determinants of the brain-specific expression of the rat aldolase c gene: ex vivo and in vivo...

Eur. J. Biochem. 218, 143-151 (1993) 0 FEBS 1993

Determinants of the brain-specific expression of the rat aldolase C gene: ex vivo and in vivo analysis Muriel THOMAS’, Iman MAKEH’, Pascale BRIAND’, Axel KAHN’ and Henriette SKALA’ ’ Institut Cochin de GCnCtique MolCculaire, Laboratoire de GCnCtique et Pathologie MolCculaires, INSERM U129, Paris, France * Institut Cochin de GCnCtique MolCculaire, Laboratoire de GCnCtique et Pathologie ExpCrimentales, CJF.9003 INSERM, Paris, France

(Received June 2WAugust 5, 1993) - EJB 93 0953/1

A 115-bp promoter fragment of the aldolase C gene is sufficient for conferring neural cell specificity on a reporter gene, in cultured PC12 cells and in transgenic mice. In vitro DNase I protection experiments detected two footprints on the promoter, termed boxes A/A‘, and B. The 5’ NA’ box contains overlapping Spl and Krox2O/Krox24 binding sites; it binds Spl in fibroblasts (box A’) and a different complex in brain (box A). Any deletion or mutation of this box that impairs protein recognition also suppresses promoter activity. The replacement of box MA‘ by a Spl consensus binding site results in the loss of the brain specificity of expression in transgenic mice. Further 3‘, box B is composed of a 5’ direct repeat and a 3’ GC box consisting of overlapping Spl and Krox20/Krox24 binding sites. Mutation of the direct repeat subregion appears to be more deleterious for the promoter activity than mutation of the G+C-rich subregion.

Aldolase C is one of the three isoforms of the glycolytic enzyme, fructose-l,6-bisphosphate aldolase. Its expression is ubiquitous during ontogeny but after birth it becomes restricted to brain and particularly to neuronal cells (Popovici et al., 1990; Skala et al., 1987). In situ hybridization experiments have shown that aldolase C mRNA is especially abundant in well defined brain areas (hippocampus and thalamic nuclei) (Mukai et al., 1991 ; Popovici et al., 1990; Skala et al., 1987). In addition, the aldolase C gene is re-expressed in actively proliferating cancerous cells (Skala et al., 1987; Takashi et al., 1990). The basis for the brain specificity of this gene in adults is, at least in part, transcriptional, as judged from run-on assays (Vibert et al., 1989). In spite of its tissue specificity, the aldolase C gene promoter displays features of housekeeping genes (Araki et al., 1991 ; Farnham and Means, 1990; Luo and King, 1990; Ma et al., 1991): multiple start sites of transcription distributed over about 100 nucleotides; absence of TATA box and of CAAT box, rich- ness in GC doublets and presence of putative GC boxes (Gidoni et al., 1985). In fact, similar characteristics have also been reported for other genes expressed in brain cells, e.g y- enolase (Forss-Petter et al., 1990), thy-1 (Vidal et al., 1990), a-internexin (Ching and Liem, 1991) and neural cell adhesion molecule (Hirsch et al., 1990). However, the DNA elements responsible for the tissue-restricted expression of these genes are often not known in detail. We have therefore inves- tigated the determinants of brain specificity of the aldolase C gene.

Correspondence to M. Thomas, CHU Cochin, ICGM U.129 IN- SERM, 24 rue du Fg St Jacques, F-75014 Paris, France

Fux: +33 1 44 41 24 21. Abbreviations. CAT, chloramphenicol acetyltransferase; UMS,

upstream mouse sequence; SV40, simian virus 40; PCR, polymerase chain reaction; DOTAP, N-[l-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium methylsulfate.

Enzyme. Aldolase C, fructose-l,6-bisphosphate aldolase (EC 4.1.2.13).

We demonstrate in this paper that a short 115-bp aldolase C 5’-flanking DNA fragment is sufficient for conferring on the chloramphenicol acetyltransferase reporter gene a specific expression in cultured pheochromocytoma PC12 cells, whose endogenous aldolase C gene is very active, and in the brain of transgenic mice. This expression requires binding of several factors, especially on DNA elements resembling GC boxes and able to interact, in vitro, with Spl, and with proteins of the Krox2o/Krox24 family (Nardelli et al., 1991). However, replacing the distal G+C-rich site by a Spl consensus binding site resulted in the loss of the brain specificity of expression in transgenic mice.

EXPERIMENTAL PROCEDURES

Recombinant plasmids The basal promoterless plasmid pEMBL19 CATKJMS

(referred to as UMS/CAT) has been described by Cognet et al. (1991). In this construct, the upstream mouse sequence (UMS) (Wood et al., 1984), the coding unit of the chloramphenicol acetyltransferase (CAT) gene and the simian virus 40 (SV40) polyadenylation sequence were cloned into pEMBL19. All constructions were obtained by ligating sub- fragments of the 5’-flanlung region of aldolase C gene into UMS/CAT in front of the CAT gene. 5.5/CAT contained a 5.5-kb aldolase C fragment ending at a XmaIII restriction site at position -36 (with respect to the ATG translation initiator in the second exon). Smaller fragments, -199 to -84 and - 168 to - 84, were generated by the polymerase chain reaction (PCR) and ligated in front of the CAT gene, yielding plasmids 0.115/CAT and AAIA’ICAT. A deletion by FokI di- gestion of the 0.1WCAT plasmid gave plasmid d45/CAT with a -154 to -84 aldolase C flanking fragment. A PCR error resulted in a plasmid AJA‘muVCAT, equivalent to 0.11YCAT but with a point mutation at position -175 (G/

144

A). DRmut/CAT and SplBmut/CAT correspond to 0.1151 CAT where sequences TGTCTG (- 159/- 154) and CGCC- CC (-149/-144) are both mutated by PCR reaction into GAATTC. Two versions of G+C-rich motifs were cloned upstream of the plasmid ANA‘KAT: either the aldolase C NA’ boxes (-203 to -168), yielding plasmid insO.llS/CAT, which was very similar to 0.115/CAT except for a 6-bp insert at the -168 position; or the Spl consensus binding site 5’GCATAACTCCGCCCAGTTAG3’, yielding plasmid Spl cons/CAT.

Plasmid O.llS/CATSV was obtained by cloning the 0.115 aldolase C fragment into the previously described pEMBL19- CAT/UMS/SV40 plasmid (Cognet et al., 1991), where the 72-bp repeat SV40 enhancer was cloned in a CZaI site downstream of the CAT gene.

Cell lines

Two cell lines were used: rat pheochromocytoma PC12 cells (Green and Tischler, 1976) and mouse NW3T6 fibro- blastic cells. PC12 cells were cultured in RPMI medium (Gibco) containing 5% (by vol.) fetal calf serum, 10% (by vol.) horse serum, and 0.15% (mass/vol.) sodium bicarbon- ate. 3T6 cells were grown in Dulbecco’s modified Eagle medium supplemented with 10% (by vol.) fetal calf serum. These cells were maintained at 37°C under 5% CO,.

Transfection assays

Cells were transfected with a mixture of 7.5 pg tested plasmid and 2.5 pg internal control plasmid, pRSVluci (De Wet et al., 1987) which contains the coding sequence of a firefly luciferase cDNA under the control of the Rous sarcoma virus long terminal repeat.

Cells (1.5X lo‘), suspended in 150 p1 of their own com- plete medium mixed with 10 pg plasmid, were put into an electroporation cuvette and kept on ice for 10 min. Cells were then exposed to a pulse of 160 V at 960 pF for PC12 cells and of 240 V at 960 pF for 3T6 cells. Pulses were deliv- ered by the Bio-Rad gene pulser system. Cuvettes were kept on ice for 10 min, then cells were plated on 6-cm dishes in their corresponding medium. Also, 3T6 cells were transfected with 30 pg of the same plasmid mixture by the calcium phosphate coprecipitation technique and by the lipofection method with N-[l-(2,3-dioleoyloxy)propyl]-N,N,N- trimethylammonium methylsulfate (DOTAP) reagent.

The medium was changed 24 h after transfection and 48 h later cells were harvested and assayed for luciferase and CAT activities (De Wet et al., 1987; Gorman et al., 1982). Each CAT activity was normalized to the corresponding luciferase dosage.

DNase I protection and band-shift assays

Isolation of nuclear proteins from adult rat brain and from 3T6 and PC12 cells was performed as described (Piette et al., 1985). Nuclear extracts from adult rat liver and kidney were purified according to Gorski et al. (1986) and DNase I footprinting and gel shift assays carried out as previously reported (Cereghini et a]., 1987; Raymondjean et al., 1988). Bacterial extracts with and without Spl, Krox20 and 0 0 x 2 4 recombinant protein were generously provided by P. Char- nay.

Fig. 1. Ransient CAT assay of the O.l15/CAT construct in neural PC12 cells and 3T6 fibroblasts. Cells were transfected by electroporation. UMSfCAT, promoterless plasmid; pSV2CAT, CAT construct driven by the early promoter and enhancer of the SV40 virus; CM, chloramphenicol ; Ac-CM, acetylchloramphenicol stereoiso- mers.

Table 1. CAT activity generated by different constructs in PC12 cells transfected by electroporation, and 3T6 fibroblasts transfected by calcium phosphate coprecipitation. The CAT activities were standardized with respect to the luciferase activity generated by a cotransfected Rous sarcoma virus luciferase plasmid and expressed as a percentage of pSV2CAT activity. The results are the means of at least three independent measurements.

Construct PC12 3T6 electroporation calcium phosphate

%

5.5fCAT 3 0.115fCAT 3.2 0.11 5/CAT/SV 42 pSV2CAT 100

0.18 0.21

26 100

Double stranded oligonucleotides used as competitor were: D, the -109 to -86 site of the rat albumin gene promoter (Raymondjean et al., 1988) S’GGTATGATTTTG- TAATGCGGTAGG3’; and NFY, the -93 to -65 site of the rat albumin gene promoter (Raymondjean et al., 1988) 5’GGGGTAGGAACCAATGAAATGAAAGGTTA3’.

Transgenic mice Plasmids (0.11YCAT and Spl cons/CAT) were digested

by XbaI and CZaI. The restriction fragments containing the chimeric genes were purified from agarose gels and microin- jected into fertilized mouse eggs by the methods described previously (Tremp et al., 1991). DNA was isolated from the tails of 2-week-old mice (F1 generation) and analyzed on Southern blot by hybridization with a CAT probe.

RESULTS A short 5’-flanking 115-bp fragment of the rat adolase C gene confers on the CAT reporter gene a specific expression in PC12 cells

We chose PC12 rat pheochromocytoma cells as a model of neural-type tissue strongly expressing the aldolase C gene as judged from the abundance of the aldolase C mRNA analysed by Northern blot. In contrast, this messenger was unde-

145

Fig.2. DNase I footprinting analysis of the aldolase C 115-bp promoter fragment. A 140-bp fragment was excised from the O.llS/CAT plasmid by XbaI and Sac1 digestions and end-labelled. GfA, Maxam-Gilbert sequence reactions; free, DNA treated with DNase I without nuclear extract. (A) Protection by 30-50 pg nuclear extracts from brain or 3T6 fibroblasts. Footprints A, A‘ and B are indicated by vertical lines. (B) Protection by bacterial extracts containing (Spl f; Krox24+) or not containing (-) recombinant DNA binding proteins.

tectable in NIH3T6 fibroblast RNAs analysed by the same method (data not shown). Results reported in Fig. 1 and Ta- ble 1 show that the 0.119CAT plasmid was at least tenfold more active in PC12 cells than in NIH3T6 fibroblasts. Other aldolaseCtCAT (aldC/CAT) constructs with larger 5’-flanking sequences, up to about 5.5 kb, were similarly active in PC12 cells and practically inactive in fibroblasts (Table 1). Activity of the aldC/CAT constructs in PC12 cells remained relatively low (3% of PSV2CAT), which is in line with our previous observation that, although specific, the aldolase C gene promoter is weak in adult brain (Vibert et al., 1989). Indepen- dently of the transfection method (electroporation, calcium phosphate and lipofection with DOTAP reagent), all aldC/ CAT constructs had a negligible activity in fibroblasts. Cell specificity of the 115-bp aldolase C promoter fragment was lost in the presence of the SV40 enhancer, the O.l15/CATSV plasmid being approximately equally active in PC12 cells and fibroblasts (Table 1).

DNase I footprinting analysis of the active 115-bp aldolase C promoter fragment

Since 115 bp of the aldolase C 5’-flanking sequences were sufficient to confer cell specificity on a reporter gene, we analysed the interactions of this fragment with adult brain and fibroblast nuclear proteins by DNase I footprinting. The first tissue synthesizes aldolase C intensively, while 3T6 cells contain no aldolase C isozyme. The footprint observed with these two types of nuclear extracts consisted of two protected ‘windows’. In brain, the distal footprint (box A) spanned from bp -197 to -171 while in fibroblasts (box A’) it was more 3’, from bp -186 to -166. Box B, common to the two types of extracts tested, spanned from bp -161 to -138 (Fig. 2A). Both box A/A’ and box B include potential Spl and Krox20/Krox24 binding sites (Fig. 2B). Indeed, recombinant Spl gave a strong footprint including both A and B boxes plus the intermediary region (from bp - 185 to - 138).

146

Footprint of box A/A’ and box 6

Box A/A‘ Box B

T A

Putative binding sites of Spl and Krox20/Krox24

-199 -136

TAGACCAGTCCTGGG CAGGA C T GAGTC

Fig. 3. Sequences of boxes MA‘ and B deduced from footprinting experiments (Fig. 2) and putative binding sites of Spl and Krox20/ Krox24. Vertical lines delimit protected sequences (Fig. 2) .

This pattern is similar to that observed in fibroblasts, except for the protected region of bp -166 to -161, which might indicate that a supplementary Spl molecule is able to bind to the aldolase C promoter when using the truncated recombinant protein. This is in line with the presence of a TGGI GAG/GTG putative Spl binding site between bp -166 and -158 (Fig. 3). With Krox24, a weak protection limited on the 3’ side by a hypersensitive site was observed on box MA’ between bp -187 and -171, and a strong protection on box B between bp -154 and -136 (Fig. 2B). The same pattern was obtained with Krox20 (not shown). These results show that the footprint A‘ obtained with fibroblast nuclear extracts rnimicks the footprint observed when using recombinant Spl, especially for the 5’ boundary. In addition, this protection is displaced by adding excess Spl consensus oligonucleotide (not shown). In contrast, the footprint A resulting from protection with brain extracts is displaced on the 5’ side with respect to the Spl/A‘ footprint; its 3‘ boundary is approximately similar to that of the slight protection obtained with recombinant Krox20/Krox24. In addition, footprint A is resistant to competition with excess Spl consensus oligonucleotide (not shown). Footprint B was similar to that related to Spl binding and was slightly more upstream than that related to Krox2O/Krox24 binding, as expected from the putative binding sites (Fig. 3).

Gel shift analysis of the DNMprotein interactions at boxes MA‘ and B

An oligonucleotide reproducing the box MA‘ sequence, referred to as oligonucleotide A/A’, formed in gel shift assay a single retarded complex that was similar with all nuclear extracts tested (Fig. 4A). It was more abundant in fibroblasts and liver than in brain, with intermediate values in PC12 cells and kidney. This complex exhibited the same migration as that formed with a Spl consensus oligonucleotide (Splcons; Fig. 5B) and was displaced by both Splcons and MA’ oligonucleotides in excess, although more efficiently by the former one (not shown). Similarly, a Spl cons-containing complex was much more efficiently displaced by Splcons than by A/A’ oligonucleotides (Fig. 4B). These results indicate that box MA‘ is able to bind Spl, at least in vitro, but with a low affinity compared to Spl cons oligonucleotide,

and confirmed the unequal abundance of Spl in different tissues and cells (Somma et al., 1991).

The B oligonucleotide (which reproduces the sequence of box B) gave several retarded bands. With brain extracts, we observed a single, relatively diffuse band X, displaced by the homologous oligonucleotide but neither by Spl cons nor by D oligonucleotides (Fig. 5 A); [the D oligonucleotide which reproduces the box D sequence of the albumin promoter binds proteins of the CEBP family (Raymondjean et al., 1988)]. The complex formed with 3T6 fibroblast nuclear extracts consisted of a predominant band S and of a weak X;Y doublet. Band S comigrated with Splcons and MA‘ oligonucleotide-containing complexes and was efficiently displaced by the Spl cons oligonucleotide. The X;Y doublet was only displaced by homologous B oligonucleotide. It appears, therefore, that box B is able to bind Spl, but with such a low affinity that the Spl complex is only detected in fibroblasts, which are especially rich in this factor. In addition, complex X is observed in brain. Since box B is composed of a 3’ G+C-rich sequence resembling a Spl binding site (- 153/TCACGCCCC/-l45), referred to as Spl B, and of a 5’ direct repeat (- 159/TGTCTGTC/- 152), referred to as DR, we separately mutated these sub-elements. Mutation of the Spl B subregion (Spl Bmut) led to the disappearance of band S. Mutation of the DR subregion resulted in disappearance of the X;Y complex, but not of the S band which, on the contrary, is reinforced with fibroblast extracts (Fig. 6). A supplementary, non-specific, fast-migrating band was detected with the DRmut probe. Box B, therefore, interacts in vitro with Spl but with a low affinity; its distal sub-region is capable of binding non-identified proteins whose abundance, nature or relative proportion can differ in different tissues. The DR and Spl B subregions are contiguous and could even be slightly overlapping, resulting in this case in an exclusive binding of either X;Y factors or Spl related proteins.

Ex vivo cis-activity of the protein binding sites detected on the aldolase C promoter

Fig. 7 shows that all constructs whose box A/A’ is de- leted (d45/CAT and AA/A’/CAT) or mutated (A/A’mut/CAT) were inactive in PC12 cells. The A/A’mut/CAT construct has a mutation in the GC sequence of box MA’ (converting the AGGGCGGGA into AGGGCGAGA) that strongly impairs

147

Fig. 4. Gel shift analysis of box NA’ and identification of the box MA’ as a Spl binding site. (A) the MA’ oligonucleotide, reproducing the box MA‘ sequence was incubated with 3-5 pg nuclear extracts from fibroblasts (F), PC12 cells (P), kidney (K), liver (L) and brain (B). Free, no added nuclear extract. (B) The Splcons oligonucleotide which reproduces a high-affinity Spl binding site of the SV40 early promoter was incubated with brain extracts, either in the absence of competitor (first lane), or in the presence of increasing amounts of competitors (5, 10 and 30 ng Spl cons or MA‘), or in the presence of 30 ng NFY oligonucleotide derived from the albumin gene promoter binding site (Raymondjean et al., 1988).

Fig. 5. Gel shift analysis of box B. (A) The B oligonucleotide was incubated with nuclear extracts from brain, and 3T6 fibroblasts, either without competitor (0 or with 30 ng various oligonucleotide competitors: Splcons, oligonucleotide B and D. The location of different retarded complexes are shown: S = Spl complex; X;Y = X and Y complexes. (B) Comparison between Spl complexes formed by various oligonucleotides (Splcons, MA‘ and B) incubated with 3T6 nuclear extracts.

the interaction with DNA binding proteins; the A footprint obtained with brain was totally suppressed by the mutation (Fig. 8). These results indicate that a functional box A/A’ is essential to the activity of the aldolase C promoter. The question was then whether the cis-activity of box MA’ could be mimicked by an element with a high affinity for Spl but devoid of the 5‘ putative binding site for proteins of the Krox20/Krox24 family. To investigate this question, box A/ A’ was replaced by a Spl consensus binding site yielding plasmid SplcondCAT. This element had no affinity for Krox20/Krox24 as judged from a gel shift assay experiment (not shown). In spite of the increase in the affinity of this new GC box for Spl, promoter activity of Spl cons/CAT was slightly reduced in PC12 cells and not significantly increased in fibroblasts (not shown). Fig. 7 also shows that mutation of

B GRTGGGAGGTGTCTGTCRCGCCCCCRGGGRGTC

Sp 1 Bm u t GRTGGGRGGTGTCTGTC~GRATT(CCAGGGRGTC

D R m ut G R T G G G R G q m p C R C G C C C C C R G G G R G T C

Fig.6. Gel shift analysis of DR and SplB subregions of box B. Comparison of the retarded complexes formed by the oligonucleotides B (wild type), SplBmut (mutated in the Spl subregion) and DRmut (mutated in the DR subregion) when incubated with nuclear extracts from either brain or 3T6 fibroblasts. Positions of the Spl, X and Y complexes are indicated by arrows. The strong fast-migrating retarded band observed with the DRmut oligonucleotide is non-specific (not shown). Sequences of each nucleotide are indicated.

the DR sub-region of box B resulted in an important inactiva- tion of the promoter while mutation of the SplB sub-region decreased this activity about threefold. The DR binding proteins interacting with the distal sub-region of box B could therefore be especially important in the activity of this element, the consequences of the Spl B mutation being possibly related to a modification of the DR site 3’-flanking sequence. In line with this hypothesis, we can observe in Fig. 6 that affinity of the Spl Bmut oligonucleotide for X;Y complexes seemed to be slightly reduced with respect to the normal probe. The activity of the plasmid insO.llS/CAT, in which a

148

CAT activity

EAT

, I EAT

[ J - 3 A T

B 0 I 1 5 / C A T I ,.A.!A., I

A45/CAT

6 A A I A /CAT

EAT B A / A m u t / C A T I - ' I

-&AT I B

S p l cons/CAT '

A / A DRmut /CAT """' - ' E A T

I * ' , , * , . I I - E A T

1 I , , , 1 -AT

S P l B m u t / C A T A / A

6 Ins0 1 15 /CAT A / A

P C I 2

3 4

7

0

0

0

2 2

0 1

09

3 2

- Fig. 7. CAT activity generated by various aldC/CAT plasmids in PC12 cells transfected by electroporation. The results are the means of two, three or four independent experiments, standardized with respect to the Rous sarcoma virus luciferase plasmid activity and expressed as percentages of the pSV2CAT construct activity, as reported in Table 1.

6-bp insertion (i.e. half a turn of DNA double helix) has been added between boxes NA' and B, was not modified compared to the wild-type construct, indicating that no strict steric relationship is required between the complexes built up at boxes MA' and B. Therefore, factors binding in neural cells to box MA' and to the DR sub-region of box B appear to be essential for activating the aldolase C promoter. How- ever, since these DNA elements are able to bind ubiquitous factors in vitro, the exact nature of the protein complexes responsible for the brain specificity of the aldolase C promoter remains uncertain.

In vivo involvement of box MA' in the brain-specific expression of the aldolase C gene

The activity of plasmid Splcons/CAT seemed to be slightly decreased compared to the wild-type construct, while Spl cons/CAT binds Spl more efficiently than oligonucleotide NA'. This suggested that Spl was not the transcriptional factor involved in activity of the aldolase C promoter in neural cells. Such a hypothesis prompted us to look at the activity of the SplcondCAT construct in the brain and other tissues of transgenic mice, as compared to that of the non- mutated O.llS/CAT construct: we analyzed four transgenic lines for each transgene. While the wild-type 0.1 15/CAT transgene exhibited a strong brain specificity (Fig. 9 and Ta- ble 2), this specificity was lost in the lines carrying the mu- tant transgene that was less active in the brain than the 0.115/ CAT transgene but was slightly expressed in all tested tissues (intestine, muscle, heart, kidney, spleen, lung, testes and liver) (Fig. 9 and Table 2).

DISCUSSION A short 115-bp promoter fragment of the rat aldolase C

gene is sufficient to confer on a reporter gene a specific ex-

Fig. 8. DNase I footprinting analysis of the A/Amut 115-bp promoter fragment. A 140-bp fragment was excised from the A/ A'mutlCAT plasmid, as reported in Fig. 2, and either not protected (free) or protected by incubation with brain nuclear extracts.

pression in PC12 cells ex vivo and in brain of transgenic mice in vivo. This result contrasts with characteristics of this promoter that are reminiscent of those of housekeeping promoters, namely absence of TATA and CCAAT boxes, rich- ness in CG dinucleotides, presence of GC boxes and of multiple start sites of transcription. Two in vitro DNase I footprints have been characterized by protecting the 115-bp promoter fragment with nuclear proteins from brain and fibroblasts extracts (boxes MA' and B).

The G+C-rich box MA' is indispensable to the brain specificity of the aldolase C promoter

Box A' protected by fibroblast nuclear extracts seems to be very similar to the footprint resulting from protection by recombinant Spl. Gel shift assay showed that oligonucleotide MA' binds Spl, especially in fibroblasts where this factor is abundant. With brain extracts, the A footprint (- 197 to - 171) was shifted to the 5' side and began on the 3' side at the same nucleotide as a faint footprint resulting from protection by recombinant Krox2O/Krox24 proteins. In gel retardation experiments, oligonucleotide NA', however, formed a single very faint complex with brain nuclear pro-

149

Transgene : 0. t 15/CAT

G R c c R G T c CT GGG G RG AGGGC G G G R CC-

Transgene : Sp t cons/CAT

Fig. 9. CAT activity in different organs of transgenic mice expressing either 0.115aldC/CAT or SplconsCAT transgenes. (A) Transgenic line, carrying about one copy of the 0.11YCAT transgene. (B) Transgenic line, carrying about two copies of the Spl consCAT transgene. CAT activity was determined with 50 pg tissue extracts previously heated for 20 min at 60°C to destroy tissue deacetylase activity (Cuif et al., 1992). B, brain; I, intestine; M, muscle; H, heart; K, kidney; S, spleen; T, testes; L, lung; Li, liver.

Table 2. CAT activity in different organs of transgenic mice expressing either 0.115ICAT or Splcons/CAT transgenes. The results are expressed as the specific activity of acetylated chloramphenicol production; the approximate number of transgene copies is given; n.d., not determined.

Transgene Mouse Copy CAT activity in line no.

brain liver heart kidney spleen lung intestine

cpm . min-’ (pg protein)-’

0.11 SICAT 19 4 1.1 <0.01 <0.01 0.06 0.02 10.01 O.lIS/CAT 13 10 1.4 <0.01 <0.01 <0.01 <0.01 <0.01 0.11 YCAT 15 1 1.5 <0.01 <0.01 <0.01 <0.01 <0.01 0.1 1 S/CAT 9 15 0.04 <0.01 <0.01 <0.01 <0.01 <0.01 Spl consICAT 3 2 0.14 0.05 0.14 0.17 0.12 0.1 3 Spl conslCAT 9 2 0.3 0.3 0.2 0.2 0.4 0.3 Spl conslCAT 10 15 0.01 0.03 0.05 0.02 0.07 0.05 Spl consICAT 4 20 <0.01 0.02 n.d. 0.05 0.07 0.05

<0.01 <0.01 CO.01 <0.01

0.03 0.1

n.d. n.d.

teins that could not be distinguished from a Spl complex. Our data suggest that A’ region of the aldolase C promoter binds Spl in fibroblasts. In brain, the A box is recognized by another complex. The MA’ region of the rat aldolase C promoter includes overlapping Spl (- 1 8UAGGGCG- GGM- 173) and Krox20/Krox24 (- 184/GAGAGGGCG/- 176) binding sites (Fig. 10). This arrangement is also observed in the human aldolase C promoter (Fig. 10) and is reminiscent of a so-called ‘SNN’ element reported to be conserved in the promoters of the synapsin (Sauerwald et al., 1990), 68-kDa neurofilament (Lewis and Cowan, 1986) and nerve growth factor receptor genes (Sehgal et al., 1988). Overlapping consensus binding sites for Spl and Krox20/ Krox24 have been also described in promoters of murine adenosine deaminase and Hoxl.4 genes (Ackerman et al., 1991; Chavrier et al., 1990). Moreover, the 5’-subregion of rat box A (- 196 to - 182) is identical to the human sequence from bp -193 to -178 (Fig. 10). A point mutation at nucleotide -175, changing a G for a A, totally suppressed footprint

A (Fig. 8) and strongly attenuated footprint A’ (not shown). This mutation also abolished activity of the aldolase C promoter in PC12 cells as well as in fibroblasts, even in a construct including a SV40 enhancer (not shown). Therefore, box A/A’ is essential for the promoter activity of the aldolase C 115-bp fragment. Although this A-specific complex could have some similarities with Krox20/Krox24, it is neverthe- less probably different from these proteins as indicated by their low affinity for this region. To confirm that activity of the aldolase C promoter is not related to the binding of Spl to box AJA‘, we replaced the aldolase C box A/A‘ sequence (TAGACCAGTCCTGGGGAGAGGGCGGGACCAG) by a consensus Spl binding site derived from the 21-bp repeat of the SV40 early promoter (gcATAACTCCGCCCAgttag). Although this Spl cons element has a higher affinity for Spl than oligonucleotide A/A’, the resulting Spl consCAT plasmid was slightly less efficiently expressed in PC12 cells than the wild-type construct. Above all, this Spl consCAT construct exhibited only a low ubiquitous expression in different

150

Box A

Box B

SNN

-197

G -171

C SNN consensus (Sauerwald et al., 1990) and will try to iden- tify the exact nature of the binding proteins responsible for the brain-specific cis-activity of this type of element

-168 (Fig. 10).

C The bipartite box B contains two types of puGtive cis-regulatory elements-

Box B is clearly bipartite, consisting of a DR element and of a G+C-rich element whose binding capacity can be analyzed by selective mutations. In vitro, the DR element (gTGTCTGTCacgc) binds factors termed X and Y whose abundance varies in different tissues; X is predominant in brain extracts while Y is more abundant than X in fibroblasts. The G+C-rich subregion is termed Spl B because it proves to be a low-affinity Spl binding site, but it is also able to bind proteins of the Krox20/Krox24 family. Functionally, a mutation suppressing the capacity of X / Y to bind to the DR

- Rat

I-hman GGCATGCAG -

r

Neurofllament C consensus

NGF recepteur L

Fig. 10. Comparison of MA’, and B sequences between rat, human and consensus sites. Putative binding sites for Spl and Krox2O/Krox24 are indicated. Bases perfectly conserved in the rat and human (Buono et al., 1990) promoters are delimited by boxes. SNN consensus was deduced by comparison between 5’-flanking sequences of the synapsin I, 68-kDa neurofilament and nerve growth factor receptor genes (Sauenvald et al., 1990).

lines of transgenic mice. These results indicate, therefore, that the MA’ region of the aldolase C promoter is required for the strong elective promoter activity in brain and that this specificity most likely could not be accounted for by Krox20, Krox24 or Spl binding only. Many hypotheses could be en- visaged about the identity of transcriptional complex binding the short A/A’ region.

a) The A/A’ region could bind members of the Spl family. Many proteins with the same DNA recognition site as Spl have been described: Sp2 (Sehgal et al., 1988); Sp3 (Hagen et al., 1992; Kingsley et al., 1992); Sp4 (Hagen et al., 1992; Kingsley and Winoto, 1992), also referred to as SPR-1; and the brain-enriched factor BTEB (Imataka et al., 1992).

b) The MA’ region could bind members of the Krox201 Krox24 family. Krox 20, Krox 24, but also EGR3 (Patward- han et al., 1991) and NGFI-C (Crosby et al., 1991) belong to a family of cellular immediate-early genes encoding zinc finger transcriptional factor, In fact, it seems that an extensive family of zinc finger proteins able to bind G+C-rich motifs exists; some of them could be more or less brain-enriched, as Krox20 itself, which has been recently shown to be speci- fically expressed in rhombomers 3 and 5 of the developing hindbrain (Sham et al., 1993).

c) The A/A’ region could bind a new protein. We can suppose that an unknown protein or a multiprotein complex could bind the A/A‘ region and dictate a brain-specific transcription.

d) Finally, the A/A‘ region could bind a multiprotein complex, some of the constituents of which could belong to the Spl and (or) Krox2o/Krox24 families. Further investiga- tions will investigate whether the arrangement of the A/A’ region is interchangeable with another ‘brain element’, the

subregion has a deleterious effeci on the promoter activity in PC12 cells, while mutation of the SplB subelement suppressing binding of Spl has a limited effect only, which sug- gests that the DR subregion is functionally important. The DR element seems to be important not only for the promoter activity in PC12 cells, but also for the very low basal activity in fibroblasts (not shown), so that its role in brain-specific expression cannot be deduced from these experiments. In addition, Fig. 10 shows that the DR subregion is not well conserved between rat and human while, in contrast, Spl and Krox20/Krox24 sites of Spl B are highly conserved. Conse- quently, before a definitive conclusion can be reached, the actual role of these elements should be analyzed in a system other than PC12 cells, e.g. in transgenic mice.

In conclusion, the aldolase C promoter contains, in a 115- bp fragment, two footprinted boxes (box A/A’, box B). The A/A’ region is a G+C-rich element consisting of overlapping motifs able to bind members of either the Spl or the Krox20/ Krox24 transcriptional factor family, that is indispensable for both promoter activity and brain specificity of expression, ex vivo and in vivo. A direct repeat sub-element of box B binds different amounts of uncharacterized X and Y factors in brain and non-brain extracts and is important for the promoter activity in neural cells. As the DR subregion is not conserved between rat and human sequences, the role of this region should be confirmed in transgenic mice.

We are grateful to P. Charnay and J. Nardelli for the kind gift of the recombinant proteins Spl , Krox20 and Krox24. We thank P. Charnay, J. Nardelli and C. Vesque for their helpful reading of the manuscript and A. Strickland for a revision of the text. This work was supported by grants from the Ministtre de la recherche et de l’espace, l’association de recherche sur le cancer. la ligue nationale de la recherche sur le cancer et l’universitt Paris V-Rend Descartes.

REFERENCES Ackerman, S.-L., Minden, A.-G., Williams, G.-T., Bobonis, C. &

Yeung, C.-Y. (1991) Functional significance of an overlapping consensus binding motif for Spl and Zif268 in the murine adenosine deaminase gene promoter, Proc. Nut1 Acad. Sci. USA 88, 7523-7527.

Araki, E., Murakami, T., Shirotani, T., Kanai, F., Shinohara, Y., Shi- mada, F., Mori, M., Shichiri, M. & Ebina, Y. (1991) A cluster of four Spl binding sites required for efficient expression of the human insulin receptor gene, J. Biol. Chem. 266, 3944-3948.

Buono, P., Mancini, F. P., Izzo, P. & Salvatore, F. (1990) Character- ization of the transcription-initiation site and of the promoter

151

Luo, X. & Kim, K. H. (1990) An enhancer element in the housekeeping promoter for acetyl-CoA carboxylase gene, Nucleic Acids Res. 18, 3249 - 3254.

Ma, L., Weeda, G., Jochemsen, A. G., Bootsma, D., Hoeijmakers, J. H. J. & Van der Eb, A. J. (1991) Molecular and funcional analysis of the XPBCERCC-3 promoter: transcription activity is dependent on the integrity of an Spl-binding site, Nucleic Acids Res. 20, 217-224.

Mukai, T., Yatsuki, H., Masuko, S., Arai, Y., Joh, K. & Hori, K. (1991) The structure of the brain-specific rat aldolase C gene and its regional expression, Biochem. Biophys. Res. Commun.

Nardelli, J., Gibson, T., Vesque, C. & Charnay, P. (1991) Base sequence discrimination by zinc-finger DNA-binding domains, Na- ture 349, 175-118.

Patwardhan, S., Gashler, A., Siegel, M. G., Chang, L. C., Joseph, L. J., Shows, T. B., Le Beau, M. & Sukhatme, V. P. (1991) EGR3, a novel member of the Egr family of genes encoding immediate- early transcription factors, Oncogene 6, 917-928.

Piette, J., Kryszke, M.-H. & Yaniv, M. (1985) Specific interaction of cellular factors with the B enhancer of polyoma virus, EMBO J. 4,2675-2685.

Popovici, T., Benvald-Netter, Y., Vibert, M., Kahn, A. & Skala, H. (1990) Localization of aldolase C mRNA in brain cells, FEBS Lett. 1, 189-193.

Raymondjean, M., Cereghini, S. & Yaniv, M. (1988) Several distinct ‘CCAAT’ box binding proteins coexist in eukaryotic cells, Proc. Nut1 Acad. Sci. USA 85, 757-761.

Sauerwald, A,, Hoesche, C., Oschwald, R. & Kilimann, M. W. (1990) The 5’-flanking region of the synapsin I gene, J. Biol. Chem. 265,14932-14937.

Sehgal, A,, Patil, N. & Chao, M. (1988) A constitutive promoter directs expression of the nerve growth factor receptor gene, Mol. Cell. Biol. 8, 3160-3167.

Sham, M. H., Vesque, C., Nonchev, S., Marshall, H., Frain, M., Das Gupta, R., Whiting, J., Wilkinson, D., Charnay, P. & Krumlauf, R. (1993) The Zinc finger gene Krox20 regulates HoxB2 (Hox2.8) during hindbrain segmentation, Cell 72, 183-196.

Skala, H., Vibert, M., Lamas, E., Maire, P., Schweighoffer, F. & Kahn, A. (1987) Molecular cloning and expression of rat aldolase C messenger RNA during development and hepatocarcino- genesis, EUK J. Biochem. 163, 513-518.

Somma, M. P., Gambino, I. & Lavia, P. (1991) Transcription factors binding to the mouse HTF9 housekeeping promoter differ between cell types, Nucleic Acids Res. 19, 4451 -4458.

Takashi, M., Haimoto, H., Koshikawa, T. & Kato, K. (1990) Expres- sion of aldolase C isozyme in renal cell carcinoma, Am. J. Clin. Pathol. 93, 631 -636.

Tremp, G. L., Boquet, D., Ripoche, M. A., Cognet, M., Lone, Y. C., Jami, J., Kahn, A. & Daegelen, D. (1991) Expression of the rat L-type pyruvate kinase gene from its dual erythroid- and liver- specific promoter in transgenic mice, J. Biol. Chem. 264,

Vibert, M., Henry, J., Kahn, A. & Skala, H. (1989) The brain-specific gene for rat aldolase C possesses an unusual housekeeping- type promoter, Eur: J . Biochem. 181, 33-39.

Vidal, M., Morris, R., Grosveld, F. & Spanopoulou, E. (1990) Tis- sue-specific control elements of the Thy-1 gene, EMBO J. 9, 833-840.

Wood, T. G., McGeady, M. L., Baroudy, B. M., Blair, D. G. & Vande Woude, G. F. (1984) Mouse c-mos oncogene activation is prevented by upstream sequences, Proc. Natl Acad. Sci. USA 81,

174, 1035-1042.

19904-19910.

7817-7821.

region within the 5’-flanking region of the human aldolase C gene, Eur: J. Biochem. 192, 805-811.

Cereghini, S., Raymondjean, M., Carranca, A. G., Herbomel, P. & Yaniv, M. (1987) Factors involved in control of tissue-specific expresion of albumin gene, Cell 50, 627-638.

Chavrier, P., Vesque, C., Galliot, B., Vigneron, M., DollC, P., Du- boule, D. & Charnay P. (1990) The segment-specific gene Krox- 20 encodes a transcription factor with binding sites in the promoter region of the Hox-1.4 gene, EMBO J. 9, 1209-1218.

Ching, G. Y. & Liem, K. H. (1991) Structure of the gene for the neuronal intermediate filament protein a-internexin and functional analysis of its promoter, J. Biol. Chem. 266, 19459- 19468.

Cognet, M., Bergot, M.-0. & Kahn, A. (1991) cis-acting DNA elements regulating expression of the liver pyruvate kinase gene in hepatocytes and hepatoma cells, J. Bid. Chem. 266,7368-7365.

Crosby, S. D., Puetz, J. J., Simburger. K. S., Fahrner, T. J. & Mil- brandt, J. (1991) The early response gene NGFI-C encodes a zinc finger transcriptional activator and is a member of the GCGGGGGCG (GSG) element-binding protein family, Mol. Cell. Biol. 11, 3835-3841.

Cuif, M.-H., Cognet, M., Boquet, D., Tremp, G., Kahn, A. & Vau- lont, S. (1992) Elements responsible for hormonal control and tissue specificity of L-type pyruvate kinase expression in transgenic mice, Mot. Cell. Biol. 12, 4852-4861.

De Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R. & Subra- mani, S. (1987) Firefly luciferase gene: structure and expression in mamalian cells, Mol. Cell. Biol. 7, 725-737.

Farnham, P. J. & Means, A. L. (1990) Sequences downstream of the transcription initiation site modulate the activity of the murine dihydrofolate reductase promoter, Mol. Cell. Biol. 10, 1390- 1398.

Forss-Petter, S., Danielson, P. E., Catsicas, S., Battenbeerg, E., Price, J., Nerenberg, E. & Sutcliffe, G. (1990) Transgenic mice expressing P-galactosidase in mature neuron-specific enolase promoter control, Neuron 5, 187-197.

Gidoni, D., Kadonaga, J. T., Barrera-Saldana, H., Takahashi, K., Chambon, P. & Tjian, R. (1985) Bidirectional SV40 transcription mediated by tandem Spl binding interactions, Science 203,511 - 517.

Gorman, C., Moffat, L. &Howard, B. (1982) Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells, Mol. Cell. Biol. 2, 1044-1051.

Gorski, K., Carneiro, M. & Schibler, U. (1986) Tissue-specific in vitro transcription from the mouse albumin promoter, Cell 47, 767 - 776.

Green, S. H. & Tischler, A. S. (1976) Establishment of a noadrener- gic clonal line ot rat adrenal pheochromocytoma cells which re- spond to nerve growth factor, Proc. Natl Acud. Sci. USA 73, 2424 -2428.

Hagen, G., Muller, S., Beato, M. & Suske, G. (1992) Cloning by recognition site screening of two novel GT box binding proteins: a family of Spl related genes, Nucleic Acids Res. 20, 5519- 5525.

Hirsch, M.-R., Gaugler, L., Deagostini-Bazin, H., Bally-Cuif, L. & Goridis, C. (1 990) Identification of positive and negative regulatory elements governing cell-type-specific expression of the neural cell adhesion molecule gene, Mol. Cell. Biol. 10, 1959-1968.

Imataka, H., Sogawa, K., Yasumoto, K.-I., Kikuchi, Y., Sasano, K., Kobayashi, A., Hayami, M. & Fujii-Kuriyama, Y. (1992) Two regulatory proteins that bind to the basic transcription element (BTE), a GC box sequence in the promoter region of the rat P- 4501Al gene, EMBO J . 11, 3663-3671.

Kingsley, C. & Winoto, A. (1992) Cloning of GT box-binding proteins: a novel Spl multigene family regulating T-cell receptor gene expression, Mol. Cell. Biol. 12, 4251 -4261.

Lewis, S. A. & Cowan, N. J. (1986) Analogous placement of introns in a member of the intermediate multigene family: an evolution- ary conundrum, Mol. Cell. Biol. 6 , 1529-1534.

determinants of the brain-specific expression of the rat aldolase c gene: ex vivo and in vivo...

Documents