INFECTION AND IMMUNITY, Nov. 1994, p. 4922-49280019-9567/94/$04.00+0Copyright X 1994, American Society for Microbiology

Vol. 62, No. 11

Identification of hifD and hi/E in the Pilus Gene Cluster ofHaemophilus influenzae Type b Strain Eagan

KIRK W. McCREA,' WENDY J. WATSON,2 JANET R. GILSDORF,2 AND CARL F. MARRS'*Department of Epidemiology, University of Michigan,' and De,'artment of Pediatrics and Communicable Diseases,

University of Michigan Medical School, Ann Arbor, Michigan 48109

Received 31 March 1994/Returned for modification 2 June 1994/Accepted 19 August 1994

Haemophilus influenzae produces surface structures called pili that promote adherence to human cells. Threegenes encoding the major pilus structural component (pilin), chaperone, and usher proteins (designated hifA,-B, and -C, respectively) have been identified previously. In this study, transposon mutagenesis and DNAsequence analysis identified two open reading frames (ORFs) downstream of, and in the same orientation as,hifC. These genes have been designated hifD and hifE. Both genes have predicted C-terminal amino acidhomology to HifA, and mutations in either gene resulted in the loss of morphologic and functional pili,indicating that hipD and hi/E encode pilus structural components and are required for pilus expression.Another ORF, identified immediately downstream of hiJE, has a predicted amino acid sequence that is 70%oidentical to an aminopeptidase of Escherichia coli called PepN, and a mutation within this ORF did not alterpilus expression. These data indicate that the pepN homolog is not required for pilus biogenesis and that oneend of the pilus gene cluster has been defined.

Haemophilus influenzae type b (Hib) and nonencapsulatedstrains both produce long proteinaceous appendages called pilithat mediate adherence of the organism to human buccalepithelial cells (BECs) and erythrocytes (RBCs) in vitro (14,18, 42, 48). Pili are multimeric structures composed of 24-kDasubunits called pilin (19). The gene encoding pilin, hifA, hasbeen cloned from both Hib (12, 16, 29, 50) and nonencapsu-lated H. influenzae (7, 23). The deduced amino acid sequenceof the hifA gene has significant homology to the pilin proteinsof other gram-negative bacteria (16, 50), and insertionalinactivation of this gene results in the complete loss of bothpilin and pili from the organism (54). Two additional genesinvolved in pilus biogenesis have been identified at the samechromosomal locus as hifA. hifB is upstream and in theopposite orientation of hifA (Fig. la) (51) and encodes anEscherichia coli chaperone-like protein (21). The third gene inthe cluster, designated hifC, has recently been identified down-stream and in the same orientation as hifB (Fig. la) (53).Insertional inactivation of hifC results in the loss of pili on thecell surface; however, pilin is still detected intracellularly. Inaddition, the predicted amino acid sequence of hifC hasextensive homology to the pilus usher proteins of numerousgram-negative bacteria, suggesting that this gene encodes asimilar product (53).

Besides chaperone and usher proteins, the pili of othergram-negative organisms require a number of structural pro-teins for pilus biogenesis. These components often mediatepilus-associated adherence (2, 34) or regulate pilus assembly(1, 22). Apart from pilin, no other structural components havebeen identified in H. influenzae pili; however, additional Hibpilus accessory proteins may be encoded within the pilus genecluster. van Ham et al. (50) have isolated a cosmid clone fromHib strain 770235f+b° that enabled E. coli DH5-a to expressfunctional Hib pili. A minimum 8.13-kb DNA fragment wasrequired for pilus expression, and most of this DNA was

* Corresponding author. Mailing address: Department of Epidemi-ology, University of Michigan, Ann Arbor, MI 48109. Phone: (313)747-2407. Fax: (313) 764-3192. Electronic mail address: carl.marrs@um.cc.umich.edu.

upstream of hifA, suggesting that the genetic informationnecessary for functional pilus expression exists in this clone(50). Since the present pilus gene cluster in strain Eagan is only4 kb in length, we analyzed the DNA farther upstream of hifA(downstream of hifC) for additional genes involved in Hib pilusexpression.

In this paper, we describe two genes, designated hipD andhifE, that are involved in pilus expression and are locatedimmediately downstream of hifC. Analysis of mutants contain-ing transposon insertions indicates that these genes are re-quired for pilus expression, and homology between the pre-dicted amino acid sequences of HifA, HifD, and the Cterminus of HifE suggests that hifD and hifE encode pilusstructural components. Analysis of DNA further downstreamof hifE identified no other genes essential for pilus biogenesis,indicating that one end of the pilus gene cluster has beendefined for Hib strain Eagan.

MATERIALS AND METHODS

Bacterial strains and plasmids. Piliated and nonpiliatedvariants of Hib strain Eagan (Elap+ and Elap-, respectively),the E. coli strains used for genetic manipulations, and themedia used for general bacterial growth, development ofcompetence in Hib, and construction of the m-yb transposoninsertions have been described elsewhere (4, 20, 53). Theplasmid pWW2 contains a 6.8-kb insert with 5.5 kb of the insertexisting downstream of hifC (Fig. lb), and its construction hasbeen described previously (53). pWW15 was made by ligatinga 6.5-kb PmlI fragment from pWW4 (53) into the HincII site ofa pGEM5 vector (Fig. lc). This plasmid contains all of hifA, -B,and -C and an additional 2 kb of DNA downstream of hifC.Plasmids used for myb conjugational mutagenesis were pro-vided by C. Berg and have been described previously (4, 53).

Construction of insertion and deletion mutants. Randominsertion mutagenesis was carried out on plasmids pWW2 orpWW15 by using the liquid mating procedure of Berg et al. (4).A modification of this method was used for the identificationof hifC (53). Mutagenized plasmid DNA was purified fromindividual transconjugants, excised from the plasmid vector,

4922

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

IDENTIFICATION OF TWO H. INFLUENZAE PILUS GENES 4923

P Pm Bg, XD EAcP P,NdAc DXmPmApDXm BgI I Ir I I 11 I mI 11MIfr IIoI

E W1I1 hif FWn I h I I nam=Iliz0- 01 . .01ho mnolg-7

b

Bg(B E

C IFEM7 J

Armrys10A my6-1 3

A my6-11A myS-06

Bg/BpWW15

ILPNd' IPm/Hc Pm/Hic

PLNd' IPm/'Hc Pm/JHc

I EGFM7I

I . 1I \Bg/B E

A myn -06

FIG. 1. (a) Genetic map of the Hib strain Eagan pilus gene cluster includes the position and orientation of previously defined genes (hifA, -B,and -C) and genes identified in this study (hifD and -E and the pepN homolog). (b) Plasmid pWW2 was used to obtain the random m-yb-10, -13,-11, and -06 transposon insertions. (c) Plasmid pWW15 was constructed from pWW4 and used to generate m-y8-14 and theNdeI probe for Southernanalysis. (d) pKD2 contains an in-frame deletion of hifD. To facilitate selection following transformation, anAccI fragment containing this deletionwas ligated into pWW2 containing m-y-06 to create pKD4. The relative positions of the transposon insertions are marked by triangles. Restrictionsite abbreviations: A, AvrII; Ac, AccI; B, BamHI; Bg, BglII; D, DraI; E, EcoRI; Hc, HincII; N, NcoI; Nd, NdeI; Pm, PmlI; P, PstI; X, XhoI; Xm,XmnI.

and transformed into competent Elap+ as described previ-ously (53). Kanamycin-resistant colonies were selected onsupplemented brain heart infusion agar containing 25 ,ug ofkanamycin per ml.An in-frame deletion mutation in hifD was constructed by

excising the m-yb-14 transposon from hifD (Fig. lc) withBamHI, briefly treating the linearized plasmid with exonucle-ase III (Erase-a-Base System; Promega, Madison, Wis.), andligating, transforming, and screening the resulting recombi-nants for plasmids containing an in-frame deletion in hifD byrestriction mapping and DNA sequence analysis. One plasmidcontaining an appropriate deletion was designated pKD2 (Fig.ld). To provide a selectable marker for transformation into H.influenzae, an AccI fragment containing the in-frame hifDdeletion was subcloned from pKD2 into pWW2 that containedan insertion, m-yb-6, located in the pepN homolog gene, andthe resulting plasmid was designated pKD4 (Fig. ld). Theinsert DNA ofpKD4 was transformed into Elap+ as describedabove.

Southern analysis was used to confirm that the DNA frag-ments containing insertions or deletions had integrated intothe wild-type Elap+ chromosome by homologous recombina-tion. Genomic DNA from wild-type Elap+, and the Elap+insertion mutants were double digested withXhoI andAvrII orXmnI alone, and DNA from a hifD deletion mutant wasdigested with eitherAccI or DraI and used in Southern blots asdescribed previously (53). The NdeI fragment of pWW15 (Fig.lc) was excised, purified, and subjected to random oligonucle-otide labeling (Pharmacia, Piscataway, N.J.) with 32p. Hybrid-izations were performed overnight at 65GC.Immunologic analyses. Pilin expression in various mutants

was determined by Western blot (immunoblot) analysis inwhich the proteins from whole-cell lysates were resolved on asodium dodecyl sulfate-polyacrylamide gel, transferred to anitrocellulose membrane, and reacted with polyclonal rabbitanti-pilin antiserum, R20 (17), diluted 1:500. Pilus expression

was detected by whole-cell enzyme-linked immunosorbentassays (ELISAs) (15) using rabbit polyclonal anti-purified pilusantiserum, R19 (17), diluted 1:500.Transmission electron microscopy. Dense suspensions of

agar-grown bacteria in 1% ammonium acetate were appliedto Formvar- and carbon-coated specimen grids (ElectronMicroscopy Sciences, Fort Washington, Pa.) for 1 to 2 min.The grids were washed with 2 drops of 1% ammonium acetate,stained with 2 drops of 1.5% phosphotungstic acid (pH 6.9), airdried, and examined with a Philips EM 10C/CR electronmicroscope.

Hemagglutination and cell-binding assays. The ability ofmutated Elap+ to adhere to human cells was determined byhemagglutination and BEC binding assays. Hemagglutinationassays were performed as described previously (42, 53). Anenzyme-linked immunosorbent binding assay (41) was used toquantitate the ability of the Elap+ mutants to adhere to BECs.Briefly, ELISA microtiter wells were coated with pooled BECsfrom five donors (41). After blocking with phosphate-bufferedsaline (PBS) containing 0.2% gelatin (PBS-G), 100 ,ul of 70%transmittance bacterial suspensions was added to the wells(eight wells per strain) and the wells were incubated withshaking at room temperature for 1 h. Following two washeswith PBS-G, anti-H. influenzae rabbit antisera (16), diluted1:100, was added to the wells. The colorimetric end point wasdetermined by using horseradish peroxidase-conjugated goatanti-rabbit antisera (1:5,000) and soluble peroxidase substratetablets (Sigma Chemical Co., St. Louis, Mo.) (16).DNA sequence analysis. Dideoxy DNA sequence analysis

was performed as described previously (53). Sequence analysiscomplicated by gel compressions or artifact bands was resolvedby using a combination of dITP labeling reactions chased withterminal deoxynucleotidyl transferase and excess deoxynucleo-side triphosphates (37). DNA and protein sequences wereanalyzed by using software from DNASTAR (DNASTAR,Madison, Wis.).

a1.0 kb

pWW2

pWW4

d

A myr -14

pKD2

pKD4

VOL. 62, 1994

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

4924 McCREA ET AL.

Nucleotide sequence accession number. The nucleotide se-quence reported in this article can be found in GenBank underaccession number U13254.

RESULTS

Construction of insertion mutants in strain Eagan. Toinvestigate the possibility that additional genes were present inthe Hib pilus gene cluster, we made transposon insertionmutations in DNA downstream of hifC, transformed the DNAback into competent, piliated strain Eagan, and analyzed thetransformants for alteration in pilus structure and function.Four unique my8 insertion mutations (designated m-y-14, -10,-13, and -11) were created throughout a 2.6-kb region of DNAdownstream of hifC by using a random conjugational mutagen-esis method (4) on subclones pWW2 or pWW15 (Fig. lb andc). The insertions were localized by DNA sequence analysis,and the mutated DNA was transformed into competentElap+. Kanamycin-resistant colonies were selected and ana-lyzed for their ability to express pili. The four mutant strainswere named E114, E110, E113, and EBll on the basis of them,yb construct they contained.

Southern analysis of the mutated Elap+ chromosomal DNAconfirmed that homologous recombination had occurred. Thelabeled NdeI probe hybridized to a XhoI-AvrII band in strainsE114, E110, and E113 and to aXmnI band in strain E11. Inall cases, these bands were 1.8 kb larger than a homologousband in the piliated wild-type Eagan DNA (data not shown),indicating that cloned DNA containing a 1.8-kb m-y transpo-son had entered the chromosome by homologous recombina-tion.DNA sequence analysis. DNA sequence analysis was per-

formed to identify putative encoding regions and to localizethe random insertion mutations. Two open reading frames(ORFs) were identified immediately downstream of, and in thesame orientation as, hifC (Fig. 2). The first ORF, designatedhijD, begins 16 bp downstream of hifC, is 648 bp in length, andcontains a putative ribosomal binding site in front of an ATGinitiation codon (Fig. 2). The predicted amino acid sequencefrom hifD would encode a protein containing 216 amino acids.The first 18 amino acids form a potential signal sequence witha probable cleavage site existing between alanine and serine(52) (Fig. 2). The mature protein would have a predictedmolecular mass of 20.6 kDa. HifD has significant homology toHifA (Fig. 3), the major structural component of Hib pili,suggesting that hifD may encode another structural componentof Hib pili.The second ORF identified downstream of hifC, designated

hifE, begins 27 bp past hiflD, is 1,305 bp in length, and containsa putative ribosomal binding site (Fig. 2). This gene wouldencode a translation product containing 435 amino acids witha putative signal sequence existing in the first 29 amino acids(Fig. 2). The mature protein would have a predicted molecularmass of 45.5 kDa. The deduced amino acid sequence of HifEhas significant C-terminal homology to both HifA and HifD(Fig. 3), again suggesting that this gene encodes anotherstructural component of Hib pili.The beginning of a third ORF was found 219 bp downstream

of hifE. A preliminary sequence was determined for approxi-mately 1,300 bp of this ORF, and the putative translationproduct was found to have 70% amino acid identity to anaminopeptidase of E. coli called PepN (data not shown) (11,36). In E. coli, this enzyme is involved in the degradation ofintracellular peptides (56), suggesting that the PepN homologin H. influenzae may be a housekeeping gene.The positions of the four random insertion mutations were

determined by DNA sequence analysis. m-yb-14 is located inhiJD, m-y6-10 and -13 are located in hifE, and myb-1l is locatedin the pepN homolog (Fig. lb, lc, and 2).

Detection of pilin and pili by immunoassay. Western blotanalysis was performed to determine if pilin was still expressedin the insertion mutants. All mutants and the wild-type Elap+expressed a 24-kDa band that was reactive with the anti-pilinantiserum, R20, indicating that pilin is still expressed in thesemutants. No pilin band was seen in Elap-, the nonpiliatedvariant of strain Eagan (data not shown).To determine if pilus expression was altered in the mutant

strains, whole-cell ELISAs were performed with rabbit poly-clonal anti-purified pilus antiserum R19. The reactivity of thisantiserum to the insertion mutants Elap+ and Elap- is shownin Table 1. The anti-pilus antiserum showed significantly morereactivity to wild-type Elap+ than to mutants containinginsertions within the hiJD and hifE genes (E114, E110, andE113), indicating that the loss of either gene affects pilusexpression. The antiserum bound similarly to Elap+ and amutant containing an insert in thepepN homolog gene (EB11).Interestingly, this anti-pilus antiserum reacted more to hiJDand hifE mutant organisms than to Elap-, suggesting thatthese mutants still express a form of abortive pili possessingsome epitopes of purified pili. Alternatively, the antiserum maybe recognizing significantly fewer pili on the cell surface.

Detection of pili by electron microscopy. Electron micros-copy was used to determine if mutant Elap+ strains havemorphologically altered pili. Pili were absent on strains con-taining insertions in either hiJD or hifE. These results corrob-orate the immunologic data presented above since pili drasti-cally altered in structure or decreased in number may not havebeen detected. Pili identical in number and structure to Elap+were seen on the strain containing an insert in the pepNhomolog (data not shown).

Hemagglutination and RBC and BEC adherence. The abilityof Hib strain Eagan to hemagglutinate and bind BECs isdirectly associated with the presence of pili on the cell surface(18, 42, 48). Hemagglutination and BEC ELISA adherenceassays were used to determine if organisms containing m-yinsertions downstream of hifC could mediate adherence.Strains E114 (hifD), E110 and E113 (hifE), and Elap- did nothemagglutinate and bound BECs less than Elap+ (Table 1).Strain EBll (pepN homolog mutant) hemagglutinated RBCsand bound to BECs like Elap+. These data suggest that hipDand hifE are required for the expression of functional pili andthat the pepN homolog does not contribute to pilus-mediatedadherence.

Construction and analysis of a hifD in-frame deletionmutant. Since a transposon insertion within hifD may have apolar effect on the expression of hifE, loss of pili from a hifDinsertion mutant may not accurately reflect the requirement ofhifD in pilus expression. We therefore constructed and ana-lyzed a mutant containing an in-frame deletion in hifD. Asubclone containing both an in-frame deletion in hifD (A1O-481) and a my8 transposon in the pepN homolog gene wasconstructed (pKD4) (Fig. ld) and transformed into piliatedEagan, and DNA from kanamyacin-resistant isolates was ana-lyzed by Southern hybridization to identify mutants with linkedalleles.One isolate, containing both mutations, was designated

E116 and characterized for its ability to produce pili. Westernblot analysis using anti-pilin antiserum confirmed that themutant still produced pilin. However, an ELISA using anti-purified pilus antiserum (R19) demonstrated that neither thehifD deletion (E116) nor the insertion (E114) mutant ex-pressed pili but wild-type levels of reactivity still occurred with

INFECT. IMMUN.

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

IDENTIFICATION OF TWO H. INFLUENZAE PILUS GENES 4925

60

hIfC Ter S.D. hifD MetGln120

AAAACACCCAAAAAATTAACCGCACTTTGCCATCAACAATCCACCGCTTCTTGTAGTGGCLysThrProLysLysLeuThrAlaLeuCysHisGlnGlnSerThrAlaSerCySSerGly

t 180

TCGAATTATAGTGGCTCAAATTATAGTGGCTCAAAATGCTTTAGGCTTCATCGTCTGGCTSerAsnTyrSerGlySerAsnTyrSerGlySerLysCysPheArgLeuHisArgLeuAla

240TTGCTTGCTTGCATTGTGGCACTGCCTGCTTATGCCGTTGATGGCAGAGTGACCTTTCAALeuLeuAlaCysIleValAlaLeuProAlaTyrAlaValAspGlyArgValThrPheGln

300GGGGAGATTGTAAGTGATGGCACTTGTAAAATTGAAACAGACAGCAAAAATCGCACTGTTGlyGluIleValSerAspGlyThrCysLysIleGluThrAspSerLysAsnArgThrVal

V my6-14 360ACCCTGCCAACGGTGGGCAAAGCCAATTTAAGCCTTGCAGGGCAAACCGCCGCCCCCGTGThrLeuProThrValGlyLysAlaAsnLeuSerLeuAlaGlyGlnThrAlaAlaProVal

420CCTTTTTCTATCACGCTAAAAGAGTGTAATGCAGCCGATGCTAAAAAAGCCAATCTGCTAProPheSerIleThrLeuLysGluCysAsnAlaAlaA.pAlaLysLysAlaAsnLeuLeu

480TTTAGTGGGGCAGTAACAAAAGGTCAGCTTTATCTTTCTAATGCCGCAAGCAGCGGCAAAPheSerGlyAlaValThrLysGlyGlnLeuTyrLeuSerAsnAlaAlaSerSerGlyLys

540GCCAACAATGTTGGCATTCAAATTGTCAAAGCTGATGGCACAGGCTCGCCCATTAACGTAAlaAsnAsnValGlyIleGlnIleValLysAlaAspGlyThrGlySerProlleAsnVal

600GACGGCAGCCAAGCCAACAGCGAAAAAGCCCCCGACACAGGCAAAGAGCAAAACAGCACAAspGlySerGlnAlaAsnSerGluLysAlaProAspThrGlyLysGluGlnAsnSerThr

660GTTATTCAACCCCGTTTTGACTACTTCGCACATTATTACGCCACAGGTGCCGCCACCGCAValIleGlnProArgPheAspTyrPheAlaHisTyrTyrAlaThrGlyAlaAlaThrAla

720GGCGAAGTTGAAGCCACTGCAACTTTTCAAGTGCAGTATAACTAATTTATCATAGGCAATGlyGluValGluAlaThrAlaThrPheGlnValGlnTyrAsnTer hifE

780AGAATAAA-ATGAAAACTTTAACAACATACGCAAAGTATTTCACGCCCATCTCTAAAATTS.D. MetLysThrL.uThrThrTyrAlaLysTyrPheThrProlleSerLysIle

840GCATTCTTATTTTGTTTCTTAATGGGGAATATTGCAGAAGCCACGATCAAAAGGGCAAAAAlaPheLeuPheCysPheLeuMetGlyAsnIlleAlaGluAlaThrIleLysArgAlaLys

t 900TTTACTAACGGATTTTCAGGAATAAATAGAATTATTACTTATACTTTTGAAGGAAGTTCTPheThrAsnGlyPheSerGlyIleAsnArgIleIleThrTyrThrPheGluGlySerSer

960ACAATGATTGCTTCTGCTACCACACCAGAACAGATCCTTTTTTCTAAAGCAAGAGACAATThrMetIleAlaSerAlaThrThrProGluGlnIleLeuPheSerLysAlaArgAspAsn

1020ACGGTCATTGATCCATCATATTCCAATAATGTCCAGCAATGGTCGGTATTTAATAATTGGThrValIleAspProSerTyrSerAsnAsnValGlnGlnTrpSerVal PheAsnAsnTrp

1080ATAGATACCACTGTTTCAGGCGATACGGGTTATAGTTTTGCAGGATTTAGTTGTGTATCTIleAspThrThrValSerGlyAspThrGlyTyrSerPheAlaGlyPheSerCysValSer

1140

AACCCTTGCGCGCAAATGCAACTGCCCTTACGATTTTATCTTGATAGTGCAATATTAGAAAsnProCysAlaGlnMetGlnLeuProLeuArgPheTyrLeuAspSerAlaIleLeuGlu

1200GCTACGTCGATGCGGAGTGCTGATAATCAAGTTATTTTTAAAATACGTCAACATCCAGAGAlaThrSerMetArgSerAlaAspAsnGlnVal IlePheLysI leArgGlnHisProGlu

1260CTTGGTGTTTCTTTTCAATTAGGAATGAAAAAAGGTATTGAAGATGTTAAATGGTTAAGTLeuGlyValSerPheGlnLeuGlyMetLysLysGlyIleGluAspValLysTrpLeuSer

1320AATTTACAACAAGAGGATTTTTTACTAACCACTTTACAAATTTATTTTGGTGATGCAGCGAsnLeuGlnGlnGluAspPheLeuLeuThrThrLeuGlnIleTyrPheGlyAspAlaAla

1380GATATATCATTTAAAGTAAGAGCAAAATTACACTTACTTAAATTACCTACTGAAAATACAAspIleSerPheLysValArgAlaLysL.uHisLeuLeuLysLeuProThrGluAsnThr

1440GAGCTTCCTACAATGAAACTTAATCTTGGTCAAATTAAATTGCAATCTTGGGGAATAAATGluLeuProThrMetLysLeuAsnLeuGlyGlnIleLysLeuGlnSerTrpGlyIleAsn

1500AATTGGGGACGTACAAAAGTATCATATCGAGTTCAAGATGTTGGTTCACTTAATGTGCAAAsnTrpGlyArgThrLysValSerTyrArgValGlnAspValGlySerLeuAsnValGln

my--10 V

CTTAAGACGCCAAAAATTTACTTCATCCAACAACAACGCCAATGTATCTTGAATAGTACTLeuLysThrProLys I leTyrPheI leGlnGlnGlnArgGlnCys I leLeuAsnSerThr

1620TACAAAAAAATACCAGTCACTCTAAAAAGTGTTAAAAAACGTGAATTTGAGACAAACACTTyrLysLysIleProValThrLeuLysSerValLysLysArgGluPheGluThrAsnThr

1680GAAATTGAAGGTGGACAATTTAAGCTAAGAGTGAACTGTGAGGATACAACATATAACAAAGluIleGluGlyGlyGlnPheLysLeuArgValAsnCysGluAspThrThrTyrAsnLys

1740TTTAACGGCAAATGGTTATTTCCTGTAGTGAAAGTTACTTTTAGGGGCGAAGATGGTACAPheAsnGlyLysTrpLeuPheProValValLysValThrPheArgGlyGluAspGlyThr

1800ATGAATGATGGAACAAATGAATTACTTCGCACCCAAACAGGCACCGGACAAGCCACAGGCMetAsnAspGlyThrAsnGluLeuLeuArgThrGlnThrGlyThrGlyGlnAlaThrGly

1860GTTAGCTTAAAAATCAAACGTGATAGCGGTAATGGCGATTCGGTTAAATATGGACTTGATValSerLeuLys I leLysArgAspSerGlyAsnGlyAspSerVal LysTyrGlyLeuAsp

1920TCAGCCAATATGAATAATCATGGACAATTTGAATTAAAAAAACAACCATCCCCTGCTGGCSerAlaAsnMetAsnAsnHisGlyGlnPheGluLeuLysLysGlnProSerProAlaGly

V my6-13 1980GGAGATCAAAGTGCTGAAGAAACCTTCAAAGTCTATTACGTAAAAGACACAACAAGAGGTGlyAspGlnSerAlaGluGluThrPheLysValTyrTyrValLysAspThrThrArgGly

2040GCTTTAACCGAAGGAAAAGTTAAAGCCGCCGCCACTTTCACAATGTCATATCAATAATAAAlaLeuThrGluGlyLysValLysAlaAlaAlaThrPheThrMetSerTyrGlnTer

2100TGTAGGGTGGGCGTAAGCCCAACGCGGGATATAACCAAACAAACACGTGGGCTTACGCCC

2160ACCCTACAACTAATTAAAACGTGGCGTAGAATAGCATAGATTACATATATTGAGCAAAC

2220GTTTGCTAAATGGTTTTTGTAGGAAAATACCATTGCAACTTTAAGGATAAAATTTTATCC

2280TAGGCATAACTTTTATAAGAATAGGTCAAATT-ATGTTAGCCAAAGCAAAATATAGAAAA

pepN homolog S.D. MetLeuAlaLysAlaLysTyrArgLys2340

GATTACAAACAACCAGATTTTACGGTCACAGATATTTATTTAGATTTTCAACTTGATCCTAspTyrLysGlnProAspPheThrValThrAspIleTyrLeu.AspPheGlnLeuAspPro

2400AAACATACTGTGGTAACCGCAATCACAAAATTCCAACGCTTAAATAATGAAGCGACTTCTLysHisThrValValThrAlaIleThrLysPheGlnArgLeuAsrAsnGluAlaThrSer

2460TTATGTTTAGACGGGCATAGCTTCCAGTTTTCTTCTATTAAATTTAATGGCGAGCCATTTLeuCysLeuAspGlyHisSerPheGlyPheSerSerIleLysPheAsnGlyGluProPhe

2520TCTGATTATCAACAAGATGGCGAGAGTTTAACGCTCGATTTAAAAGACAAAAGTGCGGATSerAspTyrGlnGlnAspGlyGluSerLeuThrLeuA.spLeuLysAspLysSerAlaAsp

2580GAATTTGAGCTTGAAATTGTGACGTTCCTTGTGCCAGCCGAAAATACGTCATTACAAGGGGluPheGluLeuGluIleValThrPheLeuValProAlaGluAsnThrSerLeuGlnGly

V my6-ll 2640CTATATCAGTCTGGCGAAGGTATTTGTACGCAATGTGAGGCGGAAGGTTTCCGTCAAATCLeuTyrGlnSerGlyGluGlyIleCysThrGlnThrGluAlaGluGlyPheArgGlnIle

FIG. 2. DNA and predicted amino acid sequence of hifD, hifE, and the beginning of the pepN homolog. The ATG start codons, putativeShine-Dalgarno (S.D.) ribosomal binding sites, and termination codons (Ter) are underlined. The exact positions of my8-14, -10, -13, and -11 are

indicated by inverted triangles; proposed signal sequence cleavage sites for hifD and hifE are indicated by vertical arrows.

E106 (pepN homolog::m-yb-06) (Table 2). In addition, neitherthe hifD deletion (E116) nor the insertion (E114) mutantagglutinated RBCs, whereas thepepN homolog mutant (E106)hemagglutinated RBCs at the same level as Elap+ (Table 2).These results indicate that the loss of functional pili from ahifD insertion mutant was not due to polar effects on hifE,further demonstrating that hifD is required for pilus expressionin Hib.

DISCUSSION

Pilus biogenesis in various gram-negative bacteria share a

number of common features. Most pilus expression systemspossess periplasmic chaperone proteins that cap and ferry pilus

subunits from the inner membrane to outer membrane usherproteins (21). Usher proteins appear to coordinate subunitintegration in pilus biogenesis (10). Pili are composed ofmultiple subunits that provide pilus structural integrity (13, 24,33), function as adhesins (2, 34), or act as initiators, adaptors(22), or terminators (1) in pilus biogenesis. Similar to that inother gram-negative organisms, pilus expression in Hib re-quires chaperone-like (21) and usher-like (53) proteins and amajor structural subunit, pilin (16, 50). To date, no other pilusstructural components have been identified in Hib pili.

In this study, we describe two additional genes, hifD andhifE, encoding proteins that are required for the biogenesis ofHib pili. Their involvement in pilus expression was docu-mented by the loss of structural and functional pili from the

VOL. 62, 1994

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

4926 McCREA ET AL.

HifA M 1HifD M Q K T P K K L T A L C H Q Q S T A S C S G S N Y S G S N Y 30

Hi fAHifD

Hi fAHifD

Hi fAHifD

Hi fAHifD

Hi fAHifDHifE

Hi fAHifDHifE

Hi fAHifDHifE

HifAHifDHifE

KLLMI L IA A NMQ aAM NA D T K T P Tl 31S G K C F R H R IL A LlL V L JA Y A V D R T 60

F M K V - E N IT C Q -V K D H |K N R S VI V N D IV G K N 60Q E E V S U G IT C K I E I K N R T Vl T P T IV GKQ A 90

S L K D K G N T Al M f T IP F T I I L Q N C N L T A A N S S J1 90L S L A IG Q T A A V F S I T L K E CN-- - - - - - 113

N K N K V G Y Y W E N A D E rN N T K K T S T 120A D IA K Kl A Nfl L JS GJ - - A V T J G QJLJ - a S J LA S 140

ND F A T M N I 1 E G K E I K V V G K E T E D 150GKA - - N N IQI- - - - - - - - - - - - 156GQ - - T G L K I K RJ D S N - - - - - - - - - - - - 368

F V H K N A T G A SJV A L T Q H P D D H I S T L T 180_--T_-_G[SI NJ S Q NS E A P D IT Gl K E IQ1IS 181

_ G S V K Y LD S A M N N HG Q F [E L K K P p 395

G G|LIQT 2061J;T1D!LHFIQYY--IQPRFE IDY IFI E IY Yl - -- -EIAIT IGAIEITIWIGITE 206

G G LJEE T K V V K D T R L E 4hK 425ISSlV D 0 ff--DrEl 216

1771Tl[A Tl IFIL N IY NJ 216WAl> TI g T S Shr QI 435

FIG. 3. Comparison of the predicted amino acid sequence of HifA, HifD, and the C terminus of HifE. Conserved and identical residues are

in boxes, pilin-like signatures (see discussion) are in bold type, and dashes facilitate sequence alignment.

cell surface of mutants containing aberrations in either gene.Since pilin was still produced in these strains and mutantscontaining insertions within either hifD or hifE still reactedslightly with an anti-purified pilus antiserum (suggesting thepresence of an immature or abortive form of pili on the cellsurface), we hypothesize that HifD and HifE may be minorstructural proteins required for pilus biogenesis. This pattern isexemplified in other gram-negative organisms, where the lossof minor pilus structural components often results in a widerange of phenotypes ranging from a total loss of pili (55) to avariety of changes in pilus number, structure, or adhesiveability (3, 25, 31, 38, 45).The primary structures of the predicted HifD and HifE

proteins have features in common and like those of the majorstructural component of pili, HifA. All three proteins havestrong C-terminal amino acid homology to one another, con-tain a conserved tyrosine and glycine 2 and 14 residues fromthe C terminus, and contain a pair of similarly spaced cysteineresidues (Fig. 3). These pilin and pilin-like signatures arecommon in pilus structural components of other gram-negativeorganisms (25, 30, 43, 55), and the importance of a conservedC terminus for chaperone interaction has been demonstrated(28, 44). Besides the presence of a conserved C terminus, the

TABLE 1. Immunologic and adherence characterizationof insertion mutants

Ela strains Reactivity to anti- HA titerb BECpilus antiseruma adherencea

Elap+ 1.220 ± 0.106 1:16 1.220 ± 0.076Elll (pepN::my8-11) 1.233 ± 0.120 1:16 1.024 ± 0.112E114 (hiJD::my8-14) 0.596 ± 0.102 <1:1 0.445 ± 0.061EllO (hifE::m-y8-10) 0.401 ± 0.085 <1:1 0.303 ± 0.056E113 (hifE::my8-13) 0.610 ± 0.113 <1:1 0.284 ± 0.022Elap- 0.272 ± 0.079 <1:1 0.283 ± 0.042R10/conjc NAd NA 0.266 ± 0.022

a Optical density mean ± standard deviation obtained from eight microtiterwells.

b HA, hemagglutination.' Primary and conjugated antisera reactivity to BECs alone.d NA, not applicable.

predicted HifE protein is approximately twice the size of eitherHifA or HiMD, has no amino acid homology to other proteinsin its N terminus, and contains four cysteine residues. Sincethese features are reminiscent of E. coli Pap (30, 34), type 1(25), and F17 (32) and putative B. pertussis pilus adhesivecomponents (55), we speculate that HifE may be the adhesivecomponent in Hib pili.The identification of hifD and hifE defines one end of the

pilus gene cluster for Hib strain Eagan. An insertionallyinactivated E. coli aminopeptidase homolog, pepN, down-stream of hifE did not affect Hib pilus expression, suggestingthat the pepN homolog in H. influenzae is not involved in pilusbiogenesis. At the other end of the pilus gene cluster, twogenes with amino acid homologies to two E. coli purinebiosynthesis enzymes, PurE and PurK, have previously beenidentified about 750 bp past hifA, and these genes are notrequired for pilus expression (53). The 750-bp gap betweenhifA and thepurE homolog is currently under study. Figure 4ashows the current Hib strain Eagan pilus gene cluster withflanking genes.

Interestingly, DNA sequences identified immediately down-stream of hifE were found to be repeated throughout the pilusgene cluster. These sequences occur immediately downstreamof hifA, between hifA and hifB (unpublished results), andbetween hifB and hifC (Fig. 4a) (53). The repeats flanking hifCand hifE were found as large palindromes (Fig. 4b), and eachrepeat in the cluster contains a common inverted repeat with

TABLE 2. Phenotypic comparison between hifD insertionand in-frame deletion mutants

Ela strains Reactivity to anti- HA titerpilus antiseruma

Elap+ 0.983 ± 0.136 1:16E106 (pepN::m-y8-06) 1.101 ± 0.125 1:16E114 (hiJD::my8-14) 0.265 ± 0.059 <1:1E116 (AhiJD -yb-06) 0.119 ± 0.043 <1:1Elap- 0.082 ± 0.004 <1:1

a Optical density mean ± standard deviation obtained from eight microtiterwells.

INFECT. IMMUN.

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

IDENTIFICATION OF TWO H. INFLUENZAE PILUS GENES 4927

__4,4,homolog-. ,

a4,

R-D I -; H DOANm g.00.0- ;r Koimolog-7 1.0kb

D purE.. CCCCACGTGGAGACACAT TTTGTA CGTAAGCCCA-CGCAGATA--TAA-CAAAC----ACGTGGGCTTA . . hi fAhifA.. GCCCACTTGGAGACATATAAAAAAGATTTGTAGG-TGGGTAAGCCCA-CGCGGAACA--TAATCAAACAAC . . hifBhif B.. TAACGTAGGGTGGGCGTAGCCCA-CGCATTACCTATAATCACTTTAATACGrGGGCTTACGCCCACCTTACAAC . . hi fChifE.. TAATTAGGTGGCGTAAGCCCMCGCGGGATA--TAACCAAAAAACACGrGGGCTTACGCCCACCCTACMC . .pepN

- ,- x -

FIG. 4. (a) The positions of the intergenic repeating DNA sequences within the pilus gene cluster (marked by bold arrows in the map); (b)alignment of the intergenic repeating DNA sequences. Palindromic sequences are marked by half arrows.

features similar to rho-independent terminating structures (8)(Fig. 4b). These sequences were not present intragenically orbetween hifC and hifD or hiJD and hifE. The significance ofthese repeating DNA sequences is unknown; however, repeatsequences are common in bacterial genomes (35). E. colichromosomes contain hundreds of repetitive extragenic palin-drome elements that are located within or at the end ofoperons. Although the significance of repetitive extragenicpalindrome sequences is unclear, proposed functions includegene regulation or mRNA stabilization (6, 40, 46, 47). Sixteen-or 18-bp direct repeats in E. coli 536 have recently been foundflanking genetic determinants for hemolysin and P-related pili,and high-frequency excision of these segments resulted inreduced virulence of the organism (5, 39). In addition, repeatsequences in the form of insertion elements (9, 27) andrho-independent terminators containing DNA uptake se-quences (26, 49) have been identified in the H. influenzaegenome, and their role in the acquisition of virulence factorshas been proposed.

In conclusion, we have identified two additional genesinvolved in the expression of Hib pili, and these genes appearto define one end of the gene cluster in strain Eagan. Pheno-typic alterations of pilus expression in the absence of thesegenes and predicted amino acid sequence homologies suggestthat they encode structural components of Hib pili.

ACKNOWLEDGMENTS

We would like to thank Shelly Tucci and Theresa Sweet for theirtechnical assistance.

This work was supported by grant RO1-AI25630 from the NationalInstitutes of Health.

REFERENCES1. Baga, M., M. Norgren, and S. Normark 1987. Biogenesis of E. coli

Pap pili: papH, a minor pilin subunit involved in cell anchoringand length modulation. Cell 49:241-251.

2. Bakker, D., P. T. Willemsen, L. H Simons, F. G. van ZUderveld,and F. K. de Graaf. 1992. Characterization of the antigenic andadhesive properties of FaeG, the major subunit of K88 fimbriae.Mol. Microbiol. 6:247-255.

3. Bakker, D., P. T. Willemsen, R. H. Willems, T. T. Huisman, F. R.Mooi, B. Oudega, F. Stegehuis, and F. K. de Graaf. 1992.Identification of minor fimbrial subunits involved in biosynthesisof K88 fimbriae. J. Bacteriol. 174:6350-6358.

4. Berg, C. M., N. B. Vartak, G. Wang, X. Xu, L. Liu, D. J. MacNeil,K. M. Gewain, L. A. Wiater, and D. E. Berg. 1992. The m gammadelta-1 element, a small gamma delta (TnlOOO) derivative usefulfor plasmid mutagenesis, allele replacement and DNA sequencing.Gene 113:9-16.

5. Blum, G., M. Ott, A. Lischewski, A. Ritter, H. Imrich, H. Tschape,and J. Hacker. 1994. Excision of large DNA regions termedpathogenicity islands from tRNA-specific loci in the chromosomeof an Escherichia coli wild-type pathogen. Infect. Immun. 62:606-614.

6. Boccard, F., and P. Prentki. 1993. Specific interaction of IHF with

RIBs, a class of bacterial repetitive DNA elements located at the3' end of transcription units. EMBO J. 12:5019-5027.

7. Coleman, T., S. Grass, and R. J. Munson. 1991. Molecular cloning,expression, and sequence of the pilin gene from nontypeableHaemophilus influenzae M37. Infect. Immun. 59:1716-1722.

8. d'Aubenton Carafa, Y., E. Brody, and C. Thermes. 1990. Predic-tion of rho-independent Escherichia coli transcription terminators.A statistical analysis of their RNA stem-loop structures. J. Mol.Biol. 216:835-858.

9. Dobson, S. R M., J. S. Kroll, and E. R Moxon. 1992. Insertionsequence IS1016 and absence ofHaemophilus capsulation genes inthe Brazilian purpuric fever clone of Haemophilus influenzaebiogroup aegyptius. Infect. Immun. 60:618-622.

10. Dodson, K. W., F. Jacob-Dubuisson, R T. Striker, and S. J.Hultgren. 1993. Outer-membrane PapC molecular usher discrimi-nately recognizes periplasmic chaperone-pilus subunit complexes.Proc. Natl. Acad. Sci. USA 90:3670-3674.

11. Foglino, M., S. Gharbi, and A. Lazdunski. 1986. Nucleotidesequence of the pepN gene encoding aminopeptidase N of Esch-erichia coli. Gene 49:303-309.

12. Forney, L. J., C. F. Marrs, S. L. Bektesh, and J. R Gilsdorf. 1991.Comparison and analysis of the nucleotide sequences of pilingenes from Haemophilus influenzae type b strains Eagan and M43.Infect. Immun. 59:1991-1996.

13. Gaastra, W., F. R Mooi, A. R Stuitje, and F. K. de Graaf. 1981.The nucleotide sequence of the gene encoding the K88ab proteinsubunit of porcine enterotoxigenic E. coli. FEMS Microbiol. Lett.12:41-46.

14. Gilsdorf, J. R, H. Y. Chang, K. W. McCrea, and L. 0. Bakaletz.1992. Comparison of hemagglutinating pili of Haemophilus influ-enzae type b with similar structures of nontypeable H. influenzae.Infect. Immun. 60:374-379.

15. Gilsdorf, J. R, L J. Forney, and K. W. McCrea. 1993. Reactivityof antibodies against conserved regions of pilins of Haemophilusinfluenzae type b. J. Infect. Dis. 167:962-965.

16. Gilsdorf, J. R, C. F. Marrs, K. W. McCrea, and L. J. Forney. 1990.Cloning, expression, and sequence analysis of the Haemophilusinfluenzae type b strain M43p+ pilin gene. Infect. Immun. 58:1065-1072.

17. Gilsdorf, J. R, K. McCrea, and L. Forney. 1990. Conserved andnonconserved epitopes among Haemophilus influenzae type b pili.Infect. Immun. 58:2252-2257.

18. Guerina, N. G., S. Langermann, H. W. Clegg, T. W. Kessler, D. A.Goldman, and J. R Gilsdorf. 1982. Adherence of piliated Hae-mophilus influenzae type b to human oropharyngeal cells. J. Infect.Dis. 146:564.

19. Guerina, N. G., S. Langermann, G. K. Schoolnik, T. W. Kessler,and D. A. Goldmann. 1985. Purification and characterization ofHaemophilus influenzae pili, and their structural and serologicalrelatedness to Escherichia coli P and mannose-sensitive pili. J. Exp.Med. 161:145-159.

20. Herriott, R M., E. M. Meyer, and M. Vogt. 1970. Definednongrowth media for stage II development of competence inHaemophilus influenzae. J. Bacteriol. 101:517-524.

21. Holmgren, A., M. J. Kuehn, C. I. Branden, and S. J. Hultgren.1992. Conserved immunoglobulin-like features in a family ofperiplasmic pilus chaperones in bacteria. EMBO J. 11:1617-1622.

22. Jacob-Dubuisson, F., J. Heuser, K. Dodson, S. Normark, and S.

VOL. 62, 1994

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from

4928 McCREA ET AL.

Hultgren. 1993. Initiation of assembly and association of thestructural elements of a bacterial pilus depend on two specializedtip proteins. EMBO J. 12:837-847.

23. Kar, S., S. C. To, and C. C. Brinton, Jr. 1990. Cloning andexpression in Escherichia coli of LKP pilus genes from a nontype-able Haemophilus influenzae strain. Infect. Immun. 58:903-908.

24. Klemm, P. 1984. The fimA gene encoding the type-1 fimbrialsubunit of Escherichia coli. Nucleotide sequence and primarystructure of the protein. Eur. J. Biochem. 143:395-399.

25. Klemm, P., and G. Christiansen. 1987. Three fim genes requiredfor the regulation of length and mediation of adhesion of Esche-richia coli type 1 fimbriae. Mol. Gen. Genet. 208:439-445.

26. Kroll, J. S., B. M. Loynds, and P. R. Langford. 1992. PalindromicHaemophilus DNA uptake sequences in presumed transcriptionalterminators from H. influenzae and H. parainfluenzae. Gene 114:151-152.

27. Kroll, J. S., B. M. Loynds, and E. R. Moxon. 1991. The Haemophi-lus influenzae capsulation gene cluster: a compound transposon.Mol. Microbiol. 5:1549-1560.

28. Kuehn, M. J., D. J. Ogg, J. Kihlberg, L. N. Slonim, K Flemmer, T.Bergfors, and S. J. Hultgren. 1993. Structural basis of pilus subunitrecognition by the PapD chaperone. Science 262:1234-1241.

29. Langermann, S., and A. Wright. 1990. Molecular analysis of theHaemophilus influenzae type b pilin gene. Mol. Microbiol. 4:221-230.

30. Lindberg, F., B. Lund, and S. Normark. 1986. Gene productsspecifying adhesion of uropathogenic Escherichia coli are minorcomponents of pili. Proc. Natl. Acad. Sci. USA 83:1891-1895.

31. Lindberg, F. P., B. Lund, and S. Normark. 1984. Genes ofpyelonephritogenic E. coli required for digalactoside-specific ag-glutination of human cells. EMBO J. 3:1167-1173.

32. Lintermans, P. F., A. Bertels, C. Schlicker, F. Deboeck, G.Charlier, P. Pohl, M. Norgren, S. Normark, M. van Montagu, andH. De Greve. 1991. Identification, characterization, and nucleotidesequence of the F17-G gene, which determines receptor binding ofEscherichia coli F17 fimbriae. J. Bacteriol. 173:3366-3373.

33. Livey, I., C. J. Duggleby, and A. Robinson. 1987. Cloning andnucleotide sequence analysis of the serotype 2 fimbrial subunitgene of Bordetella pertussis. Mol. Microbiol. 1:203-209.

34. Lund, B., F. Lindberg, B. L. Marklund, and S. Normark 1987. ThePapG protein is the alpha-D-galactopyranosyl-(1----4)-beta-D-galactopyranose-binding adhesin of uropathogenic Escherichiacoli. Proc. Natl. Acad. Sci. USA 84:5898-5902.

35. Lupski, J. R., and G. M. Weinstock 1992. Short, interspersedrepetitive DNA sequences in prokaryotic genomes. J. Bacteriol.174:4525-4529.

36. McCaman, M. T., and J. D. Gabe. 1986. The nucleotide sequenceof the pepN gene and its over-expression in Escherichia coli. Gene48:145-153.

37. McCrea, K W., C. F. Marrs, and J. R. Gilsdorf. 1993. Gelcompressions and artifact banding can be resolved in the sameDNA sequence reaction. Biotechniques 15:843-844.

38. Mooi, F. R., M. van Buuren, G. Koopman, B. Roosendaal, andF. K. de Graaf. 1984. K88ab gene of Escherichia coli encodes afimbria-like protein distinct from the K88ab fimbrial adhesin. J.Bacteriol. 159:482-487.

39. Morschhauser, J., V. Vetter, L. Emody, and J. Hacker. 1994.Adhesin regulatory genes within large, unstable DNA regions ofpathogenic Escherichia coli: cross-talk between different adhesingene clusters. Mol. Microbiol. 11:555-566.

40. Newbury, S. F., N. H. Smith, E. C. Robinson, L. D. Hiles, and C. F.Higgins. 1987. Stabilization of translationally active mRNA by

prokaryotic REP sequences. Cell 48:297-310.41. Ofek, I., H. S. Courtney, D. M. Schifferli, and E. H. Beachey. 1986.

Enzyme-linked immunosorbent assay for adherence of bacteria toanimal cells. J. Clin. Microbiol. 24:512-516.

42. Pichichero, M. E., M. Loeb, P. Anderson, and D. H. Smith. 1982.Do pili play a role in pathogenicity of Haemophilus influenzae typeB? Lancet ii:960-962.

43. Roosendaal, E., A. A. Jacobs, P. Rathman, C. Sondermeyer, F.Stegehuis, B. Oudega, and F. K. de Graaf. 1987. Primary structureand subcellular localization of two fimbrial subunit-like proteinsinvolved in the biosynthesis of K99 fibrillae. Mol. Microbiol.1:211-217.

44. Simons, B. L., P. Rathman, C. R. MaliJ, B. Oudega, and F. K. deGraaf. 1990. The penultimate tyrosine residue of the K99 fibrillarsubunit is essential for stability of the protein and its interactionwith the periplasmic carrier protein. FEMS Microbiol. Lett.55:107-112.

45. Simons, L. H., P. T. Willemsen, D. Bakker, F. K de Graaf, and B.Oudega. 1991. Localization and function of FanH and FanG,minor components of K99 fimbriae of enterotoxigenic Escherichiacoli. Microb. Pathog. 11:325-336.

46. Stern, M. J., G. F. Ames, N. H. Smith, E. C. Robinson, and C. F.Higgins. 1984. Repetitive extragenic palindromic sequences: amajor component of the bacterial genome. Cell 37:1015-1026.

47. Stern, M. J., E. Prossnitz, and G. F. Ames. 1988. Role of theintercistronic region in post-transcriptional control of gene expres-sion in the histidine transport operon of Salmonella typhimurium:involvement of REP sequences. Mol. Microbiol. 2:141-152.

48. Stull, T. L., P. M. Mendelman, J. E. Haas, M. A. Schoenborn,K. D. Mack, and A. L. Smith. 1984. Characterization ofHaemophi-lus influenzae type b fimbriae. Infect. Immun. 46:787-796.

49. Tomb, J. F., H. el-Hajj, and H. 0. Smith. 1991. Nucleotidesequence of a cluster of genes involved in the transformation ofHaemophilus influenzae Rd. Gene 104:1-10.

50. van Ham, S. M., F. R. Mooi, M. G. Sindhunata, W. R. Maris, andL. van Alphen. 1989. Cloning and expression in Escherichia coli ofHaemophilus influenzae fimbrial genes establishes adherence tooropharyngeal epithelial cells. EMBO J. 8:3535-3540.

51. van Ham, S. M., L. van Alphen, F. R. Mooi, and J. P. van Putten.1993. Phase variation of H. influenzae fimbriae: transcriptionalcontrol of two divergent genes through a variable combinedpromoter region. Cell 73:1187-1196.

52. von HeiJne, G. 1983. Patterns of amino acids near signal-sequencecleavage sites. Eur. J. Biochem. 133:17-21.

53. Watson, W. J., J. R. Gilsdorf, M. A. Tucci, K. W. McCrea, L. J.Forney, and C. F. Marrs. 1994. Identification of a gene essentialfor piliation in Haemophilus influenzae type b with homology to thepilus assembly platform genes of gram-negative bacteria. Infect.Immun. 62:468-475.

54. Weber, A., K Harris, S. Lohrke, L. Forney, and A. L. Smith. 1991.Inability to express fimbriae results in impaired ability of Hae-mophilus influenzae b to colonize the nasopharynx. Infect. Immun.59:4724-4728.

55. Willems, R. J., C. Geuijen, H. G. van der Heide, M. Matheson, A.Robinson, L. F. Versluis, R. Ebberink, J. Theelen, and F. R. Mooi.1993. Isolation of a putative fimbrial adhesin from Bordetellapertussis and the identification of its gene. Mol. Microbiol. 9:623-634.

56. Yen, C., L. Green, and C. G. Miller. 1980. Degradation ofintracellular protein in Salmonella typhimurium peptidase mu-tants. J. Mol. Biol. 143:21-33.

INFECT. IMMUN.

on Novem

ber 12, 2020 by guesthttp://iai.asm

.org/D

ownloaded from