JOURNAL OF BACrERIOLOGY, Mar. 1994, p. 1364-13730021-9193/94/$04.00+0Copyright © 1994, American Society for Microbiology

Vol. 176, No. 5

Determinants of Affinity and Mode of DNA Binding at the CarboxyTerminus of the Bacteriophage SPOl-Encoded

Type II DNA-Binding Protein, TF1LADISLAV ANDERA* AND E. PETER GEIDUSCHEK

Department of Biology and Center for Molecular Genetics, University of California,San Diego, La Jolla, California 92093-0634

Received 20 October 1993/Accepted 18 December 1993

The role of the carboxy-terninal amino acids of the bacteriophage SPOl-encoded type Il DNA-bindingprotein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine,arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. Thebinding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to bindingsites in larger SPOl [5-(hydroxymethyl)uracil-containingI DNA fragments, and to thymine-containinghomologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. Weconclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding andthat the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1dimers bound to DNA.

Bacteria contain a variety of small, basic, and abundantnucleic acid-associated proteins (10, 29). Prominent in thisgroup of proteins are the type II DNA-binding proteins(DBPII), which include the general Escherichia coli DNA-binding protein HU and the E. coli integration host factor(IHF). Although HU is not absolutely required for the viabilityof E. coli, cells that contain no HU grow poorly, exhibitalterations of gene expression, and are defective in the main-tenance of plasmids (2, 13, 16, 17, 20, 21). Homologs of HUexist in every species of eubacteria that has been examined andalso in archaebacteria. A protein with a related sequence iseven thought to be encoded by African swine fever virus, acytoplasmically replicating animal virus (20a).

IHF, which is almost as abundant in E. coli as HU (29), isalso nonessential. Nevertheless, bacteria lacking IHF are de-fective in site-specific recombination and are aberrant indiverse aspects of gene regulation (reviewed in references 5, 6,and 12).The experiments reported in this work were done with TF1,

the only virus-encoded member of the DBPII family. TF1 issynthesized during the middle and late phases of infection ofBacillus subtilis by its lytic bacteriophage, SPOl. In the approx-imately 140-kbp genome of SPOl, 5-(hydroxymethyl)uracil(hmUra) entirely replaces thymine. TF1 has a correspondinglystrong preference for hmUra-containing DNA over thymine-containing DNA, as well as a strong preference for certain sitesin SPO1 DNA (9, 15, 31, 35).The structures of the dimeric DBPII probably represent

variations on a common plan (34), but these variations gener-ate a diversity of properties, particularly with regard to DNAbinding. The HU proteins, which bind nonspecifically to DNA,are 90- to 92-amino-acid homodimers, with the exception ofthe Salmonella typhimurium and E. coli proteins, which areheterodimers. TF1 and IHF both exhibit considerable site

* Corresponding author. Present address: CNRS-LGME/INSERM-U.184, Institut de Chimie Biologique, Faculte de Medecine, 11, rueHumann, 67085 Strasbourg Cedex, France. Phone: (33) 88 37 1255,ext. 332. Fax: (33) 88 37 0148.

selectivity of binding and differ from the HU proteins in havinga carboxy-terminal extension (Fig. 1): TF1 is a homodimer of99-amino acid subunits, and IHF is a heterodimer of 98- and94-amino-acid subunits (designated ot and ,B, respectively). Thenine C-terminal amino acids of TF1 are known to be requiredfor DNA binding (26), and recent work points to the C terminiof the IHF at and i subunits as likewise being involved in DNAbinding (8, 19). IHF and TF1 strongly bend DNA as they bindto it, and the extent of bending probably is similar (25, 30, 31,34, 36). However, TF1 and IHF also differ from each other inthat single IHF dimers bind noncooperatively to single DNAsites (4, 7, 36), while TF1 assembles nested DNA complexesaround preferred central DNA-binding sites, presumablythrough auxiliary interactions between neighboring proteindimers (9, 30). It is plausible to anticipate that a connectionwill be found to exist between the different DNA-bindingmodes of TF1 and IHF and the facts that the IHF heterodimereffectively has one C-terminal extension while the TF1 ho-modimer has two.The close relationship between the general stability of the

three-dimensional structure of TF1 and DNA binding wasexplored recently (1). In those experiments, changes in affinityfor DNA were generated by amino acid substitutions at sitesfar removed from the putative regions of direct interactionbetween the small TF1 dimer (99-amino-acid subunits) and itslarge DNA-binding site. Two interesting results of thoseexperiments concerned the generation of a doubly mutatedTF1 protein (at amino acids 15 and 32 in putative oa-helices 1and 2) with more stable secondary structure and an approxi-mately 40-fold-higher affinity for DNA and the generation of amutant TlF1 with a secondary structure stabilized by binding toDNA or by higher concentrations of electrolyte.

In this work, we further explore the involvement of theC-terminal segment of TF1 in DNA binding. We show thatamino acid 97, Phe in the wild-type protein, is essential forDNA binding and that substitutions at amino acid 97 stronglyaffect affinity. We also show that other truncations and substi-tution at amino acids 98 and 99 generate a broad range of

1364

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE SPOI-ENCODED TYPE II DNA-BINDING PROTEIN

a-helix

E S L K K AIAIE G LK Y E D F AK

K A L K D A VI K

K A L K D A V' A G K

K A L K D A V; K

K A L K D A VI N

Q K L K S R V! E N A S P K D E

K E L R D A R. N I Y G

FIG. 1. C-proximal amino acid sequences of TF1 and of some otherDBPII. The arrows mark amino acids chosen for site-directed mu-

tagenesis of TF1.

alterations in DNA binding and protein-protein interactionson DNA.

MATERIALS AND METHODS

E. coli strains, media, reagents, site-directed mutagenesis,and protein purification. E. coli strains, media, chemicals,site-directed mutagenesis of the TF1 gene, and protein over-

expression are described elsewhere (1). E. coli BL21 cells forTF1 overexpression were cultivated in 2 x YT medium contain-ing 0.5 M NaCl.TF1-0p98, TF1-0p99, and TF1-W99 (see Table 1) were

purified as described for wild-type TF1 (28), but with modifi-cations specified elsewhere (1). The other variant proteins (seeTable 1) did not bind to heparin-Sepharose (TF1-C97 onlybound poorly) and were purified by hydrophobic chromatog-raphy on phenyl-Sepharose; flowthrough fractions from hepa-rin-Sepharose were brought to 1.8 M (NH4)2SO4, loaded ontophenyl-Sepharose, washed with 5 volumes of HA buffer (20mM Tris-HCl [pH 7.6], 50 mM KCl, 5% [vol/vol] glycerol, 1

mM Na2EDTA, 5 mM 2-mercaptoethanol, 0.1 mM phenyl-methylsulfonyl fluoride) containing 1.8 M (NH4)2SO4, andeluted with a gradient of 1.8 to 0 M (NH4)2SO4 in HA buffer.Fractions were analyzed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) (18), and the mostpure fractions (-90 to 95% pure, as judged by Coomassie bluestaining of SDS-polyacrylamide gels) were collected, concen-

trated, dialyzed into TF1 storage buffer (20 mM Tris-HCl [pH7.6], 25 mM NaCl, 0.1 mM EDTA, 5 mM 2-mercaptoethanol),and stored at - 70°C.The concentrations of all variant proteins were determined

from their A280 values with extinction coefficients of 6,760 M(monomer)- 1 cm-' for TF1-W99 and 1,200 M (monomer)-cm- 1 for all other proteins.

Isolation and labeling of DNA, gel electrophoresis of TF1-DNA complexes, quantification of TF1-DNA interactions, andfootprinting analysis. SPOl DNA restriction fragments usedfor gel retardation and footprinting experiments were derivedfrom the region of the SPOI genome containing early promot-ers PE5 and PE6 and were purified as described previously (9,28). The thymine-containing version of SPOl DNA fragmentRK130 with its TF1-binding site and SPOI PE6 promoter was

PCR amplified from the corresponding region of SPOI DNA.Purified DNA fragments were 32p labeled at their 5' ends withT4 polynucleotide kinase.Complementary hmUra-containing oligonucleotides (40-

mers) with 5'-overhanging ends were synthesized as describedpreviously (3) and were generously provided for these experi-ments by L. Mayol and A. Galeone. The oligonucleotides were

annealed, and the recessed 3' ends were 32P labeled with theKlenow fragment of DNA polymerase I. The resulting double-stranded 44-mer with an SPOI PE6 promoter-like sequenceand a preferred TF1-binding site

5' AAUUCCUAGGCUACACCUACUCUUUGUAAGAAUUAAGCUUCUAGA 3'3' UUAAGGAUCCGAUGUGGAUGAGAAACAUUGUUAAUUCGAAGAUCA 5'

(U stands for hmUra) was used for quantitative analysis of TFIbinding. The conditions of gel electrophoresis of TF1-DNAcomplexes and the method of analyzing the results are de-scribed elsewhere (1, 28). For proteins whose complexespresented smeared bands on gel retardation, equilibrium dis-sociation constants were estimated from the concentration ofthe protein that retarded the electrophoretic migration ofone-half of the total 44-mer DNA. All experiments wererepeated at least twice. DNase I and hydroxy radical footprint-ing of TF1-DNA complexes was done as described previously(31).

Modification of TF1-C97 with the photo-cross-linking re-agent pAPB. Modification of the single cysteine in TF1-C97with p-azidophenacylbromide (pAPB) was done as describedpreviously (22). Reaction mixtures contained, in 500 [LI, 20 mMTris-HCl (pH 8.0), 100 mM KCl, 0.1 mM Na2EDTA, 5%glycerol, 1.5 mM 2-mercaptoethanol, 10 pM TFI, 5% dimeth-ylformamide, and 800 pM pAPB (unlabeled reagent was fromSigma; 3H-labeled pAPB [32] was kindly provided by T.Nakanishi). Reaction mixtures were incubated at 23°C for 10 hand then at 4°C for 12 h and were concentrated 10-fold inCentricon-10 microconcentrators (Amicon). TFI was sepa-rated from unreacted pAPB by gel exclusion chromatographyon 1-ml Bio-Gel P-6 columns (Bio-Rad).

Reaction mixtures for photo-cross-linking contained, in 10[Id, 20 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM KCl, 10mM MgCl2, 0.5% (vol/vol) glycerol, 0.1 mM dithiothreitol,0.05% Brij 58, 100 pg of bovine serum albumin per ml, 46 nMTF1, and 3 nM 3'-end-labeled 44-mer DNA. Reaction mix-tures for analyzing protein-protein photo-cross-linking con-tained all of the above-listed ingredients but with 140 nMrather than 46 nM TF1; SPO1 DNA was added to somereactions instead of 44-mer DNA. Reaction mixtures in micro-titer plates were irradiated on a transilluminator (Fotodyne3-3000) at 310 nm for 3 min. Reaction products were separatedin 8% (wt/vol) polyacrylamide gels, which were subsequentlydried and analyzed by autoradiography. Reaction productswere also analyzed for protein-protein cross-linking in SDS-17% (wt/vol) polyacrylamide gels.

RESULTS

Purification of C-terminus variant proteins and their bind-ing to hmUra-containing DNA. The C-terminal extension ofTF1, which has been shown to be essential for its DNA-bindingactivity (26), is unique among DBPII (Fig. 1). It is known fromprevious work that binding to SPOI DNA brings Tyr-94 of TF1into the proximity of this DNA (11). A recent nuclear magneticresonance (NMR) analysis has also revealed that, in the freeTF1 dimer, Phe-97 in the tail is positioned close to Phe-61 inthe putative DNA-binding arm (24). For these reasons, Phe-97, Ala-98, and Lys-99 were chosen as targets for site-directedmutagenesis. The C-terminus variant proteins that were pre-pared are listed in Table 1.The first indications of significant changes in protein struc-

ture or interaction were that TF1-Am97 did not bind toheparin-Sepharose during protein purification and that theamino acid 97 substitution mutants bound very poorly. These

TF1

B. stearothermophilus

B. subtilis

E. coil HU-a

E. coli HU-p

E. coil IHF-a

E. coli IHF-f

1365VOL. 176, 1994

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1366 ANDERA AND GEIDUSCHEK

TABLE 1. Equilibrium dissociation constants (Kd) of theC-terminus variant proteins

TF1 Mutationa Kd (nM)

Wild type 2.5 ± 0.3Am97 Phe-97--)Am >3,000bOp98 Ala-98-*Op -35CdOp99 Lys-99-->Op 3.1 ± 0.2C97 Phe-97-*C -30cR97 Phe-97->R -30S97 Phe-97--+S -60cW99 Lys-99--*W -25C

a Am, amber; Op, opal.b No DNA binding was detected at or below this protein concentration.c Determined from the protein concentration retarding one-half of the total

hmUra-containing 44-mer DNA (smeared DNA-protein complexes).d Aggregation of 44-mer DNA occurred at a higher protein concentration.

variant proteins were instead purified by hydrophobic chroma-tography (see Materials and Methods).The DNA-binding properties of these proteins were exam-

ined by native gel retardation electrophoresis and by footprint-ing. Gel retardation confirmed that the variant proteins andwild-type TF1 formed complexes with RH600 DNA in asignificantly different manner (Fig. 2); RH600 is an -600-bp-long DNA fragment containing the SPOl PES early promoterand high-affinity TF1-binding sites. Each of the three chaintruncation mutants exhibited characteristic and individualproperties in binding to this DNA (Fig. 2A). TF1-Am97 (Fig.2A, lanes 6 to 9) resembled previously described TF1-Am91 inits extremely weak binding to SPOl DNA (26). The affinity forRH600 DNA was at least 100-fold lower than that of thewild-type protein (Fig. 2A, lanes 2 to 9), and binding wasnonspecific (see below). The affinity of TF1-Am97 for a shorthmUra-containing 44-mer synthetic DNA fragment (3) (con-taining a preferred TFm-binding site similar to a site overlap-ping the PE6 early promoter) was even lower, with no bindingdetectable at a 3 p,M protein concentration (Table 1). ThatTF1-Op98 did bind to DNA proves that Phe-97 plays animportant role in TF1 binding to DNA. However, TF1-Op98was itself anomalous. (i) It had an approximately 10-fold-loweraffinity for hmUra-containing 44-mer DNA than did wild-typeTF1 (Table 1). (ii) When it bound to RH600 DNA, itgenerated a ladder of only slightly retarded bands (Fig. 2A,lanes 10 to 12), resembling the pattern of bands generated bythe nonspecifically binding E. coli HU protein (28). At higherconcentrations, TF1-Op98 caused the aggregation of RH600DNA (leading to the retention of labeled DNA in the loadingwells of the gel shown in Fig. 2A, lanes 12 and 13) and also ofhmUra-containing 44-mer DNA (data not shown). The thirdchain termination mutant, TF1-Op99, bound to hmUra-con-taining 44-mer DNA with an affinity similar to that of wild-typeTF1 (Table 1) but formed complexes with RH600 DNA thatwere not clearly resolved by gel retardation (Fig. 2A, lanes 14to 17), and only its first complex with the -130-bp-long SPO1DNA fragment, RK130, was sharply separated (see below).

Mutants with substitutions at amino acids 97 and 99 (Fig.2B) also formed complexes with RH600 DNA that yieldedsmeared bands on gel retardation and bound to hmUra-containing 44-mer DNA with a 10- to 20-fold-lower affinitythan did wild-type TF1 (Table 1). Substitution of hydrophobicPhe-97 with hydrophobic Cys or positively charged Arg dimin-ished DNA-binding affinity less than did hydrophilic Ser in thesame position. Substitution of Lys-99 with hydrophobic Trpseverely diminished DNA-binding affinity (Table 1) and, at

higher protein concentrations, promoted the aggregation ofRH600 DNA (Fig. 2B, lane 17). Thus, the aggregation of DNAmediated by TF1-Op98 and TF1-W99 correlated with thepresence of a hydrophobic amino acid at the C terminus.

Footprinting of complexes of variant proteins with hmUra-containing DNA. DNase I footprinting analysis of complexes ofTF1-C97, TF1-R97, and TF1-S97 variant proteins with RK130DNA revealed no major differences from wild-type TF1 withregard to protection and enhancement sites but served to pointout the importance of the hydrophobic amino acid, andespecially of Phe, at position 97 (Fig. 3A and data not shown).The concentration of TF1-C97 that retarded RH600 DNA(Fig. 2B, lanes 4 and 5) correlated well with the concentrationof TF1-C97 needed for the protection of TFm-binding sites inthis fragment of SPOl DNA from DNase I (Fig. 3A, lane 8).On the other hand, 450 nM TF1-S97 caused 100% retardationof RH600 DNA (Fig. 2B, lane 13), but even a fourfold-higherconcentration afforded less than 50% protection of eitherTFm-binding site in RK130 DNA (Fig. 3A, lane 11).

Despite its low binding affinity (Fig. 2A, lanes 6 to 9),TF1-Am97 showed substantial protection of the A site, en-hanced bands, and partial protection of the B site at anextremely high protein concentration (Fig. 3B, lane 7). TFm-Op98, however, was exceptional; consistent with its propertiesin gel retardation, it did not bind to any specific site butindiscriminately covered and/or aggregated the RK130 DNAprobe so as to make it inaccessible to DNase I (Fig. 3B, lane10). TF1-Op99 and wild-type TF1 displayed a similar affinityfor and protection of RK130 DNA, but TF1-Op99, togetherwith other variant proteins lacking C-terminal Lys-99, prefer-entially protected site A of the footprint, site B being protectedonly at higher concentrations (compare lanes 3 and 12 of Fig.3B). We further examined this relationship by hydroxy radicalfootprinting of the TFl-Am97 and TF1-W99 complexes withRK130 DNA (Fig. 4). When wild-type TmF occupied sites Aand B in RK130 DNA (Fig. 4, lane 3), the hydroxy radicalfootprint extended in a regular pattern over seven turns of theDNA helix, with a very strong protection of 4- to 5-bpsegments, regularly spaced at 10- to 11-bp intervals, the centersof six protected patches extending over 64 bp. For TF1-W99,three of these segments in site A were protected from hydroxyradical cleavage, as for wild-type TF1, but the footprint wasvery weak at the site A end of site B and inapparent at thedistal end of site B (Fig. 4, lane 13), despite enhancedsusceptibility to cleavage by DNase I at each end of site B (Fig.4, lane 7). Apparently, TF1-W99 and wild-type TF1 differ intheir ability to form higher-order structures that depend onprotein-protein interactions on DNA.

Binding to thymine-containing DNA. The unusual proper-ties of the C-terminus variant proteins prompted us to directlycompare their binding to hmUra- and thymine-containingRK130 DNAs (Fig. 5). As shown previously (28), wild-typeTF1 bound to T-containing RK130 DNA with a lower affinitythan to hmUra-containing RK130 DNA and formed nonspe-cific complexes with the T-containing DNA that were poorlyresolved or not resolved as discrete bands on gel retardation(Fig. 5, lanes 2 to 5). TF1-Am97 bound with the sameextremely low affinity to both DNA fragments (Fig. 5, lanes 6to 9), but it did not provide any trace of a DNase I footprintwith RK130 (T), even at the highest concentration of proteinexamined (data not shown). TF1-Op98 caused the aggregationof both hmUra-containing and T-containing DNAs at compa-rable protein concentrations (Fig. 5, lanes 10 to 13) and failedto show a footprint on T-containing DNA (data not shown).Wild-type TF1 and TFI-Op99 bound to hmUra-containingDNA with a similar affinity (Fig. SA, lanes 2 to 5), but the level

J. BAcrERIOL.

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE SPOI-ENCODED TYPE II DNA-BINDING PROTEIN 1367

AProtein TF1 TF1-Am97 TF1-Op98 TF1-Op99nM dimer 0 0.46 1.8 7.4 30 46 180 740 30001.8 4.6 7.4 317 : :W.0 000t-';-0 08t40 t04000- 3>'3}s t 00 X 0 '; X X X 0 k i X

::0;:;; :4,. 4'di;'St;00 000000 ;; ;ff

::f: ::: f:it :004:; i:00000:00:: f:d ::::::000: ::00 ff: :0: C; 00: ;;;

idS;f .f 70 fff ;0t, 0'Sff '; jff'tf:07: ;0 f; ffad.'-4''00- d':t';i'SS'Sl-S'_

f: fff: ;X0000 'S; ?; ff000 ,000000000S,0f,'tV,,,;^,,,'St.S'L D00 ;'S 0;000000XiS00S'D:00t'SCt,'S0000000 000§'=^q\ $-

e_;;0X S00k '0000S' "Si;S,0 fff' S,0Xs,'v'V;'.0'0f';t'SSt'''',='>',''f

fF'l3 -,s ts_ :.: z v.r5<

,'; 00 0V'00 ff ;; '0t 't:0' X' -'i'-0'¢v o-LW__+''Dlit_ _! tit t00 0i00000 4t- 0ti35 2-w 40j-F X ::; t;at0Xt;000-S S10t07.i X..gw*w tdS w t*ff tD C X,; fEV;f;Xt :, 'C s?'s'^= w X 1.8 7.4 31 124

".di__r_"

1 2 3 4 5 6 7 8 9 10 11121314 1516 17

BProteinnM dimer

TF1-C97 TF1 -R97 TF1-S97 TF1-W990 1.8 7.4 31 124 1.8 7.4 31 124 7 28 112 450 7 28 112 450

1 2 3 4 5 6 7 8 9 101112 131415 1617FIG. 2. Binding of wild-type TF1 and C-terminus variant proteins to SPOI DNA. Complexes of RH600 DNA with wild-type TFI or variant

proteins at the concentrations shown above each lane were formed at 23°C for 10 min, resolved in 4% (wt/vol) polyacrylamide gels, and visualizedby autoradiography. The arrow at the side indicates trace contamination with single-stranded DNA. (A) Wild-type TF1 and chain terminationvariant proteins. (B) Variant proteins with substitutions at amino acids 97 and 99.

VOL. 176, 1994

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TF1 TFl-C97 TFl-S97AIG

0 1.2 4.7 1t6 11.7 47 186 117 470 1860

- 0

&4fl flowm.9 ft _I; ,.e )tioa

1 2 3 4 5 6 7 8 9 10 11

TFl TFl-Am97 TFl-Op98 TFl-Op990 2.3 7 21 460 18607440 4.6 14 42 4.6 14 42 0

B

A

AMG

1 2 3 4 5 6 7 8 9 10 11 12 13 1415

1368

APro,hmM d

BProteinnM dimer

B

A

.44

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE SPOI-ENCODED TYPE II DNA-BINDING PROTEIN 1369

FIG. 3. DNase I footprinting of SPOI DNA complexes with wild-type TF1 and variant proteins. Complexes of wild-type TFl, TF1-C97, andTF1-S97 (A) and of wild-type TF1, TF1-Am97, TF1-Op98, and TF1-Op99 (B) with RK130 DNA were formed at 23°C for 10 min, treated with0.2 ng of DNase I for 30 s, denatured, separated in 8% (wt/vol) denaturing polyacrylamide gels, and visualized by autoradiography. The hatchedrectangles at the side mark major sites protected by wild-type TF1; the arrows show sites of enhanced cleavage by DNase I. A+G sequencingladders are shown at the left side of panel A (lane 1) and at the right side of panel B (lane 15). Solid circles mark bands due to trace nucleasecontamination of TF1-C97 and TF1-S97.

of binding of TF1-Op99 to T-containing DNA was significantlylower than that of wild-type TF1 (Fig. 5B, lanes 14 to 17).Other variant proteins bound to both hmUra- and T-contain-ing RK130 DNA fragments with a similar affinity (data notshown). A DNase I footprint of TF1-Op99 on RK130 DNArevealed that it did not discriminate between sites A and B inT-containing DNA as it did in hmUra-containirig DNA (datanot shown).

Modification of TFI-C97 and photocross-linking. Theunique cysteine in TF1-C97 offered the possibility of chemicalmodification with the photoreactive reagent pAPB. That thiscysteine is solvent accessible was confirmed by demonstratingits ability to react with 3H-labeled pAPB (Fig. 6A). Modifica-

tion did not grossly change the affinity of TFl-C97 for hmUra-containing 44-mer DNA (data not shown). Upon irradiation,pAPB-modified TFl-C97 was internally photo-cross-linked toa second monomer (M), forming a dimer (D) that was notdissociated by boiling in the SDS-containing sample buffer (18)used for gel electrophoresis (Fig. 6B, lane 7). The ability toform intermonomer cross-links is of interest because theongoing NMR analysis of the structure of TFl in solutionprovides evidence that the carboxy-terminal tail of TF1 islocated in proximity to the f-loop arm; specifically, there are2D nuclear Overhauser effect spectroscopy (NOESY) cross-peaks between Phe-97 and Phe-61 of the wild-type protein (14,24). While the NMR analysis does not discriminate between

TFl-Am97 TF1-Am97Protein TF1 _ TF1-W99 TF1 _ TF1-W99

Ai/G -

240nM dimer 0 21 1860 7440 93 460 0 21 1860 7440 93 460

eI

A

1 2 3 4 5 6 7 8 9 1011 1213FIG. 4. High-resolution DNase I and hydroxy radical footprinting of wild-type TF1, TF1-Am97, and TFl-W99 complexes with RK130 DNA.

Complexes were formed, treated, and separated as described in the legend to Fig. 3 and in Materials and Methods. The rectangles mark protectedsites A and B of the DNase I footprint. Sites protected against cleavage by hydroxy radical attack are marked by heavy hatching. The arrowsindicate sites of enhanced cleavage in the DNase I footprint.

VOL. 176, 1994

1--

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

TF1 TF1-Am97 TF1-Op98 TF1-Op990 0.46 1.8 7.4 30 46 180 740 3000 1.8 4.6 7.4 31 0.46 1.8 7.4 31;0 ~~~~~~~. : <';i. +v >J.i# _a..: 27

1 2 3 4 5 6 7 8 9 101112 1314 151617

TF10 0.46 1.8 7.4 30

TF1-Am97 TF1-Op98 TFI-Op9946 180 740 3000 1.8 4.6 7.4 31 0.46 1.8 7.4 31

-_ _S:g,7

1 2 3 4 5 6 7 8 9 101112 1314 151617FIG. 5. Binding of C-terminus variant proteins to hmUra-containing (A) and thymine-containing (B) DNAs. Wild-type TF1 and variant

roteins at the concentrations shown above each lane were incubated with 0.2 fmol of 5'-end-labeled RK130 DNA at 23°C for 10 min, and the)mplexes were separated in 6% (wt/vol) polyacrylamide gels.

1370

AProteinnM dimer

BProteinnM dimer on M

ay 23, 2021 by guesthttp://jb.asm

.org/D

ownloaded from

BACTERIOPHAGE SPOI-ENCODED TYPE II DNA-BINDING PROTEIN 1371

6000 -

z

E0

2000 -

A

TF1

pAPB BProtein

UVSPOI DNA

13SA-1.

TF1 TF1-C97

+ +

+

TFI-C97*

+ + S

- 67-43

-23

- 12.5

Fraction #

1 2 3 4 5 6 7 8 9

CProteln

UV

TFI-C97 pAP-TF1-C97

4.

Heperin+

+ +

+

+ + +

1 2 3 4 5 6 7 8 9FIG. 6. Modification of TF1-C97 with pAPB and photo-cross-linking. (A) Separation of modified, 3H-labeled TF1-C97 from unreacted

3H-labeled pAPB on Bio-Gel P-6. As a control, the same reaction was done with wild-type TF1. Symbols: 0, TF1-C97 elution profile; 0, wild-typeTF1 elution profile. (B) Reaction products of wild-type TF1, unmodified TF1-C97, and TF1-C97 modified with pAPB (TF1-C97*) uponphoto-cross-linking. Analysis was done by SDS-PAGE; M, D, and BSA mark the positions of TF1 monomer, TF1 dimer, and bovine serum albumin,respectively; molecular weight markers (lane S) are on the right side. The gel was silver stained. (C) Photo-cross-linking of pAPB-modified TF1-C97*to hmUra-containing 44-mer DNA. Reaction mixtures were illuminated with UV light as described in Materials and Methods; non-cross-linked TF1was stripped from DNA with heparin, and the reaction products were analyzed on 8% polyacrylamide gels. Arrows mark protein-bound (B) and free(F) 44-mer DNAs. The marks on the left side designate single-stranded DNA (+) and a contaminant of unknown origin (0).

intra- and intermonomeric contacts, this cross-linking experi-ment specifies intermonomer proximity.The presence of SPOl DNA promoted the formation of

covalently photo-cross-linked higher-molecular-weight species,presumably trimers and/or tetramers (Fig. 6B, lane 8, bandsmarked with a circle). This pAPB-modified TF1 was also ableto be cross-linked to hmUra-containing 44-mer DNA, albeitweakly (Fig. 6C), further suggesting that the C-proximal tail ofTF1, particularly Phe-97, is in proximity to DNA in TF1-SPO1DNA complexes.

DISCUSSION

These experiments show that the three C-terminal aminoacids of TF1 are closely involved in and important for DNA

binding. Without amino acid 97, the affinity of TF1 for DNA isdiminished by 2 to more than 3 orders of magnitude, depend-ing on the DNA partner (Table 1 and Fig. 2). Thus, aminoacids 1 to 96 of TF1 are not more important for DNA bindingthan are amino acids 1 to 90 (27). That finding correlates withcertain early results of the ongoing analysis of TF1 structure bymultidimensional NMR spectroscopy. (i) Phe-97 is located inthe vicinity of Phe-61 in the P-loop arm (24). (ii) Molecularmodelling based on the known structure of Bacillus stearother-mophilus HU (33, 34) involves Phe-97 in a cluster with otherhydrophobic amino acid side chains of the p-loop (14, 23).

Previous fluorescence spectroscopy experiments showedthat Tyr-94 is brought into the vicinity of DNA base pairs whenwild-type TF1 binds to SPOl DNA (11). Replacing Phe-97with hydrophilic Ser strongly diminishes TF1 affinity for DNA

VOL. 176, 1994

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

1372 ANDERA AND GEIDUSCHEK

(Table 1 and Fig. 2 and 3A). A corresponding effect, i.e.,greatly diminished DNA binding resulting from the substitu-tion of Phe-61 with Ser or Gln, has been noted elsewhere (28).Taken together, this information suggests that the aromaticside chain of Phe-97 is involved in a hydrophobic cluster withside chains of amino acids from the p-loop of TF1, whichallows the tail of TF1 to assume an orientation and a structurethat are appropriate for an interaction with DNA.The effects of removing both Ala-98 and Lys-99 were also

dramatic, but in a different way. TF1-Op98, with its C-terminalhydrophobic Phe-97, bound DNA with a reasonable avidity butquite aberrantly (Fig. 2A). It evidently aggregated DNAfragments of T-containing as well as hmUra-containing DNA(Fig. 2A and 5A and Table 1). The soluble DNA complexesthat it did form resembled E. coli HU-DNA complexes in theirgel electrophoretic mobility (see Fig. 3 of reference 28). Verymodest retardation of these complexes would have beengenerated if TF1-Op98 bound DNA nonspecifically and bentDNA less than does wild-type TF1 (31). TF1-Op98 also yieldedno recognizable DNase I footprint but instead uniformlyprotected DNA (Fig. 3B), either because of completely indis-criminate binding or because of the formation of aggregatedprotein-DNA complexes that were inaccessible to the nucle-ase. We suggest that removing amino acids 98 and 99 exposestwo hydrophobic patches in each molecule of DNA-bound TF1dimer and that surface exposure of these patches generatesstrong protein-protein interactions that produce aggregation.

In contrast, removing or replacing the C-terminal Lys-99generated relatively subtle effects on DNA binding. The affinityfor a short DNA fragment with only a single TFW-binding sitewas not substantially diminished (Table 1 and Fig. SA),implying that the extra positive charge at the C terminus ofwild-type TF1 does not make a substantial contribution toaffinity for DNA. However, TF1-Op99-DNA complexes didnot form discrete bands on gel retardation (Fig. 2A), and theoccupancy of sites A and B in DNA fragment RK130 waspartly noncoordinate (Fig. 3B). These tendencies were moreclearly manifested by TF1-W99, with its diminished affinity forthe single-site-containing DNA fragment (Table 1), smearedgel retardation bands (Fig. 2B), and clearly noncoordinateoccupancy of sites A and B in RK130 DNA. We suggest thatthe C terminus of TF1 participates in protein-protein interac-tions that promote the formation of nested complexes of TF1on DNA. In TF1-W99 and, to a lesser extent, in TF1-Op99,these protein-protein interactions are aberrant.The introduction of a unique cysteine into TF1 generates a

site at which a variety of specific chemical modifications can beintroduced. TF1-C97 binds more loosely to DNA than doeswild-type TF1, as judged by gel retardation (Table 1 and Fig.2B), but yields a wild-type TF1-like footprint (Fig. 3A). TheSH group of TF1-C97 is accessible to reaction with pAPB;formation of the photoactive arylazido derivative, TF1-C97*,does not appreciably change the affinity for DNA. Intermono-meric contacts form in TF1-C97* upon irradiation, and high-molecular-weight products form in the presence of DNA,conceivably because of the formation of interdimer as well asintradimer TF1 cross-links when higher-order complexes ofTF1 are formed at high protein concentrations on long DNAmolecules. Cross-linking to DNA was also detected (Fig. 6).Thus, the preliminary evidence of these experiments suggeststhat amino acid 97 of TF1 is in the vicinity of DNA and that itis also in the vicinity of sites of protein-protein contact inhigher-order TF1 complexes on DNA.

ACKNOWLEDGMENTSWe are grateful to C. J. Spangler for discussions and for comments

on the manuscript, to G. A. Kassavetis for advice on protein purifica-tion, and to L. Mayol and A. Galeone for the generous gift of syntheticoligonucleotides containing hmUra.Our research was supported by a grant from the NIGMS.

REFERENCES

1. Andera, L., C. Spangler, A. Galeone, L. Mayol, and E. P. Geidus-chek. Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPOl-encoded type II DNA-binding protein TF1. J. Mol. Biol., in press.

2. Boubrik, F., E. Bonnefoy, and J. Rouviere-Yaniv. 1991. HU andIHF: similarities and differences. In Escherichia coli the lack ofHU is not compensated for by IHF. Res. Microbiol. 142:239-247.

3. Conte, M. R., A. Galeone, D. Avizonis, V. L. Hsu, L. Mayol, andD. R. Kearns. 1992. Solid phase synthesis of 5-hydroxymethyluracilcontaining DNA. Bioorg. Med. Chem. Lett. 2:79-82.

4. Craig, N. L., and H. A. Nash. 1984. E. coli integration host factorbinds to specific sites in DNA. Cell 39:707-716.

5. Freundlich, M., N. Ramani, E. Mathew, A. Sirko, and P. Tsui.1992. The role of integration host factor in gene expression inEscherichia coli. Mol. Microbiol. 6:2557-2563.

6. Friedman, D. I. 1988. Integration host factor: a protein for allreasons. Cell 55:545-554.

7. Gardner, J. F., and H. A. Nash. 1986. Role of Escherichia coli IHFprotein in lambda site-specific recombination. A mutational anal-ysis of binding sites. J. Mol. Biol. 191:181-189.

8. Granston, A. E., and H. A. Nash. 1993. Characterization of a set ofintegration host factor mutants deficient for DNA binding. J. Mol.Biol. 234:45-59.

9. Greene, J. R., and E. P. Geiduschelk 1985. Site-specific DNAbinding by the bacteriophage SPOl-encoded type II DNA-bindingprotein. EMBO J. 4:1345-1349.

10. Gualerzi, C. O., and C. L. Pon (ed.). 1987. Bacterial chromatin.Springer-Verlag KG, Berlin.

11. Hard, T., V. Hsu, M. H. Sayre, E. P. Geiduschek, K. Appelt, andD. R. Kearns. 1989. Fluorescence studies of a single tyrosine in atype II DNA binding protein. Biochemistry 28:396-406.

12. Hoover, T. R., E. Santero, S. Porter, and S. Kustu. 1990. Theintegration host factor stimulates interaction of RNA polymerasewith NIFA, the transcriptional activator for nitrogen fixationoperons. Cell 63:11-22.

13. Huisman, O., M. Faelen, D. Girard, A. Jaffe, A. Toussaint, and J.Rouviere-Yaniv. 1989. Multiple defects in Escherichia coli mutantslacking HU protein. J. Bacteriol. 171:3704-3712.

14. Jia, X., J. M. Reisman, V. L. Hsu, and D. R. Kearns. 1993. AnNMR study of the solution structure of transcription factor 1.Abstr. Protein Soc. 7th Symp., San Diego, Calif. Protein Sci.2(Suppl. 1):127.

15. Johnson, G. G., and E. P. GeiduscheL 1977. Specificity of the weakbinding between the phage SPOl transcription-inhibitory protein,TF1, and SPOl DNA. Biochemistry 16:1473-1485.

16. Kano, Y., and F. Imamoto. 1990. Requirement of integration hostfactor (IHF) for growth of Escherichia coli deficient in HUprotein. Gene 89-.133-137.

17. Kano, Y., T. Ogawa, T. Ogura, S. Hiraga, T. Okazaki, and F.Imamoto. 1991. Participation of the histone-like protein HU andof IHF in minichromosomal maintenance in Escherichia coli.Gene 103:25-30.

18. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

19. Mengeritsky, G., D. Goldenberg, I. Mendelson, H. Giladi, andA. B. Oppenheim. 1993. Genetic and biochemical analysis of theintegration host factor of Escherichia coli. J. Mol. Biol. 231:646-657.

20. Mensa-Wilmot, K., K. Carroll, and R. McMacken. 1989. Tran-scriptional activation of bacteriophage lambda-DNA replication invitro-regulatory role of histone-like protein HU of Escherichiacoli. EMBO J. 8:2393-2402.

20a.Neilan, J. G., Z. Lu, G. F. Kutish, M. D. Sussman, P. C. Roberts,

J. BACTERIOL.

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

BACTERIOPHAGE SPOl-ENCODED TYPE II DNA-BINDING PROTEIN 1373

T. Yozawa, and D. L. Rock. 1993. An African swine fever virusgene with similarity to bacterial DNA binding proteins, bacterialintegration host factors, and the Bacillus phage SPOl transcriptionfactor, TF1. Nucleic Acids Res. 21:1496.

21. Ogura, T., H. Niki, Y. Kano, F. Imamoto, and S. Hiraga. 1990.Maintenance of plasmids in HU and IHF mutants of Escherichiacoli. Mol. Gen. Genet. 220:197-203.

22. Pendergrast, P. S., Y. Chen, Y. W. Ebright, and R. H. Ebright.1992. Determination of the orientation of a DNA binding motif ina protein-DNA complex by photocrosslinking. Proc. Natl. Acad.Sci. USA 89:10287-10291.

23. Reisman, J. M. 1993. Analyses of two bacteriophage-encodedDNA-binding proteins in solution. Ph.D. thesis. University ofCalifornia, San Diego.

24. Reisman, J. M., V. L. Hsu, I. Jariel-Encontre, C. Lecou, M. H.Sayre, D. R. Kearns, and J. Parello. 1993. A 1H-NMR study of thetranscription factor 1 from Bacillus subtilis phage SPOl by selec-tive 2H-labeling. Eur. J. Biochem. 213:865-873.

25. Robertson, C. A., and H. A. Nash. 1988. Bending of the bacterio-phage lambda attachment site by Escherichia coli integration hostfactor. J. Biol. Chem. 263:3554-3557.

26. Sayre, M. H., and E. P. Geiduschelk 1988. TF1, the bacteriophageSPOl-encoded type II DNA-binding protein, is essential for viralmultiplication. J. Virol. 62:3455-3462.

27. Sayre, M. H., and E. P. GeiduscheL 1990. Construction andproperties of a temperature-sensitive mutation in the gene for the

bacteriophage SPO1 DNA-binding protein TF1. J. Bacteriol.172:4672-4681.

28. Sayre, M. H., and E. P. Geiduschel. 1990. Effects of mutations atamino acid 61 in the arm of TF1 on its DNA-binding properties.J. Mol. Biol. 216:819-833.

29. Schmid, M. B., and R. C. Johnson. 1991. Southern revival. NewBiol. 3:945-950.

30. Schneider, G. J., and E. P. Geiduschek. 1990. Stoichiometry ofDNA binding by the bacteriophage SPOl-encoded type II DNA-binding protein TF1. J. Biol. Chem. 265:10198-10200.

31. Schneider, G. J., M. H. Sayre, and E. P. Geiduschelk 1991.DNA-bending properties of TF1. J. Mol. Biol. 221:777-794.

32. Smith, B. D., K. Nakanishi, K. Watanabe, and S. Ito. 1990.4-Azido[3,5-3H]phenacyl bromide, a versatile bifunctional reagentfor photoaffinity radiolabeling. Synthesis of prostaglandin4-azido[3,5-3Hjphenacyl esters. Bioconjugate Chem. 2:363-364.

33. Tanaka, I., K. Appelt, J. Dik, S. W. White, and K. S. Wilson. 1984.3-A resolution structure of a protein with histone-like propertiesin prokaryotes. Nature (London) 310:376-381.

34. White, S. W., K. Appelt, K. S. Wilson, and I. Tanaka. 1989. Aprotein structural motif that bends DNA. Proteins 5:281-288.

35. Wilson, D. L., and E. P. Geiduschelk 1969. A template-selectiveinhibitor of in vitro transcription. Proc. Natl. Acad. Sci. USA62:514-520.

36. Yang, C.-C., and H. A. Nash. 1989. The interaction of E. coli IHFprotein with its specific binding sites. Cell 57:869-880.

VOL. 176, 1994

on May 23, 2021 by guest

http://jb.asm.org/

Dow

nloaded from