of the WT strain with the dra mutantrevealed that essentially all of the dra-dependent D-alanine incor-poration was found in the pellet, suggesting that an OM compo-nent of B. pertussis is modified by Dra-dependent D-alanylation(Table 3).

(ii) Boiling with 8% SDS. D-Alanine is one of the componentsof the B. pertussis peptidoglycan (30, 31). To determine if the dralocus led to the incorporation of D-alanine into B. pertussis pepti-doglycan, murein was extracted from radiolabeled membranefragments as the 8% SDS-insoluble fraction after boiling (29). Themajority of the D-alanine incorporated into membranes in theabsence of dra (�dra strain) was found in the supernatant afterSDS extraction. In the WT strain containing the dra locus, whilethere was a moderate increase of approximately 200 cpm in thepeptidoglycan-containing pellet, there was an increase of about1,000 cpm in the supernatant. This result thus suggests that dra

FIG 5 Interaction of B. pertussis with positively charged protein and peptides. The B. pertussis strains were treated with cytochrome c (A), fluorescein-labeledLL-37 (B), or FITC-labeled poly-L-lysine (C) and washed twice with PBS, and then the cells were resuspended in PBS. The amount of peptide or protein associatedwith each B. pertussis cell suspension was measured by determination of the absorbance or fluorescence, as described in Materials and Methods. Data areexpressed as the percentage of the signal from the B. pertussis suspension compared to the signal from the input protein or peptide. **, P � 0.01.

FIG 6 The dra locus promotes the resistance of B. pertussis to killing by humanPMNs. B. pertussis WT, �dra, �dravec, and �dracomp strains were incubatedseparately with PMNs at multiplicities of infection of 1:1 and 1:5 for 1.5 h.Bacterial survival was calculated by the number of CFU recovered after incu-bation with PMNs divided by the number of CFU recovered from untreatedcontrols. Each data point represents the mean and standard deviation of trip-licate samples from one of three independent experiments. **, P � 0.01.

TABLE 3 Incorporation of D[14C]alanine into various cellular fractionsof B. pertussis WT and �dra strains

Fraction or treatment

cpm (100 �g protein)a

P valueWT �dra mutant

Total membranes 1,056 7 484 36 �0.005Boiled membranes 48 6 41 7 NS2% Triton X-100

Initial counts (total membranes) 1,208 144 502 62 �0.05Supernatant 330 42 247 88 NSPellet 812 66 384 129 �0.05

8% SDSInitial counts (total membranes) 2,137 30 781 45 �0.001Supernatant 1,664 24 632 60 �0.001Pellet 328 11 135 28 �0.001

SDS-EDTA boilingTotal membranes 1,056 71 484 36 �0.005Supernatant 1,110 62 482 219 �0.05Pellet 108 66 85 66 NS

Proteinase KInitial counts (total membranes) 1,056 71 484 37 �0.005Supernatant 587 132 182 50 �0.05Pellet 184 26 103 22 �0.05

a Representative data from one of at least two to three independent experiments areshown.NS, not significant.

Taneja et al.

5108 jb.asm.org Journal of Bacteriology

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

does not catalyze the incorporation of D-alanine into B. pertussispeptidoglycan.

(iii) SDS-EDTA boiling. Boiling the membrane-containingpellet in the presence of SDS and EDTA followed by proteinase Ktreatment and precipitation with ethanol is a frequently utilizedmethod to purify polysaccharides, including lipopolysaccharides(LPSs) from the pellet fraction (49). Very little of the radioactivity,if any, was incorporated in the pellet fractions obtained from theSDS-EDTA-extracted membrane preparations of either the WTor the dra mutant. This result indicates that D-alanine is not in-corporated into either the LPS or other SDS-EDTA-extractablepolysaccharides of B. pertussis.

(iv) Proteinase K treatment. Incubation of the radiolabeledtotal membrane fragments with proteinase K, which cleaves pep-tide bonds, revealed that most of the increase in D-alanine incor-poration in the presence of the dra locus (i.e., in the WT strain)was in the supernatant after protease treatment, suggesting thatthe acceptor molecule(s) modified by the dra system includes pro-teinase K-susceptible peptide bonds and may be either a protein oranother peptide-containing complex macromolecule.

Taken together, these results suggest that the dra locus ismainly involved in the incorporation of D-alanine into a protei-nase K-susceptible OM component that is not part of the B. per-tussis peptidoglycan.

DISCUSSION

Antimicrobial peptides constitute a crucial first line of humaninnate host defenses. AMPs work in concert with other clearanceand barrier mechanisms of epithelial surfaces to help maintain thelower respiratory tract and other mucosal surfaces free from in-fection. Despite these antibacterial strategies, upon entry into thehost, pathogens easily circumvent these defenses and rapidly mul-tiply, resulting in a full-blown infection. This is true also for B.pertussis, which, upon natural infection of humans and experi-mental infection of animals, rapidly replicates in the respiratorytract. In mice, B. pertussis is able to maintain infections in themouse respiratory tract for longer than a month (50). One expla-nation for this is that like other bacterial pathogens, B. pertussis isable to counter the action of AMPs by having developed efficientresistance mechanisms.

We investigated in this work a previously uncharacterized B.pertussis locus that is similar in amino acid sequence to the se-quences of dlt operons. Inactivation of the B. pertussis dra operonresulted in enhanced sensitivity to several host defense peptides,including (i) those with a �-sheet structure and disulfide bridges,such as HNP-1 and HNP-2; (ii) the �-helical peptide LL-37; (iii)the cyclic amphipathic peptide antibiotic polymyxin B; and (iv)hSPLUNC1, a human defense protein with structural similaritiesto the BPI family of proteins. The dra mutant was also stronglyimpaired in its ability to survive in human PMNs. Since LL-37,HNP-1, and HNP-2 are representative antibacterial peptides fromneutrophil-specific granules, these results imply that the B. pertus-sis dra locus protects against neutrophil-mediated killing by con-ferring AMP resistance. The increased sensitivity of the dra mu-tant toward structurally diverse AMPs led us to carry outexperiments which demonstrated that the absence of the dra locusreduced the binding of three positively charged proteins and pep-tides to the B. pertussis cell surface. Since the common structuralfeature of many of the AMPs examined in this study is a net pos-itive charge, we propose that the mechanistic basis for the in-

creased AMP sensitivity of the dra mutant is altered electrostaticAMP-cell interactions.

The results obtained in this study showed that the dra locus isnot of major importance for the basic cell physiology of B. pertus-sis. Unlike dlt mutants of some Gram-positive bacteria (32, 38, 51,52), morphological alterations like the presence of aberrant shapeswere not observed. The dra mutant also did not show any signif-icant differences in growth characteristics in standard B. pertussisgrowth medium. Taken together, these data suggest that growthand morphological differences are not responsible for the ob-served defect in the survival of the mutant strain in PMNs.

Earlier work by Abi Khattar et al. with the dlt system fromBacillus cereus included the identification of similar genes fromGram-negative organisms, including the three Bordetella spe-cies described here that infect mammals, as well as Erwiniacarotovora subsp. atroseptica SCRI1043 and Photorhabdusluminescens TT01 (32). Our sequence searches have identifieddra homologs in several additional Gram-negative pathogenswith a wide host range comprised of plants, animals, birds, andhumans (Fig. 1). In addition to the three Bordetella spp. thatinfect mammalian hosts, a dra homolog was also identified inanother Bordetella spp., B. avium, which is the causative agentof bordetellosis in birds (53) (Fig. 1). Dra homologs were alsoidentified in the betaproteobacterium Achromobacter xylosoxi-dans, an opportunistic human pathogen that has been linked toa variety of human diseases (54); the lambdaproteobacteriumDickeya dadantii, a phytopathogen (55, 56); and Enterobactercloacae, a component of the normal flora of the gastrointestinaltract that causes opportunistic infections (57). Two additionalbetaproteobacteria (Acidovorax avenae and Delftia acido-vorans) were found to include in their genomes only two of thefive genes, which were similar to draA and draC (Fig. 1). Inter-estingly, a partially homologous system was recently identifiedin the Gram-negative pathogen Vibrio cholerae and includedDltA and DltC-like proteins (designated AlmE and AlmF, re-spectively), yet no DltB or DltD-like components were encodedwithin the operons (58). Instead, an additional gene in thisoperon encodes AlmG, a lipid A transacylase that incorporatesa glycyl (or glycyl-glycine) group into one of the fatty acidchains of lipid A in that organism. It is striking that this Almsystem in V. cholerae is more distantly related to the Dra sys-tems of other Gram-negative bacteria (�20% amino acid iden-tity between DraA and AlmE) than the Gram-positive Dlt sys-tem is to the Dra system (�35% amino acid identity betweenDraA and DltA from B. cereus) (Fig. 7).

The discovery of these homologs in Bordetella and other Gram-negative bacteria begs the question about the identity of the sur-face molecule(s) that is being modified. While teichoic acids arecommon components of the cell wall membrane of a large num-ber of Gram-positive bacteria, these are not found in Gram-neg-ative bacteria.

We show herein that membranes from the �dra mutant incor-porated smaller amounts of D-[14C]alanine than membranes fromthe WT strain of B. pertussis did and that a large proportion ofD-alanine was incorporated into the B. pertussis outer membrane.The major D-alanine-containing polymer in B. pertussis is pepti-doglycan. However, this is expected to rely on a metabolic path-way that is distinct from the dra locus (30, 31, 59). In agreementwith this, the fractionation of D-[14C]alanine-labeled membranesby boiling in 8% SDS revealed that little of the dra-specific radio-

Bordetella pertussis Resistance to AMPs and Phagocytes

November 2013 Volume 195 Number 22 jb.asm.org 5109

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

activity was contained in the SDS-insoluble peptidoglycan frac-tion. As is true for other Gram-negative bacteria, LPS is anothermajor cell surface glycopolymer of Bordetella spp. D-Alanine wasnot identified as a component of the Bordetella LPS (60), and dataobtained here demonstrate the lack of any significant incorpora-tion of D-[14C]alanine into B. pertussis LPS and other polysaccha-rides extractable by SDS-EDTA. We found that a large portion ofthe membrane-incorporated radioactivity could be digested andreleased into solution by the serine protease proteinase K frompelletable membranes. Taken together, these results suggest thatdra is involved in the incorporation of D-alanine into an outermembrane component that is susceptible to cleavage by protei-nase K. In the Gram-positive organism B. subtilis, the presence ofD-alanine in a covalent linkage to two unidentified cellular pro-teins was detected, but further characterization of these D-alany-lated proteins was not pursued (61). Precise identification of the B.pertussis surface component modified by the dra locus awaits fur-ther experimentation.

In summary, our results constitute the identification of a pre-viously unknown mechanism of immune resistance in a Gram-negative pathogen, B. pertussis. Continued research will enhanceour understanding of infections caused not only by B. pertussisand other members of the Bordetella spp. but also by several otherGram-negative bacterial pathogens with a wide host range whichmay utilize similar modifications of their surface component as ameans to develop immune resistance.

ACKNOWLEDGMENT

Research in the laboratory of R.D. is supported by funds from the NIH(grant no. 1R01AI075081).

REFERENCES1. Mattoo S, Cherry JD. 2005. Molecular pathogenesis, epidemiology, and

clinical manifestations of respiratory infections due to Bordetella pertussisand other Bordetella subspecies. Clin. Microbiol. Rev. 18:326 –382.

2. Centers for Disease Control and Prevention. 2002. Pertussis—UnitedStates, 1997-2000. JAMA 287:977–979.

3. Centers for Disease Control and Prevention. 2012. Pertussis epidemic—Washington, 2012. MMWR Morb. Mortal. Wkly. Rep. 61:517–522.

4. Mooi FR. 2010. Bordetella pertussis and vaccination: the persistence of agenetically monomorphic pathogen. Infect. Genet. Evol. 10:36 – 49.

5. McNabb SJ, Jajosky RA, Hall-Baker PA, Adams DA, Sharp P, AndersonWJ, Javier AJ, Jones GJ, Nitschke DA, Worshams CA, Richard RA, Jr.

2007. Summary of notifiable diseases—United States, 2005. MMWRMorb. Mortal. Wkly. Rep. 54:1–92.

6. Yeh SH, Mink CM. 2006. Shift in the epidemiology of pertussis infection:an indication for pertussis vaccine boosters for adults? Drugs 66:731–741.

7. Gilberg S, Njamkepo E, Du Chatelet IP, Partouche H, Gueirard P,Ghasarossian C, Schlumberger M, Guiso N. 2002. Evidence of Bordetellapertussis infection in adults presenting with persistent cough in a Frencharea with very high whole-cell vaccine coverage. J. Infect. Dis. 186:415–418.

8. de Greeff SC, Mooi FR, Westerhof A, Verbakel JM, Peeters MF, Heu-velman CJ, Notermans DW, Elvers LH, Schellekens JF, de Melker HE.2010. Pertussis disease burden in the household: how to protect younginfants. Clin. Infect. Dis. 50:1339 –1345.

9. Wendelboe AM, Njamkepo E, Bourillon A, Floret DD, Gaudelus J,Gerber M, Grimprel E, Greenberg D, Halperin S, Liese J, Munoz-RivasF, Teyssou R, Guiso N, Van Rie A. 2007. Transmission of Bordetellapertussis to young infants. Pediatr. Infect. Dis. J. 26:293–299.

10. Lai Y, Gallo RL. 2009. AMPed up immunity: how antimicrobial peptideshave multiple roles in immune defense. Trends Immunol. 30:131–141.

11. Ganz T. 2004. Antimicrobial polypeptides. J. Leukoc. Biol. 75:34 –38.12. Nizet V. 2006. Antimicrobial peptide resistance mechanisms of human

bacterial pathogens. Curr. Issues Mol. Biol. 8:11–26.13. Brogden KA, Ackermann M, McCray PB, Jr, Tack BF. 2003. Antimi-

crobial peptides in animals and their role in host defences. Int. J. Antimi-crob. Agents 22:465– 478.

14. Hancock RE, Scott MG. 2000. The role of antimicrobial peptides inanimal defenses. Proc. Natl. Acad. Sci. U. S. A. 97:8856 – 8861.

15. Melo MN, Ferre R, Castanho MA. 2009. Antimicrobial peptides: linkingpartition, activity and high membrane-bound concentrations. Nat. Rev.Microbiol. 7:245–250.

16. Elahi S, Buchanan RM, Attah-Poku S, Townsend HG, Babiuk LA,Gerdts V. 2006. The host defense peptide beta-defensin 1 confers protec-tion against Bordetella pertussis in newborn piglets. Infect. Immun. 74:2338 –2352.

17. Fernandez RC, Weiss AA. 1996. Susceptibilities of Bordetella pertussisstrains to antimicrobial peptides. Antimicrob. Agents Chemother. 40:1041–1043.

18. Banemann A, Deppisch H, Gross R. 1998. The lipopolysaccharide ofBordetella bronchiseptica acts as a protective shield against antimicrobialpeptides. Infect. Immun. 66:5607–5612.

19. Noofeli M, Bokhari H, Blackburn P, Roberts M, Coote JG, Parton R.2011. BapC autotransporter protein is a virulence determinant of Borde-tella pertussis. Microb. Pathog. 51:169 –177.

20. Peschel A, Sahl HG. 2006. The co-evolution of host cationic antimicro-bial peptides and microbial resistance. Nat. Rev. Microbiol. 4:529 –536.

21. Stainer DW, Scholte MJ. 1970. A simple chemically defined medium forthe production of phase I Bordetella pertussis. J. Gen. Microbiol. 63:211–220.

22. Conover MS, Mishra M, Deora R. 2011. Extracellular DNA is essentialfor maintaining Bordetella biofilm integrity on abiotic surfaces and in theupper respiratory tract of mice. PLoS One 6:e16861. doi:10.1371/journal.pone.0016861.

23. Deora R. 2002. Differential regulation of the Bordetella bipA gene: dis-tinct roles for different BvgA binding sites. J. Bacteriol. 184:6942– 6951.

24. Miller VL, Mekalanos JJ. 1988. A novel suicide vector and its use inconstruction of insertion mutations: osmoregulation of outer membraneproteins and virulence determinants in Vibrio cholerae requires toxR. J.Bacteriol. 170:2575–2583.

25. Brickman TJ, Cummings CA, Liew SY, Relman DA, Armstrong SK.2011. Transcriptional profiling of the iron starvation response in Borde-tella pertussis provides new insights into siderophore utilization and vir-ulence gene expression. J. Bacteriol. 193:4798 – 4812.

26. Kovach ME, Phillips RW, Elzer PH, Roop RM, 2nd, Peterson KM. 1994.pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16:800 –802.

27. Chevion M, Panos C, Linzer R, Neuhaus FC. 1974. Incorporation ofD-alanine into the membrane of Streptococcus pyogenes and its stabilizedL-form. J. Bacteriol. 120:1026 –1032.

28. Sukumar N, Mishra M, Sloan GP, Ogi T, Deora R. 2007. Differential Bvgphase-dependent regulation and combinatorial role in pathogenesis oftwo Bordetella paralogs, BipA and BcfA. J. Bacteriol. 189:3695–3704.

29. Rosenthal RS, Dziarski R. 1994. Isolation of peptidoglycan and solublepeptidoglycan fragments. Methods Enzymol. 235:253–285.

FIG 7 Dendrogram illustrating the relatedness of DraA homologues fromvarious bacterial species. A rooted dendrogram of homologous DltA/DraA/AlmE protein sequences from the various species described in the legend toFig. 1 was generated by the Clustal W program and Phylip’s Drawtree programusing the Biology Workbench at the San Diego Supercomputing Center.Shown in parentheses are the amino acid identities after pairwise alignments(at uniprot.org) of B. pertussis DraA and the corresponding homologue fromeach species.

Taneja et al.

5110 jb.asm.org Journal of Bacteriology

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from

30. Folkening WJ, Nogami W, Martin SA, Rosenthal RS. 1987. Structure ofBordetella pertussis peptidoglycan. J. Bacteriol. 169:4223– 4227.

31. Tuomanen E, Schwartz J, Sande S, Light K, Gage D. 1989. Unusualcomposition of peptidoglycan in Bordetella pertussis. J. Biol. Chem. 264:11093–11098.

32. Abi Khattar Z, Rejasse A, Destoumieux-Garzon D, Escoubas JM, San-chis V, Lereclus D, Givaudan A, Kallassy M, Nielsen-Leroux C, Gaud-riault S. 2009. The dlt operon of Bacillus cereus is required for resistanceto cationic antimicrobial peptides and for virulence in insects. J. Bacteriol.191:7063–7073.

33. Fabretti F, Theilacker C, Baldassarri L, Kaczynski Z, Kropec A, Holst O,Huebner J. 2006. Alanine esters of enterococcal lipoteichoic acid play arole in biofilm formation and resistance to antimicrobial peptides. Infect.Immun. 74:4164 – 4171.

34. Cox KH, Ruiz-Bustos E, Courtney HS, Dale JB, Pence MA, Nizet V,Aziz RK, Gerling I, Price SM, Hasty DL. 2009. Inactivation of DltAmodulates virulence factor expression in Streptococcus pyogenes. PLoSOne 4:e5366. doi:10.1371/journal.pone.0005366.

35. Kristian SA, Lauth X, Nizet V, Goetz F, Neumeister B, Peschel A,Landmann R. 2003. Alanylation of teichoic acids protects Staphylococcusaureus against Toll-like receptor 2-dependent host defense in a mousetissue cage infection model. J. Infect. Dis. 188:414 – 423.

36. McBride SM, Sonenshein AL. 2011. The dlt operon confers resistance tocationic antimicrobial peptides in Clostridium difficile. Microbiology157:1457–1465.

37. Neuhaus FC, Heaton MP, Debabov DV, Zhang Q. 1996. The dlt operonin the biosynthesis of D-alanyl-lipoteichoic acid in Lactobacillus casei.Microb. Drug Resist. 2:77– 84.

38. Palumbo E, Deghorain M, Cocconcelli PS, Kleerebezem M, Geyer A,Hartung T, Morath S, Hols P. 2006. D-Alanyl ester depletion of teichoicacids in Lactobacillus plantarum results in a major modification of lipo-teichoic acid composition and cell wall perforations at the septum medi-ated by the Acm2 autolysin. J. Bacteriol. 188:3709 –3715.

39. Ganz T. 2003. Defensins: antimicrobial peptides of innate immunity. Nat.Rev. Immunol. 3:710 –720.

40. Selsted ME, Ouellette AJ. 2005. Mammalian defensins in the antimicro-bial immune response. Nat. Immunol. 6:551–557.

41. Bingle CD, Craven CJ. 2002. PLUNC: a novel family of candidate hostdefence proteins expressed in the upper airways and nasopharynx. Hum.Mol. Genet. 11:937–943.

42. Sayeed S, Nistico L, St Croix C, Di YP. 2013. Multifunctional role ofhuman SPLUNC1 in Pseudomonas aeruginosa infection. Infect. Immun.81:285–291.

43. McGillivary G, Bakaletz LO. 2010. The multifunctional host defensepeptide SPLUNC1 is critical for homeostasis of the mammalian upperairway. PLoS One 5:e13224. doi:10.1371/journal.pone.0013224.

44. Li X, Li Y, Han H, Miller DW, Wang G. 2006. Solution structures ofhuman LL-37 fragments and NMR-based identification of a minimalmembrane-targeting antimicrobial and anticancer region. J. Am. Chem.Soc. 128:5776 –5785.

45. Bowdish DM, Davidson DJ, Lau YE, Lee K, Scott MG, Hancock RE.2005. Impact of LL-37 on anti-infective immunity. J. Leukoc. Biol. 77:451– 459.

46. Friedrich C, Scott MG, Karunaratne N, Yan H, Hancock RE. 1999.Salt-resistant alpha-helical cationic antimicrobial peptides. Antimicrob.Agents Chemother. 43:1542–1548.

47. Kraus D, Herbert S, Kristian SA, Khosravi A, Nizet V, Gotz F, Peschel

A. 2008. The GraRS regulatory system controls Staphylococcus aureussusceptibility to antimicrobial host defenses. BMC Microbiol. 8:85. doi:10.1186/1471-2180-8-85.

48. Cederlund A, Gudmundsson GH, Agerberth B. 2011. Antimicrobialpeptides important in innate immunity. FEBS J. 278:3942–3951.

49. Darveau RP, Hancock RE. 1983. Procedure for isolation of bacteriallipopolysaccharides from both smooth and rough Pseudomonas aerugi-nosa and Salmonella typhimurium strains. J. Bacteriol. 155:831– 838.

50. Harvill ET, Cotter PA, Miller JF. 1999. Pregenomic comparative analysisbetween Bordetella bronchiseptica RB50 and Bordetella pertussis TohamaI in murine models of respiratory tract infection. Infect. Immun. 67:6109 –6118.

51. Boyd DA, Cvitkovitch DG, Bleiweis AS, Kiriukhin MY, Debabov DV,Neuhaus FC, Hamilton IR. 2000. Defects in D-alanyl-lipoteichoic acidsynthesis in Streptococcus mutans results in acid sensitivity. J. Bacteriol.182:6055– 6065.

52. Clemans DL, Kolenbrander PE, Debabov DV, Zhang Q, Lunsford RD,Sakone H, Whittaker CJ, Heaton MP, Neuhaus FC. 1999. Insertionalinactivation of genes responsible for the D-alanylation of lipoteichoic acidin Streptococcus gordonii DL1 (Challis) affects intrageneric coaggrega-tions. Infect. Immun. 67:2464 –2474.

53. Sebaihia M, Preston A, Maskell DJ, Kuzmiak H, Connell TD, KingND, Orndorff PE, Miyamoto DM, Thomson NR, Harris D, Goble A,Lord A, Murphy L, Quail MA, Rutter S, Squares R, Squares S,Woodward J, Parkhill J, Temple LM. 2006. Comparison of the ge-nome sequence of the poultry pathogen Bordetella avium with those ofB. bronchiseptica, B. pertussis, and B. parapertussis reveals extensivediversity in surface structures associated with host interaction. J. Bac-teriol. 188:6002– 6015.

54. Duggan JM, Goldstein SJ, Chenoweth CE, Kauffman CA, Bradley SF.1996. Achromobacter xylosoxidans bacteremia: report of four cases andreview of the literature. Clin. Infect. Dis. 23:569 –576.

55. Mansfield J, Genin S, Magori S, Citovsky V, Sriariyanum M, Ronald P,Dow M, Verdier V, Beer SV, Machado MA, Toth I, Salmond G, FosterGD. 2012. Top 10 plant pathogenic bacteria in molecular plant pathology.Mol. Plant Pathol. 13:614 – 629.

56. Costechareyre D, Chich JF, Strub JM, Rahbe Y, Condemine G. 2013.Transcriptome of Dickeya dadantii infecting Acyrthosiphon pisum re-veals a strong defense against antimicrobial peptides. PLoS One 8:e54118.doi:10.1371/journal.pone.0054118.

57. Richet H. 2012. Seasonality in Gram-negative and healthcare-associatedinfections. Clin. Microbiol. Infect. 18:934 –940.

58. Hankins JV, Madsen JA, Giles DK, Brodbelt JS, Trent MS. 2012. Aminoacid addition to Vibrio cholerae LPS establishes a link between surfaceremodeling in gram-positive and gram-negative bacteria. Proc. Natl.Acad. Sci. U. S. A. 109:8722– 8727.

59. Scheffers DJ, Pinho MG. 2005. Bacterial cell wall synthesis: new insightsfrom localization studies. Microbiol. Mol. Biol. Rev. 69:585– 607.

60. Caroff M, Brisson J, Martin A, Karibian D. 2000. Structure of theBordetella pertussis 1414 endotoxin. FEBS Lett. 477:8 –14.

61. Clark VL, Young FE. 1978. D-Alanine incorporation into macromole-cules and effects of D-alanine deprivation on active transport in Bacillussubtilis. J. Bacteriol. 133:1339 –1350.

62. Kolter R, Inuzuka M, Helinski DR. 1978. Trans-complementation-dependent replication of a low molecular weight origin fragment fromplasmid R6K. Cell 15:1199 –1208.

Bordetella pertussis Resistance to AMPs and Phagocytes

November 2013 Volume 195 Number 22 jb.asm.org 5111

on October 30, 2020 by guest

http://jb.asm.org/

Dow

nloaded from