Upload File

de novo genome assembly - the kane labde novo genome assembly look at your dataset look at the...

  • Home
  • Documents
  • De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look
40
@HWI-ST765:7:1101:1318:2091#0/1 GGCCACCTATGACCGGCTCGCGCCGCTCGTCGGGGAGCGGCTGCTCGTCGTCACCGGGGGCGCGCCCGCGGACGCCGTCCGCGGCCCGCTCCGCGCGCCCC + ___cccccggggghhhhhh^b^^c__UZFLZWacdBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB @HWI-ST765:7:1101:1628:2156#0/1 TCTTCGCGAGTATGTCTGTTGATGGCGCTGTGTCCTATCTGCTCAAGGAAAGCAGCCCAACTCAATGTGTTACGCATTAGCGGCATTTGCTACATAATCCG + ___eeeeefggggf_bddgeafgihdgehhgfeghhhifbgfhhhhihhhihhdhigggfeede`d`]bbdbccccccccccccccccbcb`b`bdbcbcc @HWI-ST765:7:1101:2627:2192#0/1 ATTATGAAGACTGGAGAAAGCCCTATATTTATTGTATTTCTTTTCTGGATCACAAAATCCTCCCCTCTGAAACAAAAGATGTAGTTGGAATAAATAAAAGG + bbbeeeeegfgeggfhfffefghiiiihiihhhhfghhicegihiihhiihfhiiiiihfihiifhihhihihfdggeceecee_bdddbccbcddbccb_ @HWI-ST765:7:1101:3236:2246#0/1 GCGGAAAGAGGGCTTGAGGATGACTTCCCTCATAGACTGGGACCCCCACTTTGAGGTGGCTGACGTAGCCTTTAAACGGAGTCCCCGCATTCCCGGTATCT + bbbeeeeegfgggiiihiihhiiiiiiiihiiihiiiiiihiiiiiiiiiiiighhgggfeeeec`cdccccc`bcccccc^bcccac]aacdccc[_ccd @HWI-ST765:7:1101:3400:2241#0/1 GCGGACAGCTAATGCGTTCCACTTATTGAACAGGGTTCTATGGTCGGTCCGTGACCCCCGGATGCCGAAGGCGTCCTTGGGGTAATCTCGTAGTTCCTACG + ___cacc_eeaegfffZa`e]]de`egdfg[cgffcgZf]e^aX^G[Ze_agfffddgc`bXZ^[]_aaa_GTTTTW_SX`aTX]`_bbaa_aacY`bbRO @HWI-ST765:7:1101:4139:2060#0/1 NCTTCTCTCTTCATCAGAGAGTAGAGGTTGGGGCAATTGTGGGATCACGACGGGGACAGGGGCAGGTGCGGGCGGCGTCTCCGGTTGAGGAAGAGGCTGCC + BS\cceeegggggiiiiiihifgiiiiffhiiiiiiiiighiihiiiiiiiiggecccccccccccT___acX_c]][]acc_cT[_`bcbaa``caaa^^ @HWI-ST765:7:1101:4188:2089#0/1 ACAAGATATATTTGATATACTAAGATGATAGCTAGAGACTAGAGATGAGAGTGCAGGATCTAGATTTGTAACAAATATTCGACTTTGCTTATGCAAACTGT + bbbeeeeegggggiiiiiiiiiiiiiiiiiiiiiihifghiiiihiiiiiifghiiiiiiiiihiiiiiihiiihhiihiihhggggeeeeeeddddddcc De novo genome assembly

Upload: others

Post on 07-Aug-2020

1 views

Category:

Documents


0 download

Report

TRANSCRIPT

Page 1: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

@HWI­ST765:7:1101:1318:2091#0/1GGCCACCTATGACCGGCTCGCGCCGCTCGTCGGGGAGCGGCTGCTCGTCGTCACCGGGGGCGCGCCCGCGGACGCCGTCCGCGGCCCGCTCCGCGCGCCCC+___cccccggggghhhhhh^b^^c__UZFLZWacdBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB@HWI­ST765:7:1101:1628:2156#0/1TCTTCGCGAGTATGTCTGTTGATGGCGCTGTGTCCTATCTGCTCAAGGAAAGCAGCCCAACTCAATGTGTTACGCATTAGCGGCATTTGCTACATAATCCG+___eeeeefggggf_bddgeafgihdgehhgfeghhhifbgfhhhhihhhihhdhigggfeede`d`]bbdbccccccccccccccccbcb`b`bdbcbcc@HWI­ST765:7:1101:2627:2192#0/1ATTATGAAGACTGGAGAAAGCCCTATATTTATTGTATTTCTTTTCTGGATCACAAAATCCTCCCCTCTGAAACAAAAGATGTAGTTGGAATAAATAAAAGG+bbbeeeeegfgeggfhfffefghiiiihiihhhhfghhicegihiihhiihfhiiiiihfihiifhihhihihfdggeceecee_bdddbccbcddbccb_@HWI­ST765:7:1101:3236:2246#0/1GCGGAAAGAGGGCTTGAGGATGACTTCCCTCATAGACTGGGACCCCCACTTTGAGGTGGCTGACGTAGCCTTTAAACGGAGTCCCCGCATTCCCGGTATCT+bbbeeeeegfgggiiihiihhiiiiiiiihiiihiiiiiihiiiiiiiiiiiighhgggfeeeec`cdccccc`bcccccc^bcccac]aacdccc[_ccd@HWI­ST765:7:1101:3400:2241#0/1GCGGACAGCTAATGCGTTCCACTTATTGAACAGGGTTCTATGGTCGGTCCGTGACCCCCGGATGCCGAAGGCGTCCTTGGGGTAATCTCGTAGTTCCTACG+___cacc_eeaegfffZa`e]]de`egdfg[cgffcgZf]e^aX^G[Ze_agfffddgc`bXZ^[]_aaa_GTTTTW_SX`aTX]`_bbaa_aacY`bbRO@HWI­ST765:7:1101:4139:2060#0/1NCTTCTCTCTTCATCAGAGAGTAGAGGTTGGGGCAATTGTGGGATCACGACGGGGACAGGGGCAGGTGCGGGCGGCGTCTCCGGTTGAGGAAGAGGCTGCC+BS\cceeegggggiiiiiihifgiiiiffhiiiiiiiiighiihiiiiiiiiggecccccccccccT___acX_c]][]acc_cT[_`bcbaa``caaa^^@HWI­ST765:7:1101:4188:2089#0/1ACAAGATATATTTGATATACTAAGATGATAGCTAGAGACTAGAGATGAGAGTGCAGGATCTAGATTTGTAACAAATATTCGACTTTGCTTATGCAAACTGT+bbbeeeeegggggiiiiiiiiiiiiiiiiiiiiiihifghiiiihiiiiiifghiiiiiiiiihiiiiiihiiihhiihiihhggggeeeeeeddddddcc

De novo genome assembly

Page 2: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

De novo genome assembly

Page 3: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look
Page 4: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

@HWI­ST765:7:1101:1318:2091#0/1GGCCACCTATGACCGGCTCGCGCCGCTCGTCGGGGAGCGGCTGCTCGTCGTCACCGGGGGCGCGCCCGCGGACGCCGTCCGCGGCCCGCTCCGCGCGCCCC+___cccccggggghhhhhh^b^^c__UZFLZWacdBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB@HWI­ST765:7:1101:1628:2156#0/1TCTTCGCGAGTATGTCTGTTGATGGCGCTGTGTCCTATCTGCTCAAGGAAAGCAGCCCAACTCAATGTGTTACGCATTAGCGGCATTTGCTACATAATCCG+___eeeeefggggf_bddgeafgihdgehhgfeghhhifbgfhhhhihhhihhdhigggfeede`d`]bbdbccccccccccccccccbcb`b`bdbcbcc@HWI­ST765:7:1101:2627:2192#0/1ATTATGAAGACTGGAGAAAGCCCTATATTTATTGTATTTCTTTTCTGGATCACAAAATCCTCCCCTCTGAAACAAAAGATGTAGTTGGAATAAATAAAAGG+bbbeeeeegfgeggfhfffefghiiiihiihhhhfghhicegihiihhiihfhiiiiihfihiifhihhihihfdggeceecee_bdddbccbcddbccb_@HWI­ST765:7:1101:3236:2246#0/1GCGGAAAGAGGGCTTGAGGATGACTTCCCTCATAGACTGGGACCCCCACTTTGAGGTGGCTGACGTAGCCTTTAAACGGAGTCCCCGCATTCCCGGTATCT+bbbeeeeegfgggiiihiihhiiiiiiiihiiihiiiiiihiiiiiiiiiiiighhgggfeeeec`cdccccc`bcccccc^bcccac]aacdccc[_ccd@HWI­ST765:7:1101:3400:2241#0/1GCGGACAGCTAATGCGTTCCACTTATTGAACAGGGTTCTATGGTCGGTCCGTGACCCCCGGATGCCGAAGGCGTCCTTGGGGTAATCTCGTAGTTCCTACG+___cacc_eeaegfffZa`e]]de`egdfg[cgffcgZf]e^aX^G[Ze_agfffddgc`bXZ^[]_aaa_GTTTTW_SX`aTX]`_bbaa_aacY`bbRO@HWI­ST765:7:1101:4139:2060#0/1NCTTCTCTCTTCATCAGAGAGTAGAGGTTGGGGCAATTGTGGGATCACGACGGGGACAGGGGCAGGTGCGGGCGGCGTCTCCGGTTGAGGAAGAGGCTGCC+BS\cceeegggggiiiiiihifgiiiiffhiiiiiiiiighiihiiiiiiiiggecccccccccccT___acX_c]][]acc_cT[_`bcbaa``caaa^^@HWI­ST765:7:1101:4188:2089#0/1ACAAGATATATTTGATATACTAAGATGATAGCTAGAGACTAGAGATGAGAGTGCAGGATCTAGATTTGTAACAAATATTCGACTTTGCTTATGCAAACTGT+bbbeeeeegggggiiiiiiiiiiiiiiiiiiiiiihifghiiiihiiiiiifghiiiiiiiiihiiiiiihiiihhiihiihhggggeeeeeeddddddcc

De novo genome assembly

Page 5: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Look at your dataset

● Look at the amount and quality of your reads– How much data do you have?

– How good is it?

Page 6: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Look at your dataset

● Look at the amount and quality of your reads– How much data do you have?

– How good is it?● fastqc

Page 7: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Trimming and cleaning Illumina

http://www.usadellab.org/cms/index.php?page=trimmomatic

java -jar /home/nkane/Trimmomatic-0.32/trimmomatic-0.32.jar SE -threads 4 -phred33 sra_data.fastq trimmed.fq LEADING:30 TRAILING:30 MINLEN:35

http://www.usadellab.org/cms/index.php?page=trimmomatic
Page 8: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Trimming and cleaning Illumina

http://www.usadellab.org/cms/index.php?page=trimmomatic

java -jar /home/nkane/Trimmomatic-0.32/trimmomatic-0.32.jar PE -threads 4 -phred33 Species_name_1.fq Species_name_2.fq Species_trim_1_paired.fq.gz Species_trim_1_unpaired.fq.gz Species_trim_2_paired.fq.gz Species_trim_2_unpaired.fq.gz LEADING:30 TRAILING:30 MINLEN:35

http://www.usadellab.org/cms/index.php?page=trimmomatic
Page 9: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

fastqc

● Look at the quality of your reads again after trimming!

Page 10: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

DNA extraction, sequencing, assembly

Page 11: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Number of contigs vs. genome coverage

Page 12: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

DNA extraction, sequencing, assembly

Page 13: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Repeats can cause challenges

Page 14: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly algorithms

● Overlap-layout-consensus

Page 15: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly algorithms

● De Bruin graph

Page 16: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

What is a k-mer?

● A k-mer is a string (sequence of letters) of length k● ATGTAATAATG● ATGT

TGTA

GTAA

TAAT

AATA

ATAA

TAAT

AATG

Page 17: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly algorithms

● it was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness

Page 18: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly algorithms

● it was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness

it was the best was the age of

it was the age it was the

age of foolishness wisdom, it was

it was the worst was the best of

times, it was the best of times

Page 19: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 20: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 21: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 22: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 23: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 24: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 25: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It

was

the

best

of

times

Page 26: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Joining reads with k-mers

● It was the best● was the best of● the best of times

It was the best of times

Page 27: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly algorithms

● it was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness

it was the best was the age of

it was the age it was the

age of foolishness wisdom, it was

it was the worst was the best of

times, it was the best of times

Page 28: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look
Page 29: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly algorithms

● It was the best of times, it was the worst of times, it was the age of wisdom, it was the age of foolishness, it was the epoch of belief, it was the epoch of incredulity, it was the season of Light, it was the season of Darkness, it was the spring of hope, it was the winter of despair, we had everything before us, we had nothing before us, we were all going direct to Heaven, we were all going direct the other way

Page 30: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

De novo genome assembly

Page 31: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look
Page 32: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look
Page 33: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

K-mers connect reads -> assembly

Page 34: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

K-mers connect reads -> assembly

Page 35: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Repeats can cause errors

Page 36: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look
Page 37: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Evaluating the assembly – is it right? Which assembly is better?

Page 38: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Assembly: varying kmer size

Page 39: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

De novo genome assembly

Page 40: De novo genome assembly - The Kane LabDe novo genome assembly Look at your dataset Look at the amount and quality of your reads – How much data do you have? – How good is it? Look

Chromosome‐level hybrid de novo genome assemblies as an

Chromosome-scale scaffolding of de novo genome assemblies ... · de novo. genome assembly. HiC and related protocols use proximity ligation and massively parallel sequencing to probe

Structural Variation Discovery by De Novo Genome Mapping of … · 2020. 8. 7. · De Novo Human Genome Map Assembly and Depth Analysis Structural Variation Discovery by De Novo Genome

CS267 Assignment 3: Parallelize Graph Algorithms for de Novo Genome Assembly Spring 2015

Combining PacBio with short read technology for improved de novo genome assembly

MCB3895-004 Lecture #9 Sept 23/14 Illumina library preparation, de novo genome assembly

The de novo genome of the “Spanish” slug Arion vulgaris · 30/11/2020  · The de novo genome of the “Spanish” slug Arion vulgaris Moquin-Tandon, 1855 (Gastropoda: Panpulmonata):

Genome sequencing of bacteria: sequencing, de novo assembly and

De novo genome assembly of NGS data - VBC | Victorian

Hybrid de novo whole-genome assembly and annotation of …

De Novo Assembly of the Genome-in-a-Bottle Reference ... · ©2015 BioNano eserved. De Novo Assembly of the Genome-in-a-Bottle Reference Ashkenazi Trio, Structural Variation Discovery

Comparing De Novo Genome Assembly: The Long and Short of It · Comparing De Novo Genome Assembly: The Long and Short of It Giuseppe Narzisi1*, Bud Mishra1,2 ... graphs, two dominant

De novo genome assembly - Bioinformaticsbioinformatics.org.au/ws13/wp-content/uploads/ws13/sites/3/Full... · De novo genome assembly Dr Torsten Seemann ... World leader in de novo

Developing Accessible Application Software for Individual de novo Genome Projects

Sequence Assembly and Alignment - Gerstein LabDe novo assembly •Sequencing a new genome •Resequencing an existing genome •Accomodate repeats, polymorphism, sequence errors “Reference

De novo genome assembly versus mapping to a reference genomebeat.wolf.home.hefr.ch/documents/prague.pdf · De novo vs. reference Unless necessary, stick with reference based alignment

Genome Assembly and De Novo RNA- seq

OPEN Data Descriptor: Whole genome sequencing data …evoinformatics.eu/publications/Malmstrom_etal_2017.pdf · Data Descriptor: Whole genome sequencing data and de novo draft

De novo Nd-1 genome assembly reveals genomic diversity of ... · De novo Nd-1 genome assembly reveals genomic diversity of ... Holtgräwe, D., Rosleff Sörensen, T., Stracke, R.,

De novo whole genome assembly - Cornell Universitycbsuss05.tc.cornell.edu/doc/assembly2016_lecture1.pdfDe novo whole genome assembly Lecture 1 Qi Sun Bioinformatics Facility Cornell

De novo whole genome assembly · 2020. 10. 12. · genome. Maternal . Paternal . Reference. Reference genome is a mosaic of paternal and maternal genomes from one individual. The

Next Generation Sequencing - Applications - MSImaths-people.anu.edu.au/~foret/next_gen_seq/hts_applications.pdf · 1 Genome sequencing De novo genome sequencing Genome resequencing

De-Novo Genome Assembly and its Current State · 2016-11-24 · De-Novo Genome Assembly and its Current State Anne-Katrin Emde . April 17, 2013 . Freie Universität Berlin, Algorithmische

LDscaff: LD-based scaffolding of de novo genome assemblies

Torsten Seemann - de novo genome assembly

De Novo Genome Assembly - Introduction Henrik Lantz - BILS/SciLife/Uppsala University

Fast and accurate de novo genome assembly from long ...fulir.irb.hr/3411/1/068122.full.pdf · Fast and accurate de novo genome assembly from long uncorrected ... Introduction With

Era7 bioinformatics de novo bacterial genome with pacbio and BG7 pipeline

Genome Sequence Data in a Public Laboratory - APHL Home · Analysis Workflow Sequence QC High Quality Sequence De novo Genome Assembly Draft Genome Sequence Annotation Draft Genome

Discovar de novo dolicophallus genome with … · Assembly of the Ariolimax dolicophallus genome with Discovar de novo ... Identity Notes Pred – Aplysia californica transcript variant

Second generation noninvasive fetal genome …Second generation noninvasive fetal genome analysis reveals de novo mutations, single-base parental inheritance, and preferred DNA ends

Everyday de novo Assembly with the Supernova™ Assembleri5k.github.io/webinar_slides/i5k_10x_Genomics-2016.11.02.pdf · De Novo Solution Discover the true genome with the Supernova™

A complete bacterial genome assembled de novo using only … · A complete bacterial genome assembled de novo using only nanopore sequencing data Nicholas J. Loman 1, Joshua Quick

Genome Informatics Training Course What's GITC? …Genome Informatics Training Course What's GITC? (GITC) NIBB - de novo C - NGS novo RNA-seq 6111 730 I I I RNA-seq 5(31 5/30 10:00

De novo genome assembly of NGS data - VBC | Victorian ... novo assembly of NGS data... · De novo genome assembly of NGS data ... E.coli 4.6 Mbp • Simple Eukaryotes ... – Analyse/simplify/clean