december 24 & 25, 2019
TRANSCRIPT
4097 18th Street Bettendorf, IA 52722
(563) 332-7910 www.sjvbett.org
ST. JOHN VIANNEY Church
December 24 & 25, 2019
Daily Mass schedule this week only: December 26—No Mass December 27—9:00am,
followed by adoration
PASTOR’S PERSPECTIVE
Music is a beautiful way of expressing the joy of Christmas. We sing traditional Christmas carols during Mass and hear a myriad of holiday music in our homes and community. Poetic texts, coupled with music, touch the heart in ways that simply speaking works cannot express.
In fact, you will find many hymns in the bible—particularly in the 150 Psalms of the Hebrew Bible, the gospel of Luke, and some of the letters of Paul. Mary sings a song of joy as mother of the Savior when she visits Elizabeth—her Magnificat (Luke 1: 46-55). Saint Paul records an early Christian hymn as he urges the Church of Philippi to live the attitude of Jesus (Philippians 2: 6-11). And there are many other such hymns.
My favorite Christmas hymn is probably not as familiar as Silent Night or Joy to the World. Rather, it is Of the Father’s Love Begotten. It is based on a poem written by Aurelius Prudentius Clemens, who lived in the fourth century. During this time, the Church was fighting against many heresies concerning Jesus. The worst was Arianism, which taught that God the Father and the Son did not co-exist throughout eternity. Arian taught that Jesus was a creature that, though divine, was not equal to the Father. This was refuted by the Council of Nicea in 325 AD.
To emphasize the true nature of the Trinity, Prudentius composed a theological poem, later set to plain chant as early as the tenth century. The first line of the poem, in Latin, is: Corde natus ex parentis ante mundi exordium–literally “born from the parent’s here before the beginning of world (time).” He sets forth his argument that the Son has always, is always, and will always be with God and with us. In fact, if you read it closely, he repeats the theme three times!
Of the Father’s love begotten Ere the worlds began to be,
He is Alpha and Omega, He the Source, the Ending He,
Of the things that are, that have been, And that future years shall see
Evermore and evermore. I first heard this hymn while serving as pastor of Saint Mary’s Church and chaplain of the Catholic students at Central College in Pella, Iowa. In 1986, I participated in my first “Christmas Candlelight Service” at the college. The school choir devoutly sang this hymn. I was so moved by its beauty that I was moved to tears.
Years later, while studying at the University of Notre Dame, I learned that centuries before the Church taught that there were only seven sacraments, the human tear was considered a sacrament–a reminder of the very presence of God. My eyes still water, and I get a lump in my throat, whenever I hear this beautiful hymn. (It’s #427 in our Gather hymnal.)
If you would like to enjoy a magnificent rendition of this hymn, go to YouTube and enter its title, including “Augustana College.” It was recorded in 2011 at Centennial Hall, Rock Island, with the Augie choirs and symphony orchestra. If it brings a tear to your eye, know that you are in good company! We will also enjoy the hymn as we give thanks for the gift of Jesus in Holy Communion today!
icat (Luke 1: 4 attttititudude e ofof J Jesesus (Philippians 2: 6
avororititite e e e e e e e e ChChChChChriririststmamamamamas hymnmnmn i i i is s s prprprobobabablyly not as familiar as Silent Night or to the W W W W W Worororororororldldldld. . RaRaRaRaRaRaththther, itit is OfOfOf thehehehe F F Fatatatatheher’r’s s Love Begotten. It is based a poeemm wwwwwrrrrrittttttteennnnnn by Aureliusss PPPPPrrrrruuuuuuuuuuuudddddeeeennttiiuuussss CClleemens, who lived in the fourth
nturury.y. D Dururururururininining g g g g ththththththis time, the Chuhuhuhurcrcrcrcrch h h h h h h h wawawas s s s s s fifififififififighghghghting against many heresies ncererniningngngngngng J J Jesesesesesesusususususus. ThThe e e e e wowowowowowoworsrsrsrsrsrsrst wawawawawawas ArAriaiaiaiaianininismsm, , , whwhicich taught that God the therer andndndndndnd t t t t thehehehehe S S S S S S S S S S S S S S S S S S Sonononononononononononononononononon d d d d d d d d didididididididididididididididididid n n n n n notototototototototototototototototototototototot c c cooooo--exexexexist ththrorougughohoutututututututututut e eteternity. Arian taught that sus s wawas s s s s a a a a a crcrcrcreaeaeaeaeaeaeaeaeaeaeaeaeaeatuturere t t t thahahahahahahahat,t,t,t,t,t,t,t,t, t t t t t thohohohohohohohohohohohohohohohohougugugugugugugugugugugugugugugugugugugugugugh h h h h h h h h h h didididididivinene, , was s s nononononononononononononot t equal to the Father. This
was rerefuteteteteteted d d d d bybybyby t t t t t t t t t t t t t thehehehe C Cououououououououououncncncncncncilililililililil o o of f f f f f NiNiNiNiNiNiNiNiNiNiNiNiNiNiNicececececececececececea a a a a a inin 3 32525 A AD.
To e empmphahahahahahahasisisisizezezezeze t thehe t t t t t t t t trururururururue e e e e e nananananananananatututututututututututurerererere o o o o o o o o o of f f f f f ththththththe e TrTrininitity,y,y,y, P Prudentius composed a theoeolologigicacacacacacal l l popopopoememememememememememem, lalalateteteteteteteteter r seseseseseseseseseseseseseset t t t t t t t t t totototototototototo p p p p p plalalalalalalalalalalaininininininininininin c c c c c c c c c c chahahahahahahahahantnt a as s earlrlrly y y y y y y y asas the tenth century. The
rst t linenenenenene o o o of f ththththththththththe e e e popoemememememememememem, , inininininininininininin L L L L L L L Latatatatatatatatatatininin, , , , isisis: : : : CoCoCoCoCoCordrde natutututus s s s s s s s s s s exex parentis ante mundi exorordiumumumumumumum––––liliteteteteteterararararararally y “b“b“b“b“b“b“b“b“b“borororn n n n n n n n n n frfrfromomomomomomomomomomomom t t t t t t t t thehehehehehehehehehe p p p p p p pararararararenent’s s heherererererere b befefore the bebegigiginnnning of woworlrld (t(t(t(t(t(timimimimime)e)e).”.”.”.”.”.”.”.”.”.” He e sesesesesesesesesesetststststststststs f f f f f f f f f f fororororororththththththththththth h h h h h h h h hisisisisisisisisis a a a a a a a argrgrgrgrgrgrgrgrgrgrgrgrgrgrgrgrgumumumumumumumumumumumumumenent t thththatatatat t t t t t t t thehehe Sonon h h hasasasasasasasasasasasasasasasasas a a a a a alwlwlwlwlwlwlwlwlwlwlwayayayayayayayayayayayayayayays,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s, i is s alwawaysys, , , ananananand d d wiwiwiwiwiwiwill a a alwlwlwlwlwlwlwlwayayayayayayayayayayays s s s s s bebebebebebebebebebe w w witititititititititith h h h h h h h h GoGoGoGoGoGoGoGoGoGoGoGoGoGoGod d d anananananananand wiwithth u u us.s.s.s.s.s.s.s.s. I In n fafactctctctctctctctctctctctctctctctctctctct, , ifif y you read d d d d d d d d d d ititititititititititit clososely,y,y,y,y,y, h h he e e rererererererererepepepeatats s s s s s s s s thththththththe e e e e e e thththththththththththemememememememememememe e e e e e ththththththththththrerererereree e e e e e e e titititititititititititimemememememememememememememememememememememememememes!s!s!s!s!s!s!s!s!s!
OfOfOfOfOfOfOfOfOfOfOfOfOfOfOf t t t t t thehehehehehehehehehehehe F F F F F F F F Fatatatatatatatatatatatheheheheheheheheheheher’r’r’r’r’r’r’r’r’r’r’r’s s s s s s s lololololololololololoveveveveveveveveveveveveveveveveveveveve b b b b b b b b b b b begegegegegegegegegegegegegotottetetenErErErErErErErErErErEre e e e e e e e e thththththththththe e e e e e e e e e wowowowowowowowowoworlrlrlrlrlrlrlrldsdsdsdsdsdsdsds b b b b b b begegegegegegegegegegegegegegegegegeganananananananananananananan t t t t t t t t t t t t t to o o o o o o o o o bebebebebebebebebebebebebe,,,,,,,,,,
HeHeHeHeHeHeHeHeHeHeHeHe i is s s s s s s s s AlAlAlAlAlAlAlAlphphphphphphphphphphphphphphphpha a a ananananananananananananand d d d d d d d d d d d OmOmOmOmOmOmOmOmOmOmOmOmOmOmOmegegegegegegegegegegegegegega,a,a,a,a,a,a,a,a,a,a,a,a,a,a,a,HeHeHeHeHeHeHeHeHeHeHe t t t t t thehehehehehehehehehehe S S S S S S S S S Sououououououououourcrcrcrcrcrcrcrcrcrcrcrce,e,e,e,e,e,e,e,e, t t t t t t t t t thehehehehehehehehehehe E E E E E E E E E Endndndndndndndndndndndndinininininining g g g g g g g g g g g HeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHeHe,
OfOfOfOfOfOfOf t t t t t t t t t thehehehehehehehehehehehe t t t t t t t t thihihihihihihihihihihingngngngngngngngngngs s s s s s s s s s thththththththththththatatatatatatatatatatatat a a a a a a a a a a arererererererere, , , , , , , , , , , , , thththththththththththththththatatatatatatatatatatatat h h havavavavavavavavavavavavavavavave e e bebebebebebebebebebebebebebeenenenenenenenenenenenenen,,,,AnAnAnAnAnAnAnAnAnAnAnd d d d d d d d d ththththththththatatatatatatatatatatatatat f f futututututututututututututurururururururururururure e e e e e e e yeyeyeyeyeyeyeyeyeyeyeyeyeyeyeyearararararararararararars s s s s s s s s s shshshshshshshalalalalalalalalall l l l l l l l l l seseseseseseseseeeeeeeeeeee
EvEvEvEvEvEvEvEvEvEvEvererererererererererermomomomomomomomomomomomorerererererererererererererere a a a a a a a a a andndndndndndndndndndndndndndndndndndndnd e e e e e e e e e e e evevevevevevevevevermrmrmrmrmrmrmrmororore.e.e.
I fifirsrsrsrsrsrst t t heheheheheararararararararararard thththisisisisisisisisis h hymymymymymymymymymymymymymymymn n whwhwhwhwhwhwhwhwhwhwhililililililililile e e e e e e e e e e seseseseseseseseseseservrvrvrvrvrvrvrvrvrvrvrvrvrvrvrvinininininininininininining g g g g g g asasasasasasasasasasasasasasasasasasas p p p p p p p p pasastototor r r ofofofofofofofofofofof S S S S Saiaiaintntntntntntntntntntnt M M M M M M M M M M M M Marary’s Church achchapapapapapaplalalainininin o of ththe e e e e e e e e e CaCaCaCaCaCaCaCaCaththththththththththththththththolololicicicicicicicicic s s s s stututututututututututututututudedededededededededededededededededededentntntntntntntntntnts s s s s s s atatatatat C C C C C Cenenenenentrtrtralalal C C C C C C Colololololololololololololololollelelelelelegegegegegege i i i i in n n n n n n n n n n n PePePePePePePePePePePella, Iowa. In 1986I papapapapapapartrtrtrticicicipipipipipipipipipipatatatatateded i i i i i i i in n n n n n mymymymymymymymymymymy f f f f f firiririririririrststststststststststststststst “ “ “ChChChChChChChChChChChChChChChChChChChChChChririririririststststststststststststststststmamamamamamamamamamamamamamamamamamamamas s s s s s s s s CaCaCaCaCaCandndlelelelelelililililighghghght SeSeSeSeSeServrvrvrvrvrvrvrvrvrvrvrvrvicicicicice”e” at the college. Tssccccchhhhoooooooll cccccccccchhhoiirr ddddddddddddeeeeeeeeeeeevvooooooooouuuuuutttttttttllyyyyyyyyyyy sssssaaaannggggggggg ttttttthhhhhhhhhiiiiiisssssssssssssss hhyyyymmmmmnn.. I wwas sssoooooo mmmmmmmmmmmmmmoovvveed by its beauty thwawawawawawawas s s momomomomomomoveveveveveveved d tototototototototototo t t t t t t t t t t t teaeaeaeaeaeaeaeaeaeaeaearsrsrsrsrsrsrsrsrsrs.
at thehe U U U U U U U U Uninininininininiveveveveversrsrsrsrsrsrsrsrsrsrsrsrsrsrsitity y ofofofofofofofof N N N N Notototototrererererererere D D D D D D D D D Damamamamamamamamamamamamamamamamamamame,e,e,e,e,e,e,e,e,e,e, I I I I l l l l l leaeaeaearnrneded t that cecececentntntntntntntntntntntntntururies before the Church ta sacrarararamememememememememememememememememementntntntntntnts,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s,s, t t t t thehehehehehehehehehehehe h h h humumumumumumumananananananananan t t t teaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaeaear r r r r r r wawawawawas s coconsididerededededed a a a a a a a s s s s s s s s s s sacacrarament–a reminder of the
es s stitillllll w w w w w w w w w w w w w w watatataterererer, , , anananananand d d d d I gegegegegegegegegegegegegegegegeget t t t t t a a a a a a a a a a a a a a lululululumpmpmpmpmpmpmpmp i in mymy thrhroat, w w w w w w whehehehehehenenever I hear this beautiful hyhymnmnmnmnmnmnmnmnmnmnmnmnmnmnalalalalalalalalalalal.)
oy a m m m m m m m m magagagagagagagninininininininifififififififificecececececececentntntntnt r r r renendidididitititititionononon of f ththisisisisis h hymymn,n, g g g g g g g g go o o o o o o toto YoYouTube and enter its title, incwawas s s s s s s s s rererererecococordrdrdrdededededed i i in n n 202011111111 a at CeCeCeCeCeCeCeCeCeCentntntntntntntenenninialalalal H H H H H Halalalalalall, Rock Island, with the Augie choirt brbrbrininininininininininininininininininininingsgsgsgsgs a t t teaeaeaear r r tototo y youour eyeyeyeyeye,e,e,e,e, k k k k k k k k k knonow w w w w w ththththththththththththththththththatatatatatatatatatatatat y y y y y y y y y y y y y y y y yououou are in good company! We will also
anks f forororororor t t t t t t t t t t t thehehehehehehehe g gifififift t t t ofof Jesesususus in n HoHoHoHolylyly Commumumumumumumumumumumumumumumuninininininininionon today!
LITURGY FOR THE NATIVITY OF THE LORD
Assisted listening devices, large print readings, and low-gluten hosts are available in the Gathering Space.
To maintain reverence, please turn off electronic devices.
INTRODUCTORY RITE
Gathering Song O Come, All Ye Faithful ADESTE FIDELES
Greeting
Priest: In the name of the Father, and of the Son, and of the Holy Spirit.
People: Amen.
Priest: The Lord be with you. (this or a similar greeting will be used)
People: And with your spirit. Penitential Act
Christmas Prelude Music
Tuesday, December 24
4:00 pm Brass Ensemble Becky Seward Bailey Connors Molly Seybert
Carols—Brass Ensemble Piano Solos—Becky Seward
Vocal Solos—Molly and Bailey What Child is This? Birthday of a King
Mary Did You Know? O Holy Night
6:30 pm Celebration Ringers Elizabeth Weimer Ethan Good Andy Burman Megan Guest Jimmy Guest Kaylin McNeal
Veni, Veni Emmanuel O Holy Night
O Little Town of Bethlehem Mary, Did You Know?
Lo! How a Rose 10:00 pm Exultate Choir and Woodwind Trio Ed Waligora Becky Seward Steph Bray
Shepherd’s Echo Carol My Heart, Your Bethlehem
What Child is This? Calypso Lullaby
Breath of Heaven
Wednesday, December 25
10:00 am Young Adult Music Ministry Ethan Good Claire Thomsen Kaylin McNeal Katie Byrne
Piano Solos—Ethan Good Flute Solos—Claire Thomsen
Vocal Solos—Katie Byrne Noel: Christmas Eve, 1913
Breath of Heaven
CHRISTMAS—MASS DURING THE NIGHT
Reading I Isaiah 9:1-6 Reading II Titus 2:11-14 Gospel Luke 2:1-14 In those days a decree went out from Caesar Augustus that the whole world should be enrolled. This was the first enrollment, when Quirinius was governor of Syria. So all went to be enrolled, each to his own town. And Joseph too went up from Galilee from the town of Nazareth to Judea, to the city of David that is called Bethlehem, because he was of the house and family of David, to be enrolled with Mary, his betrothed, who was with child. While they were there, the time came for her to have her child, and she gave birth to her firstborn son. She wrapped him in swaddling clothes and laid him in a manger, because there was no room for them in the inn. Now there were shepherds in that region living in the fields and keeping the night watch over their flock. The angel of the Lord appeared to them and the glory of the Lord shone around them, and they were struck with great fear. The angel said to them, “Do not be afraid; for behold, I proclaim to you good news of great joy that will be for all the people. For today in the city of David a savior has been born for you who is Christ and Lord. And this will be a sign for you: you will find an infant wrapped in swaddling clothes and lying in a manger.” And suddenly there was a multitude of the heavenly host with the angel, praising God and saying: “Glory to God in the highest and on earth peace to those on whom his favor rests.”
HARK! THE HERALD
ANGELS SING
Hark! The herald angels sing, “Glory to the newborn King!
Peace on earth and mercy mild, God and sinners reconciled!” Joyful, all you nations, rise;
Join the triumph of the skies; With the angelic host proclaim, “Christ is born in Bethlehem!” Hark! The herald angels sing, “Glory to the newborn King!”
Christ, by highest heaven adored; Christ, the everlasting Lord! Late in time behold him come, Offspring of the Virgin’s womb.
Veiled in flesh the Godhead see; Hail the incarnate Deity, Pleased as man with us to dwell, Jesus, our Emmanuel.
Hark! The herald angels sing, “Glory to the newborn King!”
Hail the heaven-born Prince of Peace! Hail the Sun of Righteousness! Light and life to all he brings, Risen with healing in his wings.
Mild he lays his glory by, Born that we no more may die, Born to raise each child of earth, Born to give us second birth. Hark! The herald angels sing, “Glory to the newborn King!”
Gloria Mass of Joy and Peace Alonso
LITURGY OF THE WORD
Please be seated. Readings of the day are in the Gather hymnal.
Christmas—Mass during the Night ABC—Gather #1004 Psalm 96 Today is Born Our Savior Inwood
Gospel Acclamation Mass of Joy and Peace Alonso
Homily Profession of Faith See column on right Prayer of the Faithful People: Lord, hear our prayer.
LITURGY OF THE EUCHARIST
Presentation of the Gifts 4:00 pm and 10:00 am Masses
Hark! The Herald Angels Sing See column on left
6:30 pm Mass—Celebration Ringers
Christmas Suite arr. Sherman
10:00 pm Mass—Exultate Choir and Woodwind Quartet Lift up Your Voices by Handel
Priest: The Lord be with you.
People: And with your spirit.
Priest: A reading from the Holy Gospel according to Luke.
People: Glory to you, O Lord.
PROFESSION OF FAITH
Please stand I believe in one God, the Father almighty, maker of heaven and earth, of all things visible and invisible. I believe in one Lord, Jesus Christ, the Only Begotten Son of God, born of the Father before all ages. God from God, Light from Light, true God from true God, begotten, not made, consubstantial with the Father; through him all things were made. For us men and for our salvation he came down from heaven, (bow) and by the Holy Spirit was incarnate of the Virgin Mary, and became man. For our sake he was crucified under Pontius Pilate; he suffered death and was buried, and rose again on the third day in accordance with the Scriptures. He ascended into heaven and is seated at the right hand of the Father. He will come again in glory to judge the living and the dead and his kingdom will have no end. I believe in the Holy Spirit, the Lord, the giver of life, who proceeds from the Father and the Son, who with the Father and the Son is adored and glorified, who has spoken through the prophets. I believe in one, holy, catholic and apostolic Church. I confess one baptism for the forgiveness of sins and I look forward to the resurrection of the dead and the life of the world to come. Amen.
To acknowledge the action of God that takes place during the Eucharistic Prayer, we KNEEL after the Holy through the Great Amen.
Those who need to sit for health reasons should do so.
Invitation to Prayer
Priest: Pray, brothers and sisters, that my sacrifice and yours may be acceptable to God, the almighty Father.
Please stand People: May the Lord accept the sacrifice at your hands for the praise and glory of his name, for our good, and the good of all his holy Church. Preface Dialogue
Priest: The Lord be with you.
People: And with your spirit. Priest: Lift up your hearts. People: We lift them up to the Lord. Priest: Let us give thanks to the Lord our God.
People: It is right and just. Eucharistic Acclamations Mass of Joy and Peace Alonso
SAINT JOHN VIANNEY is blessed to have your
presence at our Christmas celebrations!
Please know that you are always welcome to join us for Eucharist. We are your
parish and your home.
Weekend Masses/Church
Saturday: 4:30pm Sunday: 7:30, 9:00, & 11:00am
Daily Masses/Mary Chapel*
Tuesday—Thursday: 7:45am
Mon—Wed; Friday: 9:00am
*Thurs @ The Fountains: 9:30am
*Friday evening Mass (Church), followed by Adoration: 5:30pm
Memorial Acclamation Doxology and Amen Priest: Through him and with him, and in him, O God, almighty Father, in the unity of the Holy Spirit, all glory and honor is yours, forever and ever.
Lord’s Prayer Please stand Sign of Peace
Priest: The peace of the Lord be with you always.
People: And with your spirit. Lamb of God
INVITATION TO COMMUNION
Priest: Behold the Lamb of God, behold him who takes away the sins of the world. Blessed are those called to the supper of the Lamb.
People: Lord, I am not worthy that you should enter under my roof, but only say the word and my soul shall be healed.
FIRST COMMUNION HYMN Angels We Have Heard on High
GLORIA
Angels we have heard on high Sweetly singing o’er the plains,
And the mountains in reply Echo back their joyous strains.
Refrain:
Gloria in excelsis Deo! Gloria in excelsis Deo!
Shepherds, why this jubilee?
Why your joyous strains prolong? Say what may the tidings be
Which inspire your heavenly song.
Refrain
Come to Bethlehem and see Him whose birth the angels sing;
Come, adore on bended knee Christ the Lord, the newborn King.
Refrain
See him in a manger laid Whom the choirs of angels praise;
Mary, Joseph, lend your aid, While our hearts in love we raise.
Refrain
COMMUNION PROCESSION As a sign of our unity as the
Body of Christ, please STAND for the communion procession.
When the last person has received, all KNEEL for private prayer.
Those who need to sit for health reasons should do so.
CONCLUDING RITE
Sending Forth Joy to the World Handel
SECOND COMMUNION HYMN Silent Night
Mohr
Silent night, holy night, All is calm, all is bright
Round yon Virgin Mother and Child, Holy Infant so tender and mild,
Sleep in heavenly peace, Sleep in heavenly peace.
Silent night, holy night,
Shepherds quake at the sight; Glories stream from heaven afar,
Heav'nly hosts sing alleluia; Christ, the Savior, is born! Christ, the Savior, is born!
Silent night, holy night,
Son of God, love's pure light Radiant beams from thy holy face, With the dawn of redeeming grace,
Jesus, Lord, at thy birth, Jesus, Lord, at thy birth.
Music is reprinted with permission under copyright license OneLicense.net #A-703462
Meditation Hymn Of the Father’s Love Begotten Proulx
1. Joy to the world! the Lord is come: Let earth receive her King; Let ev'ry heart prepare him room, And heav'n and nature sing, And heav'n and nature sing, And heav'n, and heav'n and nature sing.
2. Joy to the world! the Savior reigns: Let us, our songs employ; While fields and floods, rocks, hills, and plains Repeat the sounding joy, Repeat the sounding joy, Repeat, repeat the sounding joy.
4. He rules the world with truth and grace, And makes the nations prove The glories of his righteousness, And wonders of his love, And wonders of his love, And wonders, wonders of his love.
VICAR’S VIEW Christmas is the biggest feast! More than two billion people across 160+ countries celebrate Christmas. In America, nine in ten people celebrate it. It is so huge. In fact, many Americans travel an average of 275 miles to celebrate Christmas. This is even more astounding considering that some identify themselves as the “nones” or not religiously affiliated.
In the 1600s, Puritans made frantic efforts to ban the celebration of Christmas. Yet it continued to flourish. There has always been gift giving and family visits. There has always been eating and drinking and family traditions. Some visit their parents or grandparents, especially on Christmas Eve, as is done in Germany, Belgium, and other European countries. Even Thailand, where 90% of the people are Buddhist and Christmas is not a national holiday, there are still decorations and gifts exchanged. In Nigeria, (my country of birth), it is customary for families to exchange visits and gifts. People go to extra lengths to celebrate with their families.
I remember the fun and special meals served by my mother. I remember the new dresses made for us as kids. And our new shoes. I have fond memories of my last outfit—made for me 30-something years ago. At that time, clothes were not purchased but sewn. You were measured and had to wait to get them back. Disappointments were frequent because of tailors’ busy schedules. When kids were disappointed because their Christmas clothes were not ready, parents would be blamed. Some would threaten not to go to Church with their family members because of feeling odd or apart from the celebration. Can you imagine? Being at Christmas Mass is such an important aspect of Christmas … so parents had to make quick fixes. There is just something about Christmas that makes it so special—we all want to belong! We all want to have gifts, to be loved, to be cherished.
Family and friends also shower us with gifts on our birthdays. With Jesus, he desires to give us gifts on his own birthday ... a joy much greater than any other gift. It is the gift of his heart to us. He gives us himself. That is the very reason he was given to us by God the Father. “For God so loved the world that He gave his only begotten Son, that whosoever believes in him should not perish but have everlasting life.” (Jn. 3:16).
St. Paul spoke of this also when he said, “at the appointed time, God sent his Son, born of a woman, born under the law.” (Gal. 4:4). With this birth, JOY came into the world. We all have our favorite Christmas song … mine is Joy to the World!!! “The Lord is come. Let earth receive her King. Let every heart prepare him room. And heaven and nature sing.”
The gift is Jesus himself. He comes to us completely. He offers himself body, soul, spirit, and divinity as a special gift. He comes wrapped in swaddling clothes. Despite being a king, he comes in awesome simplicity, baffling the mind. Born in a manger. Received first by shepherds tending their sheep. Kingship and simplicity finds harmony in the Son of God. That is the beauty of the Nativity scene … a wonderful tradition begun by St. Francis of Assisi in 1223. He said, “I want to do something that will recall the memory of that Child who was born in Bethlehem, to see with bodily eyes the inconveniences of his infancy, how he lay in the manger, and how the ox and ass stood by.” (As narrated by St. Bonaventure.)
The birth of a child into a family heralds joy. The birth of Jesus Christ indeed brought joy to the holy family, but most of all, to the whole human race because his mission is for ALL. He has a mission to you and me. Though, like a gentleman, Jesus does not impose himself on us. He gently offers himself to be received. Let every heart prepare him room. The best place to keep friends is in our hearts. Jesus has you in his heart. Is he in yours? What an awesome Christmas it would be, an unforgettable experience. A lifetime of bliss to give him a place so he can dine with you. “Behold, I stand at the door and knock; if anyone hears my voice and opens the door, I will come in and eat with him, and he with me” (Rev. 3:20).
Is there a place for him in your heart? Or is it so filled with other things? Are you avoiding a relationship with the king of your heart? It is not enough for a gift to be offered, it must be accepted to become ours. A friend knows when they are being ignored and will feel this when the friendship is not pursued in regard to time together. A friendship may disintegrate when one is not appreciated. Jesus Christ, Emmanuel, (God with us) offers us his person, time, and entire life to be our friend. This give is TOTAL, COMPLETE, IRRECVOCABLE, and PERSONAL. It is ours to accept or reject whenever, and we have our whole lifetime to receive it. But, be sure of this, “to those who did accept him, who believed in his name, he gave them power to become children of God.” (Jn. 1:12)
Wishing you and your family a grace-filled Christmas!!! Fr. Nicholas
MITCH’S MESSAGE
I still remember when my daughter was two years old. We’d walk through our parish in California, where there were statues all around the walls. There was a replica of the Pieta, Mary holding the body of Jesus after he was crucified, and I explained to her what it was. She asked, “Can I kiss?” She went on to kiss every wound on Jesus’ body: hands, feet, head, and side. In awe of what I had just witnessed, I asked myself, “what would a good dad do in this moment?” I went to my wife, asked for her bottle of Purell, and I wiped my daughter’s lips and hands. Dad. Of. The. Year.
Thinking back, I realize how important it is for us to connect through touch. Studies show the incredible importance of parents having skin-to-skin contact with their newborn. During marriage vows, the soon-to-be newlyweds hold hands. If my wife and I are in an argument, putting my hand on her shoulder reminds me that she is a real person with thoughts and emotions that are equally or even more important than my own.
Christmas is more than a celebration of Jesus’ birth. It is the moment when the invisible God became visible. When the intangible became tangible. This moment is what the Church calls the Incarnation: God became flesh. He embraced flesh in order to embrace you. But, the incarnation is even more than a mere physical connection.
There’s a phrase: “God became man, so man might become God.” No, we don’t’ actually become God. God came down and entered our humanity in order to lift our humanity into his divine life. This is at the center of Christmas, of Christianity. C.S. Lewis says it well: “Jesus didn’t come to make bad people good. He came to make dead people alive.” Sin makes us dead, but Christ, through the power of his Cross and Resurrection, brings us to new life. Christianity is not a ethical system … it is the story of God’s reckless, relentless, unwavering love: for you.
We don’t have a God in the clouds watching us from afar, laughing every time I step on my kids’ Legos, (actually, I’m sure he does). What we do have is a personal God, loving us so intimately that he became one of us. And we have an opportunity to accept His love and embrace him back. This means turning away from our old self and putting on Christ. You know deep in your heart that this world’s offerings will never satisfy: fame, fortune, pleasure, power. Only Jesus satisfies. This is what we recognize during Christmas: that our humble Lord, in the form of a helpless baby, has come for you to live freely in his love. If we accept his invitation, we become his disciples.
This step of accepting Jesus and becoming his disciple is not meant to be taken alone. Once we accept Jesus’ invitation to live in his love, we need our brothers and sisters to help us continue walking the path of what we call discipleship in Christ. That is why, come February, we invite you to a 40-day Lenten challenge to learn more about Jesus, how to accept his invitation. For 40 minutes following 4:30pm Mass on Feb. 15 OR between 9:00am and 11:00am Masses on Feb. 16, we will have a preview of this challenge for those who want to learn more before committing. Invite a friend or family member to come with you. We begin March 1 and end April 18.
God is tugging at your heart right now. He’s been patiently waiting for you. If you’re unsure if this is for you, the February preview will provide answers. For now, I invite you to pray: “You have made us for yourself, O Lord, and my heart is restless until it rests in you.” Fr. Jim, Fr. Nicholas, and I are praying for you. May you encounter his mercy and love.
As you leave Mass today, you will receive the book Rediscover the Saints, by Matthew Kelly. This is a Christmas gift from our parish to you!
We hope it empowers you to live life to the fullest.
We are capable of so much more than we think. God is constantly trying to open our eyes to the amazing possibilities that he has enfolded in our being. The saints continue this work, encouraging us to explore our God-given potential. The saints are great teachers because they teach with their words and actions. Their lives raise questions about our lives, and when we ponder these questions, amazing possibilities begin to unfold. The saints encourage, challenge, and inspire us to collaborate with God and pursue our truest self. The saints inspire us to bold action and remind us over and over again: We can change the world.
We encourage you to read about a saint each day, and ponder or pray about the question that beings each chapter.
In January, we will have an opportunity to gather for discussion and fellowship as we deepen our faith as a parish community.
Mondays, Jan. 20 & 27 9:30-11:00am
Mondays, Jan. 20 & 27 6:30-8:00pm
Thursdays, Jan. 23 & 30 6:30-8:00pm
Fridays, Jan. 24 & 31 9:30-11:-00am
Sundays, Jan. 26 & Feb. 2 12:15-1:45pm
(Registration begins in January.)
Session 1: Chapter 1-12
Session 2: Chapters 13-25
Davenport, Bettendorf & Eldridge, IA
For ad info. call 1-800-950-9952 • www.4lpi.com St. John Vianney, Bettendorf, IA. B 4C 01-0380
2312 Spruce Hills Dr. • 563-424-1212
BOARD CERTIFIED PLASTIC SURGEON
REFLECTIONS MEDICAL SPA3900 28th Ave Dr Suite 105 Moline, IL 61265
Phone: 309.764.4650 Fax: 309.764.4655
ASSUMPTION HIGH SCHOOL
Outstanding Academics Faith Centered • Student Focused
(563) 326-5313ONE IN THE SPIRIT
4775 Elmore Ave. 563-355-7801Next to Best Buy
Art Monuments in Stone
1406 W. Locust St. Davenport, IA
(563) 323-8807
Bettendorf Eyecare Center Dr. Ammie Chizek Dr. Aaron Chizek
Dr. Connor Peters (563) 359-4446
1875 Middle Road • Bettendorf
Tracy Wachal Naab, Agent
1904 Middle Rd. • Bettendorf, IA 52722Bus 563-355-4500 • Fax [email protected] www.tracynaab.com
Expert Installation Or Do It Yourself
LINOLEUM SHOP
Carpet - Vinyl - Ceramic - Hardwoods 1353 W. 3rd 323-3301
MESICK FAMILY CHIROPRACTIC CLINIC
2303 E. 53rd St., Suite 3, Davenport, IA
Sarah Mesick, D.C. • Timothy Mesick, D.C.
Parish Members 344-0707
C. Ewert Plumbing & Heating, Inc.Residential - Commercial - Industrial
Repairs - Remodeling - New Construction
Water Heaters - Sales & Service
1316 W. 4th 322-3222
2239 Kimberly Rd. • Bettendorf 563.355.1255 • www.treehouseqc.com
Parishioner Owned
Family DentistryTHOMAS W. OLSON D.D.S.
Spruce Center355-5513
1912 Middle Rd., Bettendorf, Iowa 52722
Your Best Vision For LifeWilliam Benevento, M.D.
563-323-2020 • www.esaeyecare.com 777 Tanglefoot Lane, Bettendorf
6600 Elmore Ave, Davenport, IA • 563-345-5000www.millschevy.com
Parishioners
563-355-4433Supporting St. John Vianney
Contact Dan Stone to place an ad today! [email protected] or (800) 950-9952 x2607
T-shirts , Embroidery & Promotional Products
KEVIN KWAKAccount Executive
563-508-9947
www.advantageadvertising.us
Specializing in Women’s Clothing
Accessories and GiftsMary B. Hotard, Parishioner
217 North Cody Rd LeClaire, IA ❖ 563.508.5606
All Inclusive Maintenance Free
Lifestyle
Call Leah Luna 563.332.5775parish member fountainsseniorliving.com
3726 Thunder Ridge Road, Bettendorf, IA
LOVE THE WAY YOU LIVE AT THE FOUNTAINS!
Matt SturdevantParishioner
4425 Welcome Way
Davenport, IA 52806www.gosturdy.com
563-322-7143
“A Refreshing Change”
(309) 797-9900 | www.heritagelandscapedesign.com
Buy • Selling • Build Tim Martin cell: 309.738.2222
office: 563.332.6464www.TimMartin.Ruhlhomes.com • [email protected]
Licensed in Iowa & Illinois
Thank you to all clients and friends
for your past, present and
future business and trust.
Office Manager Julie Mishler ...........................332-7910
Religious Education (Grades P-6) Jeannie Moran & Nicky Stevenson ...................................... 332-7910 x113
Youth Ministry (Grades 7-12) Jan Stevenson ............. 332-7910 x111
Health Ministry ........... 332-7910 x122 [email protected]
Liturgy and Music Eleanor Kiel ................. 332-7910 x112
Pastoral Associate Mitch Narvasa ............. 332-7910 x114
Finance/Contributions Colleen Evans .............. 332-7910 x117
Virtus Coordinator Tammy Guest .............. 332-7910 x116
Vianney Vine Newsletter Jan Touney ................. [email protected]
Prayer Chain .. [email protected]
Counseling Sister Rae Elwood ................. 359-7346
Diocesan Victim Assistance Coordinator 349-5002 ..................... [email protected]
Parish Council Steve Cox ....................... 309-314-1706
Finance Council Mark McCluskey .................... 332-0300
Parish Directors Kathy Langley ........................ 343-4780 Les Lipinski ............................ 235-3723
CATHOLIC EDUCATION
SJV Preschool Christy Barnum ...................... 332-5308
Lourdes Catholic School (Grades K-8) .......................... 359-3466
www.lourdescatholic.org
Assumption High School (Grades 9-12) ........................ 326-5313
www.assumptionhigh.org
SACRAMENTS
Baptisms Please contact Julie Mishler in the parish office. First time parents are requested to attend a baptismal prep class prior to scheduling baptism.
Next class: Saturday, January 11, 2020 9:00-11:00am, Office conference room
Use NW Entrance Please call/email by noon on Jan. 10 to
register, if you plan to attend.
Eucharist for Sick and Confined Please contact the parish office by 4:00pm on Thursday, if you wish to receive Eucharist on Sunday following 9:00am Mass.
Reconciliation is offered on Saturdays, 3:30-4:15pm, in the Reconciliation Chapel, (located in main church, behind choir loft).
Marriage Congratulations as you prepare to celebrate the sacrament of marriage. Please contact the parish office at least nine months prior to your wedding date to participate in the preparation process.
RCIA—Rite of Christian Initiation of Adults Adults interested in learning more about the Catholic faith are encouraged and invited to contact the parish office.
For ad info. call 1-800-950-9952 • www.4lpi.com St. John Vianney, Bettendorf, IA. A 4C 01-0380
A Clear Path to Security
Insurance • Risk Solutions 324-1011 Davenport, IA
• INTERIOR & EXTERIOR • SENSIBLE PRICES, SUPERIOR WORK & SUPREME PAINTBOB & JAN EGGER Parish Member 600 Sycamore Dr., Le Claire, IA [email protected]
332-7415 340-6590
3-S Paint & Repair
Painting Contractors
Since 1973Come Visit Our Showroom
www.lovewellfence.com 563-391-7025
MICHAEL J. DOYLE, D.D.S.Family Dentistry
KERI C. DOYLE, D.D.S., M.S.Pediatric Dentistry
3205 Ridge Pointe 355-7884
Tree & Lawn Care Experts Since 1880133 2250 E Leclaire Rd., Eldridge | (563) 355-0701
W W W. D AV E Y. C O M
Timothy J. Smith, DDS Benjamin R. Selden, DDS
Rob H. KeechAAA Court Family Dental
2820 AAA Court, Suite 2 Bettendorf, IA 52722
(563) 449-1070 [email protected]
THOMAS E. SHIEAttorney at Law
Wills, Trusts, Real Estate601 Brady St., Ste. 220 Davenport, IA 52803
[email protected] 324-8244
www.jmcremodelingqc.com [email protected]
Jim Wadle, Funeral AssistantParishioner
644 River Dr. • Bettendorf 355-1751
www.mcginnis-chambers.com
Tim Lane Financial Advisor
1805 State Street, Suite 102 Bettendorf, IA 52722 563-359-9660
Kulig Accounting, Inc. Income Taxes • Accounting
Payroll Service
(309) 764-45523760 41st St Suite 12, Moline, IL 61265
www.kuligacct.com
Pat Angerer
Perfect Loan.Perfect Home.
309-762-8701 Subje
ct to
cred
it app
rova
l | Eq
ual H
ousin
g Opp
ortun
ity |
NMLS
#463
074
New Construction • Residential • Commercial Repairs & Remodels Free Estimates on Remodels
24 Hour Service | Family Owned Since 1973Bob Tappendorf, Owner
(563) 324-2236 6605 W. River Dr. • Davenport, IA
(563) 386-8686 Tony Bradley - Owner
Excellence Rooted in Faith.1453 Mississippi Blvd.
Bettendorf, IA
563.359.3466www.lourdescatholic.org
Contact Dan Stone to place an ad today! [email protected] or (800) 950-9952 x2607
HALLIGAN-McCABE-DeVRIES FUNERAL HOME“Every Life Tells a Story. Let Us Help Share Yours.”
Mike Chupka, Parish Member
322-4438 • 614 MAIN STREET, DAVENPORT, IOWA
ESTABLISHED 1889 www.hmdfuneralhome.com