Determining the Epitope Dominance on the Capsid of a SerotypeSAT2 Foot-and-Mouth Disease Virus by Mutational Analyses

Pamela A. Opperman,a,b Lia S. Rotherham,a Jan Esterhuysen,a Bryan Charleston,c Nicholas Juleff,c Alejandra V. Capozzo,d

Jacques Theron,b Francois F. Mareea,b

Onderstepoort Veterinary Institute, Transboundary Animal Diseases Programme, Onderstepoort, South Africaa; Department of Microbiology and Plant Pathology,University of Pretoria, Pretoria, South Africab; The Pirbright Institute, Woking, United Kingdomc; INTA, Instituto de Virología, Centro de Investigaciones en CienciasVeterinarias y Agronómicas, Buenos Aires, Argentinad

ABSTRACT

Monoclonal-antibody (MAb)-resistant mutants were used to map antigenic sites on foot-and-mouth disease virus (FMDV),which resulted in the identification of neutralizing epitopes in the flexible �G-�H loop in VP1. For FMDV SAT2 viruses, studieshave shown that at least two antigenic sites exist. By use of an infectious SAT2 cDNA clone, 10 structurally exposed and highlyvariable loops were identified as putative antigenic sites on the VP1, VP2, and VP3 capsid proteins of SAT2/Zimbabwe (ZIM)/7/83 (topotype II) and replaced with the corresponding regions of SAT2/Kruger National Park (KNP)/19/89 (topotype I). Virusneutralization assays using convalescent-phase antisera raised against the parental virus, SAT2/ZIM/7/83, indicated that the mu-tant virus containing the TQQS-to-ETPV mutation in the N-terminal part of the �G-�H loop of VP1 showed not only a signifi-cant increase in the neutralization titer but also an increase in the index of avidity to the convalescent-phase antisera. Further-more, antigenic profiling of the epitope-replaced and parental viruses with nonneutralizing SAT2-specific MAbs led to theidentification of two nonneutralizing antigenic regions. Both regions were mapped to incorporate residues 71 to 72 of VP2 as themajor contact point. The binding footprint of one of the antigenic regions encompasses residues 71 to 72 and 133 to 134 of VP2and residues 48 to 50 of VP1, and the second antigenic region encompasses residues 71 to 72 and 133 to 134 of VP2 and residues84 to 86 and 109 to 11 of VP1. This is the first time that antigenic regions encompassing residues 71 to 72 of VP2 have been iden-tified on the capsid of a SAT2 FMDV.

IMPORTANCE

Monoclonal-antibody-resistant mutants have traditionally been used to map antigenic sites on foot-and-mouth disease virus(FMDV). However, for SAT2-type viruses, which are responsible for most of the FMD outbreaks in Africa and are the most var-ied of all seven serotypes, only two antigenic sites have been identified. We have followed a unique approach using an infectiousSAT2 cDNA genome-length clone. Ten structurally surface-exposed, highly varied loops were identified as putative antigenicsites on the VP1, VP2, and VP3 capsid proteins of the SAT2/ZIM/7/83 virus. These regions were replaced with the correspondingregions of an antigenically disparate virus, SAT2/KNP/19/89. Antigenic profiling of the epitope-replaced and parental viruseswith SAT2-specific MAbs led to the identification of two unique antibody-binding footprints on the SAT2 capsid. In this report,evidence for the structural engineering of antigenic sites of a SAT2 capsid to broaden cross-reactivity with antisera is provided.

Genetically modified viruses provide a valuable tool for themanipulation of the biological properties of field and labora-

tory strains and present a promising avenue for the design of safeand effective vaccines. The modification of antigenic regions ofhuman immunodeficiency virus (HIV) by amino acid (aa) substi-tutions in a recombinant virus has been used to confirm mono-clonal antibody (MAb)-binding sites and the antigenic domi-nance of these epitopes (1). Similarly, in recent years, epitopemapping for human viruses has been performed using humanrecombinant antibodies; for example, two neutralizing antibodieswere used to map epitopes on the influenza A H5N1 virus (2). Inthis study, we utilized epitope replacement in a recombinant virusto determine the epitope dominance of an important pathogen inanimals, foot-and-mouth disease virus (FMDV). FMDV, the pro-totype member of the genus Aphthovirus in the family Picornaviri-dae, is a small, nonenveloped, icosahedral virus with a single-stranded, positive-sense RNA genome. The virus capsid iscomposed of 60 copies each of four virus-encoded structuralproteins, VP1 to VP4; the capsid outer shell is comprised ofVP1, VP2, and VP3, while VP4 lines the interior surface (3, 4).

Although FMDV causes a clinically indistinguishable vesiculardisease in cloven-hoofed animals, there are seven distinct sero-types and multiple antigenic types (5, 6). Control of FMD hasbeen reliant on large-scale vaccinations with inactivatedwhole-virus vaccines (7). However, the extensive antigenic di-versity within the FMDV serotypes impedes the efficacy of vac-cines; therefore, the strain composition of FMD vaccines mustbe selected with caution (8, 9).

Due to the strong link reported between the protection of cattleagainst FMDV and the levels of virus-neutralizing antibodies pro-duced following vaccination (10), it has generally been accepted

Received 26 February 2014 Accepted 5 May 2014

Published ahead of print 14 May 2014

Editor: D. S. Lyles

Address correspondence to Francois F. Maree, MareeF@arc.agric.za.

Copyright © 2014, American Society for Microbiology. All Rights Reserved.

doi:10.1128/JVI.00470-14

August 2014 Volume 88 Number 15 Journal of Virology p. 8307– 8318 jvi.asm.org 8307

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

that antibodies represent the major protective arm of the immuneresponse (11, 12). The majority of FMDV-neutralizing antibodiesare directed against epitopes located in the three surface-exposedcapsid proteins of the virus (4, 13). The mechanism by whichantibodies protect against FMDV in vivo is poorly understood;however, previous studies have indicated that escape from neu-tralizing antibodies may contribute to viral persistence and diseaseprogression (14).

MAbs have been used extensively to identify several antigenicsites on the structural proteins of virions belonging to serotypes A(15–17), O (13, 18), C (19), and Asia-1 (20). Not surprisingly,these antigenic sites were located on structural protrusions on thevirus surface, formed mainly by the loops connecting �-barrelstructures of the three outer capsid proteins. In particular, the�G-�H loop of VP1 has been identified as immunodominant bythe use of peptides (21, 22) and is found in all serotypes of FMDV(4, 13, 23). Sequencing of MAb-resistant (MAR) mutants andmapping of the topography of the mutations on the X-ray crystal-lographic structure of O/BFS/18/60 (O1BFS) (4) resolved five neu-tralizing antigenic sites on the capsid of serotype O FMDV (13,18). The �G-�H loop functions either independently (site 5; res-idue 149 of VP1 [18]) or as a discontinuous epitope that encom-passes the highly exposed C terminus (Ct) of VP1, particularlyresidues 200 to 213. This neutralizing antigenic site has been des-ignated site 1 and has been mapped to critical residues at positions144, 148, 154, and 208. Site 2 involves several amino acids in the�B-�C and �E-�F loops of VP2, spanning residues 70 to 73, 75, 77(2a), and 131 (2b). Site 3 includes residues 43 to 45 and 48, insidethe �B-�C loop of VP1, while site 4 maps within the �B “knob” ofVP3, with crucial residues at positions 56 and 58 to 59 (13, 19, 24).

In the case of SAT2 serotype viruses, studies involving MARmutants revealed at least two antigenic sites. The antigenic sitelocated in the �G-�H loop of VP1, downstream of the RGD motif,at residues 147, 148, 156, and 158 (25), residue 154 (23), andresidue 159 (26) is analogous to site 1 of serotype O1BFS (13).Residue 79 of VP2 may also play a role in forming this antigenicsite; however, the role of residue 79 in site 1 remains unclear (23).The second identified antigenic site involves residue 210 at the Cterminus of VP1. In addition, the importance of each of theseindividual neutralizing antigenic sites in SAT2 viruses is still un-defined.

In this study, the role of known and predicted epitopes in theantigenicity of SAT2 viruses was investigated. Residues located in10 of the structurally exposed loops of VP1, VP2, and VP3 wereselected and mutated, and the effect of these mutations on antige-nicity was measured with virus neutralization (VN) and antibodyavidity assays and profiled using SAT2-specific MAbs. We presentevidence of epitope dominance within the SAT2 serotype andidentify two new epitopes in VP2 for SAT2 viruses. Furthermore,the results revealed the effect of the different surface-exposed mu-tated residues on the interaction with antibodies in sera from con-valescent animals.

MATERIALS AND METHODSCell lines, viruses, plasmids, and bacterial strains. Baby hamster kid-ney-21 cells (BHK-21, ATCC CCL-10) were maintained and propagatedin Eagle’s basal medium (BME; Life Technologies) as described previously(27). The SAT2 FMDV vaccine strain Zimbabwe (ZIM)/7/83 (passagehistory, once in bovine cells and eight times in BHK cells [B1BHK8]) is abovine virus, originating from an outbreak in western Zimbabwe

during 1983 (28). The SAT2 virus Kruger National Park (KNP)/19/89(PK1RS2BHK4; PK indicates pig kidney cells, and RS indicates InstitutoBiologico Renal Suino cells [IB-RS-2 is a pig kidney cell line]) is a buffalovirus, originating from the KNP in South Africa during 1989. The plasmidpSAT2, a previously described genome-length infectious cDNA clone ofSAT2/ZIM/7/83 (28), was used as the genetic backbone in the construc-tion of recombinant cDNA clones harboring mutated epitopes. The virusrecovered from pSAT2 is referred to as vSAT2. Escherichia coli MAX Effi-ciency DH5� [genotype, F�80dlacZ�M15 �(lacZYA-argF)U169 deoRrecA1 endA1 hsdR17 (rk

� mk�) phoA supE44 �� thi-1 gyrA96 relA1], ob-

tained from Life Technologies, was used as the transformation host incloning experiments.

MAb isolation. Monoclonal antibodies (MAbs) were prepared by in-oculating BALB/c mice with a blend of inactivated and purified 146Sparticles of SAT1/Kenya (KEN)/11/2005, SAT/2/ZIM/5/81, and SAT3/ZIM/4/81. The antigen blend comprised 40 g of each antigen. Threedoses of the antigen blend in TiterMax Gold adjuvant (Sigma-Aldrich)were administered subcutaneously 3 weeks apart, and a final dose of an-tigen blend in phosphate-buffered saline (1 PBS) was administered in-travenously 7 days before spleen cells were harvested for fusion with mu-rine myeloma SP2/O cells. Cell fusion and cloning of positive hybridomaswere performed according to procedures standardized at The PirbrightInstitute (29). MAbs were screened by enzyme-linked immunosorbentassay (ELISA) for their reactivity against homologous virus, and fiveSAT2/ZIM/5/81-specific MAbs were selected (mouse IgG1 isotype MAbs1D5 [14 g/ml], DA10 [8 g/ml], GE11 [19 g/ml], GD12 [15 g/ml],GG1 [22 g/ml]).

Epitope prediction. The epitopes mutated in this study were pre-dicted as described previously (30). Briefly, potential regions of antigenic-ity were identified based on the identification of hypervariable regions,defined as having more than 60% variable residues within a 10-amino-acid region, and positions of high entropy, i.e., the uncertainty at eachamino acid position (31), within the deduced outer capsid protein se-quence of SAT2 viruses. Previous studies indicated that linear amino acidsequences with high variability or residue positions with high entropywhich are structurally exposed when mapped to modeled structures of thecapsid proteins have the potential to be involved in the antigenicity of thevirus (30). The regions selected for mutation in this study were residues 71to 72 and 133 to 134 of VP2, residues 133 to 134 of VP3, and residues 48 to50, 84 to 86, 109 to 111, 137 to 140, 157 to 160, 169 to 171, and 199 to 201of VP1.

Structural modeling. A homology model of the SAT2 capsid proteinswas built using Modeler 9v3 (32) with O1BFS coordinates (Protein DataBank accession no. 1FOD) as the template (33). Alignments were per-formed with ClustalX, and modeling scripts were generated with thestructural module of FunGIMS (30). Structures were visualized and thesurface-exposed residues identified with PyMOL v1.1rc2pre (DeLano Sci-entific LLC).

Site-directed mutagenesis, subcloning, and DNA sequencing. Site-directed mutagenesis of 10 known and putative epitopes located in theVP1, VP2, and VP3 capsid proteins of SAT2/KNP/19/89 (GenBank acces-sion number DQ009735) was used to replace the corresponding epitopesof the genetically disparate virus SAT2/ZIM/7/83 (GenBank accessionnumber DQ009726) using the infectious SAT2 genome-length clone.Overlap extension PCR mutagenesis was used to introduce the mutationsinto the pSAT2 plasmid. Briefly, each of the PCR processes involved theuse of four oligonucleotides (two inner mutagenic oligonucleotides andtwo genome-specific oligonucleotides) and three different PCRs (34). Adescription of the different oligonucleotides is provided in Table 1.

Mutations were introduced into distinct PCR products using overlap-ping inner mutagenic oligonucleotides. Using pSAT2 as the templateDNA, a “left” PCR was performed by using a common forward outeroligonucleotide (P622) and an antisense inner mutagenic oligonucleo-tide, whereas the “right” PCR was performed with a sense inner muta-genic oligonucleotide and a common outer reverse oligonucleotide

Opperman et al.

8308 jvi.asm.org Journal of Virology

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

(cDNA-2A). The two PCRs were performed with the TaKaRa Ex Taq PCRsystem and the following cycling conditions: 95°C for 20 s, 58°C for 20 s,and 68°C for 2 min (30 cycles). The two first-round PCR amplicons werepurified from an agarose gel with the NucleoSpin extraction kit (Mach-erey-Nagel) according to the manufacturer’s instructions and mixed inequimolar amounts, and the PCR was extended for 8 cycles of 95°C for 20s and 74°C for 5 min using the Advantage 2 PCR system (Clontech). Theproduct was then used as the template for PCR by employing the senseand antisense outer oligonucleotides detailed above. The cycling condi-tions for this third PCR were 95°C for 20 s and 68°C for 3 min (25 cycles).

The agarose gel-purified PCR amplicons of ca. 2.2 kb (containing partof the VP2, VP3, and VP1-2A coding region of SAT2/ZIM/7/83 with thenewly introduced mutations) were digested with SspI and XmaI and then

cloned into the unique SspI and XmaI restriction sites of the pSAT2 plas-mid. Replacement of the SAT2/ZIM/7/83 epitopes with those of SAT2/KNP/19/89 was verified by nucleotide sequencing using genome-specificoligonucleotides and the ABI Prism BigDye Terminator cycle sequencingready reaction kit (v3.0; Applied Biosystems). The extension productswere resolved on an ABI Prism 3100 genetic analyzer (Applied Biosys-tems). No unintended site mutations were found, and the epitope-re-placed mutant clones are indicated in Table 2.

In vitro RNA synthesis, transfection, and virus recovery. The con-structed epitope-replaced mutant cDNA clones and pSAT2 were linear-ized at the SwaI site downstream of the poly(A) tract and used as templatesto synthesize RNA in vitro with the MEGAscript T7 kit (Ambion) accord-ing to the manufacturer’s instructions. RNA transcripts (3 g) were in-

TABLE 1 Synthetic oligonucleotides used for introducing SAT2/KNP/19/89 antigenic regions into the genome-length cDNA clone ofSAT2/ZIM/7/83

Mutationa oroligonucleotideb Oligonucleotide sequence (5= to 3=)

Orientation(purpose)

Epitope-replacedDNA clonec

Recoveredvirusc

MutationsVP2-site2a F GCTTTTTGATTGGACACCTGAAAAACCATTTGGCACGCTGTATG Sense pKNPS2aSAT2 vKNPS2aSAT2VP2-site2a R CATACAGCGTGCCAAATGGTTTTTCAGGTGTCCATCAAAAAGC AntisenseVP2-site2b F GTGCCGGAGCTGTGCTCGCTTCGGAACAGAGAGGAGTTTCAAC Sense pKNPS2bSAT2 vKNPS2bSAT2VP2-site2b R GTTGAAACTCCTCTCTGTTCCGAAGCGAGCACAGCTCCGGCAC AntisenseVP3-site4 F CACCAGGCATTGAGACTGAAAAGCTGCCCAAGACACCCGAGG Sense pKNPS4SAT2 NRVP3-site4 R CCTCGGGTGTCTTGGGCAGCTTTTCAGTCTCAATGCCTGGTG AntisenseVP1-site1 F CAAAGTACGCCAACATCAAACACACGCTCCCGTCTACCTTC Sense pKNPS1SAT2 vKNPS1SAT2VP1-site1 R GAAGGTAGACGGGAGCGTGTGTTTGATGTTGGCTACTTTG AntisenseVP1-site3 F GTTCTGACAAATAGAACCACCTTCAACGTTGACTTGATGGACAA Sense pKNPS3SAT2 vKNPS3SAT2VP1-site3 R GGTGTCCATCAAGTCAACGTTGAAGGTGGTTCTATTTGTCAGAAC AntisenseVP1-site5 F CAACGGTGAGTGCAAGTACGAGACGCCCGTCACTGCCATTCGCGGTGAC Sense pKNPS5SAT2 vKNPS5SAT2VP1-site5 R GTCACCGCGAATGGCAGTGACGGGCGTCTCGTACTTGCACTCACCGTTG AntisenseVP1-DHR F TTGCCTGCCTTGGCGACCACCGGCGCGTGTGGTGGCAGCC Sense pKNPDHRSAT2 vKNPDHRSAT2VP1-DHR R GGCTGCCACCACACGCGCCGGTGGTCGCCAAGGCAGGCAA AntisenseVP1-NKG F CAACCCCATGGTGTTTTCGAACAAAGGTGTCACGCGTTTTGCTG Sense pKNPNKGSAT2 vKNPNKGSAT2VP1-NKG R CAGCAAAACGGTGACACCTTTGTTCGAAAACACCATGGGGTTG AntisenseVP1-NS F CCACGTGACCGCCGACAACAGCGTCGACGTTTACTACCGG Sense pKNPNSSAT2 NRVP1-NS R CCGGTAGTAAACGTCGACGCTGTTGTCGGCGGTCACGTGG AntisenseVP1-Cterm F CTCCTCCCTGGCTACGACTATGCAAGTAGGGACAGGTTTGACA Sense pKNPCtSAT2 vKNPCtSAT2VP1-Cterm R CTGTCAAACCTGTCCCTACTTGCATAGTCGTAGCCAGGGAGGAG Antisense

Genome-specific outeroligonucleotides

2B GACATGTCCTCCTGCATCTG Antisense (cDNA)cDNA-2a CGCCCCGGGGTTGGACTCAACGTCTCC Antisense (P1d PCR)P622 GCACTGACACCACGTCTAC Sense (P1 PCR)

a The structural region that was targeted for mutagenesis.b Names of the oligonucleotides used for cDNA synthesis and amplification of the capsid-coding region.c The mutated genome-length cDNA clone and recombinant virus names are derived from the KNP buffalo isolate SAT2/KNP/19/89, followed by the structural region that wasmutated (superscript) and the SAT2 genetic background of SAT2/ZIM/7/83. NR, no viable virus was recovered.d P1, polyprotein 1.

TABLE 2 Summary of the surface-exposed amino acid differences between the capsid proteins of FMDV SAT2/KNP/19/89 and SAT2/ZIM/7/83a

Virus(es)

Amino acids at indicated site in capsid protein �-sheetb

Site 2a inVP2�B-�C

Site 2b inVP2�E-�F

Site 4 inVP3�E-�F

Site 3 inVP1�B-�C

DHR site inVP1 �D-�E

NKG site inVP1 �F-�G

Site 5 inVP1�G-�H

Site 1 inVP1�G-�H

NS site inVP1�H-�I

Ct site inVP1 Cterminus

Parental SAT2/ZIM/7/83 TSDK LKDR TDRL TAFAV GEHER SHNNV YTQQST NTKHKL DKPV DHADRParental SAT2/KNP/19/89 TPEK LRDR TEKL TTFNV GDHRR SNKGV YETPVT NIKHTL DNSV DYASREpitope-replaced clones TPEK LRNR TEKL TTFNV GDHRR SNKGV YETPVT NIKHTL DNSV DYASRRecovered epitope-

replaced mutantsTPEK LRNR NR TTFNV GDHRR SNKGV YETPVT NIKHKLc NR DYASR

a The identified surface-exposed loops of SAT2/KNP/19/89 were used to replace the corresponding epitopes of the genetically disparate virus SAT2/ZIM/7/83 using the infectiousSAT2 genome-length clone pSAT2. The amino acid sequences of the epitope-replaced pKNPSAT2 clones, as well as those of the recovered viruses, are indicated. NR, no viable viruswas recovered from these epitope-replaced mutants.b The amino acid residues in SAT2/ZIM/7/83 that were mutated to the corresponding region in SAT2/KNP/19/89 are indicated in bold.c The mutated amino acid residue in site 1 that reverted back to the original SAT2/ZIM/7/83 sequence when the epitope-replaced virus was recovered in BHK-21 cells is underlinedand italic.

Epitope Dominance of FMDV SAT2

August 2014 Volume 88 Number 15 jvi.asm.org 8309

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

troduced into BHK-21 cells and seeded into 35-mm-diameter cell cultureplates (Nunc) using Lipofectamine 2000 reagent (Life Technologies) ac-cording to the manufacturer’s instructions. Transfected monolayers wereincubated at 37°C with a 5% CO2 influx for 48 h in Eagle’s basal medium(BME) containing 1% (vol/vol) fetal calf serum (FCS) and 25 mM HEPES(Invitrogen). The supernatants were used to infect fresh BHK-21 mono-layers and incubated at 37°C for 48 h. Viruses were subsequently harvestedfrom infected cells by a freeze-thaw cycle and passaged four or more timeson BHK-21 cells, using 10% of the supernatant of the previous passage.Viruses recovered from transfection included vSAT2, vKNPS1SAT2,vKNPS2aSAT2, vKNPS2bSAT2, vKNPS3SAT2, vKNPS5SAT2, vKNPDHR

-

SAT2, vKNPNKGSAT2, and vKNPCtSAT2 (where superscripts indicate thestructural regions that were mutated). Following the recovery of viableviruses, the external capsid region was obtained by reverse transcription(RT)-PCR, as described below, and the presence of the mutations wasverified with automated sequencing.

RNA isolation, cDNA synthesis, and PCR amplification. RNA wasextracted from infected tissue culture samples with a guanidinium-basednucleic acid extraction method (35) and used as the template for cDNAsynthesis. Avian myeloblastosis virus (AMV) reverse transcriptase (Pro-mega) and the genome-specific oligonucleotide 2B (36) were used forreverse transcription, which was carried out at 42°C for 2 h. The externalcapsid-coding region of the epitope-replaced mutant viruses was ampli-fied using the Expand high-fidelity PCR system (Roche Diagnostics) andflanking oligonucleotides, P622 and cDNA-2A (Table 1).

Plaque titrations. BHK-21 cell monolayers were infected for 1 h withthe parental viruses SAT2/ZIM/7/83 and SAT2/KNP/19/89, as well as withvSAT2 and the above-mentioned epitope-replaced mutant viruses. Fol-lowing the addition of 2 ml of tragacanth overlay (37) and incubation for48 h, the cell monolayers were stained with 1% (wt/vol) methylene blue.Virus titers were calculated and are expressed as the logarithm of thenumber of PFU/ml.

Neutralization of infectivity in cell culture. The antigenic diversity ofthe epitope-replaced mutant viruses in relation to the SAT2/ZIM/7/83and SAT2/KNP/19/89 viruses was determined with cross-neutralizationassays in microplates, as described in the OIE Manual of Standards (38).BHK-21 cells were used as the indicator system in the test. Convalescent-phase bovine reference sera were prepared by intradermolingual inocula-tion of cattle with 104 50% tissue culture infectious doses (TCID50) ofeither SAT2/ZIM/7/83 or SAT2/KNP/19/89. Two cattle were infected witheach virus strain, after which blood was collected at 21 days postinocula-tion and pooled. Cattle were housed in the biosafety level 3 isolationfacility at the Transboundary Animal Diseases Programme (TADP) withthe approval of the Onderstepoort Veterinary Institute (OVI) AnimalEthics Committee. The endpoint titer of the serum against the homolo-gous and heterologous viruses was calculated as the log10 of the reciprocalof the last dilution of serum to neutralize 100 TCID50 in 50% of the wells(39). Differences in the average neutralization titers between each of theepitope-replaced mutant viruses and the reference viruses across four in-dependent experiments were calculated.

To determine whether the five SAT2-specific MAbs (1D5, DA10,GE11, GD12, and GG1) were able to neutralize the parental SAT2/ZIM/7/83 and SAT2/KNP/19/89 viruses, as well as the epitope-replaced mutantviruses, cross-neutralization assays were performed using BHK-21 cellcultures as described above. A minor modification to the protocol de-scribed above was that the sera were replaced with the SAT2-specificMAbs.

Virus purification. Confluent BHK-21 cell monolayers (eight 750-cm2 plastic roller bottles; Corning) were infected at a multiplicity of in-fection (MOI) of 1 with SAT2/ZIM/7/83, vKNPS5SAT2, vKNPDHRSAT2,and vKNPNKGSAT2 in BME containing 1 antibiotic-antimycotic solu-tion and 25 mM HEPES buffer. Following incubation for 12 to 16 h at37°C, the cells in each roller bottle were lysed by addition of 10% (vol/vol)Triton X-100 and 0.5 M EDTA (pH �7.4). The supernatants were pooledand subjected to centrifugation at 9,800 g for 30 min. The 146S virus

particles were precipitated from the recovered supernatant with 8% (wt/vol) polyethylene glycol 8000 (PEG 8000) at 4°C for 3 h, collected bycentrifugation, and suspended in TNE buffer (50 mM Tris [pH 7.5], 150mM NaCl, 10 mM EDTA). An additional clarification step was performedby addition of 0.5 M EDTA and centrifugation at 9,800 g for 30 min.The virus particles were purified on a 10 to 50% (wt/vol) sucrose densitygradient (SDG), prepared in TNE buffer, as described previously (40).Peak fractions corresponding to 146S virion particles (extinction coeffi-cient at 259 nm [E259] at 1% � 78.8 M�1 cm�1) were pooled, and theamount of antigen (g) was calculated (41).

Sandwich ELISA. A sandwich ELISA was used for titration of the fiveSAT2-specific MAbs and to characterize the parental and eight epitope-replaced mutant viruses. MaxiSorp ELISA plates (Nunc) were coated withan optimal dilution of rabbit SAT2 antiserum in 50 mM carbonate-bicar-bonate buffer (pH 9.6) and stored at 4°C overnight. A serial 2-fold dilu-tion (1:5 to 1:40) of the parental or epitope-replaced viruses (supernatantof infected cells) in blocking buffer (0.05 M Tris, 0.15 M KCl containing0.5% [wt/vol] milk powder) was applied to the ELISA plates. Viruses weretrapped by incubation at 37°C for 1 h, after which the plates were washedwith PBS containing 0.05% (vol/vol) Tween 20 (PBS-0.05%T). Twofolddilutions (1:20 to 1:80) of each of the MAbs, prepared in blocking buffer,were added and the plates incubated at 37°C for 1 h. The ELISA plates werewashed with PBS-0.05%T, and horseradish peroxidase (HRP)-conju-gated rabbit anti-mouse IgG (Sigma-Aldrich), diluted 1:20,000 in block-ing buffer, was added. Following incubation at 37°C for 1 h and washing ofthe plates, the ELISA plates were developed using substrate-chromogensolution, consisting of 4 mM 3,3=,5,5=-tetramethylbenzidine (Sigma-Al-drich) in substrate buffer (0.1 M citric acid monohydrate, 0.1 M, tri-potassium citrate; pH 4.5) and 0.015% (vol/vol) H2O2. The color reactionwas stopped after 10 min with 1 M H2SO4, and the absorbance values wereread at 450 nm using a Labsystems Multiskan Plus photometer (38).

The binding of the MAbs to the epitope-replaced viruses was calcu-lated as follows. The mean absorbance reading at 450 nm (A450) for thebinding of each MAb to the epitope-replaced viruses were corrected bysubtracting the background value. The adjusted A450 values for each MAbto the epitope-replaced viruses were then expressed as percentages of themean A450 value obtained against vSAT2.

Additionally, to distinguish between SAT2/ZIM/7/83 12S and 146Svirus particles, a sandwich ELISA was performed as described above, withminor modifications. Purified 146S particles were heat treated for 30 minat 56°C. Various concentrations (100 ng to 3 ng) of heat-treated anduntreated purified (representing 12S and 146S) particles were added, intriplicate, to ELISA plates coated with saturating concentrations of rabbitanti-SAT2 antiserum. The five SAT2/ZIM5/81-specific MAbs were addedto the plates at a 1:40 dilution, and the plates were developed as describedabove.

sd A-ELISA. The single-dilution avidity ELISA (sd A-ELISA) protocolwas adapted from the work of Lavoria et al. (43). Briefly, MaxiSorp ELISAplates were coated, in duplicate, overnight at 4°C with 200 ng of purifiedvirus in 50 mM carbonate-bicarbonate buffer (pH 9.6). The plates werewashed with PBS-0.05%T and blocked at 37°C for 1.5 h with blockingbuffer containing PBS, 20% (vol/vol) fetal calf serum (FCS), 0.002% (wt/vol) thimerosal, and 0.1% (wt/vol) phenol red. Following incubation, theplates were washed with wash solution (133 mM NaCl, 8.6 mM K2HPO4,1.5 mM KH2PO4, 0.05% [vol/vol] Tween 20 in distilled H2O). Serumsamples (SAT2/ZIM/7/83 and SAT2/KNP/19/89) were diluted 1:80 inblocking buffer and added to the plates. A pool of five negative sera wasused as a negative control. The plates were incubated at 37°C for 1 h andwashed three times with PBS-0.05%T, and then 4 M urea in PBS wasadded to one plate and PBS was added to the remaining plate. Followingincubation at room temperature for 15 min, the plates were washed fourtimes with wash solution before the FMDV-specific antibodies were de-tected with HRP-labeled antibovine conjugate (Sigma-Aldrich), diluted1:20,000 in blocking buffer. The colorimetric reaction was developed afterincubation at 37°C for 1 h and washing of the plates as described above.

Opperman et al.

8310 jvi.asm.org Journal of Virology

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

The mean A450s of samples and controls were corrected by subtracting themean of the blank absorbance readings at 450 nm (cA450). The avidityindex (AI) was calculated as previously described (41). Briefly, AI% �(cA450 of the sample with urea/cA450 of the sample without urea) 100.

Statistical analyses. Virus neutralization titers and avidity indexes ofepitope-replaced mutant viruses and the SAT2/ZIM/7/83 and SAT2/KNP/19/89 viruses with convalescent-phase bovine reference sera werecompared using repeated-measures analysis of variance (ANOVA) withBonferroni adjustment of P values for post hoc comparisons. All statisticalanalyses were performed using GraphPad Prism v5.03 for Windows(GraphPad Software, Inc.).

Ethics statement. All procedures involving animals were approved bythe Onderstepoort Veterinary Institute (OVI) Animal Ethics Committeeaccording to national animal welfare standards and performed with thepermission of the Department of Agriculture, Forestry and Fisheries(DAFF). For the production of the SAT2-specific MAbs, mice werehoused at The Pirbright Institute and the experiment was approvedthrough the Institute’s ethical review process, in accordance with nationalguidelines on animal use.

RESULTSPrediction of antigenic sites on the SAT2 FMD capsid. A com-bined approach of capsid protein amino acid sequence alignmentsand known structural data was used to predict antigenic sites onthe surfaces of SAT2 virions. A complete alignment of the deducedamino acid sequences of the capsid proteins of 23 SAT2 virusesacross Africa revealed amino acid regions of high variability (30,44) that corresponded to or were located in close proximity topreviously identified epitopes on type O and A viruses (see the

introduction for references). Many of the variable regions werelocated within flexible structural loops of the viral capsid and havebeen linked to poor cross-reaction in in vitro virus neutralizationtests (24, 36).

A systematic analysis of the capsid proteins of SAT2/KNP/19/89 (topotype I) and SAT2/ZIM/7/83 (topotype II) revealedthat the most variation, 18% (38 of 217 aa), occurred in the VP1protein, while the VP2 and VP3 proteins varied by ca. 4% (9 of 219aa and 8 of 222 aa, respectively). Comparison of the deducedamino acids and structurally exposed loops revealed that of thefour hypervariable regions previously identified in the VP2 region,only two, i.e., positions 71 to 72 (SD¡PE; �B-�C) and 133 to 134(KD¡RN; �E-�F) of VP2 (Table 2; Fig. 1), had significant surfaceexposure in the whole virion and were therefore chosen for thisstudy. Only one site of VP3 was variable, i.e., residues 133 to 134(DR¡EK; �E-�F), and seven sites with variable residues wereidentified in VP1 (Table 2; Fig. 1). These included residues 48 to 50(AFA¡TFN; corresponds to site 3 of serotype O), 84 to 86(EHE¡DHR; �E-�F), 109 to 111 (HNN¡NKG; �F-�G), 137 to140 (TQQS¡ETPV; �G-�H, corresponds to site 5 of serotype O),157 to 160 (TKHK¡IKHT; �G-�H, corresponds to site 1 of se-rotype O), 169 to 171 (KP¡NS; �H-�I), and 199 to 201(HAD¡YAS; C terminus of VP1) (Table 2; Fig. 1). Residues 144to 154 and 210 of VP1, all of which fall within previously identifiedSAT2 antigenic regions (23, 25, 26), were conserved betweenSAT2/ZIM/7/83 and SAT2/KNP/19/89.

FIG 1 Locations of the surface-exposed amino acid differences between the capsids of FMDV SAT2/KNP/19/89 and SAT2/ZIM/7/83 on a ribbon proteindiagram of a modeled pentamer of SAT2/ZIM/7/83 (28). The protein subunits and structural features are color coded for VP1 (cyan), VP2 (green), and VP3(magenta). VP4 has been hidden from the structure. The pore, located at the 5-fold axis of the capsid (black pentagon), is shown in the middle of the structure.The 3-fold axis is depicted by the black triangles. The positions of amino acid changes predicted to play a role in antigenicity are shown as yellow spheres. Theamino acid changes are those indicated in Table 2 for SAT2/KNP/19/89 and SAT2/ZIM/7/83.

Epitope Dominance of FMDV SAT2

August 2014 Volume 88 Number 15 jvi.asm.org 8311

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

Generation of recombinant viruses with altered surfaceepitopes. To study the effects of individual epitope-replaced mu-tations in a defined genetic background on the antigenic domi-nance of SAT2 viruses, recombinant virus mutants were con-structed using the infectious cDNA clone of the SAT2 virus ZIM/7/83, pSAT2 (Fig. 2). Of the 10 putative and known epitopes forSAT2 viruses selected from sequence and structure data, eightrepresented surface-exposed loops connecting �-� structures inthe three outer capsid proteins. However, two mutations,DR¡EK (residues 133 to 134 of VP3) and KP¡NS (residues 169to 171 of VP1), though they appear to have surface exposure, weresomewhat obscured by adjacent structural elements and were se-lected on the basis of sequence heterogeneity only. The location

and the electrostatic effects of these mutations on the virion sur-face are shown in Fig. 3. Introducing or removing the charge onthe capsid surface may completely abrogate ionic interaction be-tween antibodies and the capsid. Some of the substitutions causedan increase in the net positive charge in the VP1 protein of thederived recombinant virus (Fig. 3B and C). The EHE¡DHR (res-idues 84 to 86 of VP1) and HNN¡NKG (residues 109 to 111 ofVP1) mutations had a strong effect on the local surface potentialof the capsid, creating a distinct patch of surface area that waspredominantly positively charged. The TQQS¡ETPV (residues137 to 140 of VP1) mutation introduced a strong negative chargeat the N-terminal base of the �G-�H loop.

The engineered epitope-replaced mutant viruses, designated

FIG 2 Schematic representation of the epitope replacement strategy used to replace epitopic structures of SAT2/ZIM/7/83 with those of SAT2/KNP/19/89. The10 known and predicted epitopic structures located in the VP1, VP2, and VP3 capsid proteins of SAT2/KNP/19/89, as well as the corresponding epitopes of thegenetically disparate virus SAT2/ZIM/7/83, are indicated. Following overlap extension mutagenesis, as described in Materials and Methods, the epitope-mutatedP1 regions were cloned into the SspI and XmaI sites of pSAT2, a genome-length cDNA clone of SAT2/ZIM/7/83. C-term, C terminus; S-frag, S fragment; IRES,internal ribosome entry site; 3=UTR, 3= untranscribed region.

FIG 3 Surface models of the crystallographic protomers of SAT2/ZIM/7/83 and the epitope-replaced mutant virus vKNPSAT2, indicating differences inelectrostatic potential. (A) The mutations and their positions on the FMDV protomer are indicated. (B) Electrostatic potential of the SAT2/ZIM/7/83 protomer.(C) Electrostatic potential of the vKNPSAT2 protomer, containing all 10 mutations. Positively charged surfaces are shown in blue, and negatively charged surfacesare in red. The yellow ovals indicate areas of a change in the local electrostatic potential. The black pentagon and triangle show the 5- and 3-fold axes of the virion,respectively.

Opperman et al.

8312 jvi.asm.org Journal of Virology

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

vKNPS2aSAT2, vKNPS2bSAT2, vKNPS3SAT2, vKNPDHRSAT2,vKNPNKGSAT2, vKNPS5SAT2, vKNPS1SAT2, and vKNPCtSAT2,were readily obtained from the infectious cDNA clones. High-titerstocks were prepared and their genetic identities confirmed bysequencing analysis. Despite numerous attempts to recover viablevKNPS1SAT2, either the recovered viable virus corresponded tothe wild-type virus (i.e., SAT2/ZIM/7/83) or only the T156¡Imutation in VP1 was present (Table 2). The K159¡T mutationreverted back to SAT2/ZIM/7/83 K159 (Table 2). No viruses couldbe recovered for mutations at positions 133 to 134 of VP3(KNPS4SAT2) and 169 to 171 of VP1 (KNPNSSAT2), despitetransfection of a minimum of 20 sequence-correct clones of eachmutant.

Effect of the epitope-replaced mutations on plaque morphol-ogies and infectivity titers. The recombinant mutant viruses wereinitially characterized by determining whether the introducedmutations affect viral growth in BHK-21 cells. Plaque morpholo-gies for the eight viable epitope-replaced mutant viruses, as well asthe vSAT2, SAT2/ZIM/7/83, and SAT2/KNP/19/89 viruses, werecompared on BHK-21 cells (Table 3). The two VP2 epitope-re-placed viruses, namely, vKNPS2aSAT2 and vKNPS2bSAT2, the pa-rental viruses (SAT2/ZIM/7/83 and SAT2/KNP/19/89), and fourof the VP1 epitope-replaced viruses (vKNPS1SAT2, vKNPS5SAT2,vKNPCtSAT2, and vKNPDHRSAT2) all formed medium (3- to5-mm) and large (6- to 8-mm) plaques. The virus derived fromthe genome-length infectious cDNA clone of SAT2/ZIM/7/83,vSAT2, as well as vKNPS3SAT2 and vKNPNKGSAT2, formed small( 2-mm), medium (3- to 5-mm), and large (6- to 8-mm)plaques. Notably, vKNPS3SAT2 formed mostly small and mediumplaques, with only a few large plaques being observed.vKNPS3SAT2 and vKNPS1SAT2 displayed approximately 3-fold-higher infectivity titers (ca. 1.6 107 PFU/ml) than the SAT2/ZIM/7/83 parental virus, as opposed to most of the remainingepitope-replaced mutant viruses, all of which had infectivity titers(ranging from 3.2 106 to 7.4 104 PFU/ml) similar to that ofthe SAT2/ZIM/7/83 parental virus. vKNPS1SAT2 showed a 3- to4-fold-lower infectivity than the parental SAT2/ZIM/7/83 virus.The SAT2/KNP/19/89 parental virus had an infectivity titer of 1 108 PFU/ml. Taken together, the results show that the introducedmutations in the VP1 �B-�C loop (residues 48 to 50) and residues157 to 160 of the VP1 �G-�H loop increased the infectivity to

BHK-21 cells. This may, at least in part, be the functional basis ofadaptation to this cell line.

Antigenicities of the recombinant viruses with altered sur-face epitopes. The overall antigenic distance of the epitope-re-placed mutant and parental viruses were examined by virus neu-tralization assays using antisera raised from convalescent cattleagainst the parental viruses SAT2/ZIM/7/83 and SAT2/KNP/19/89. The neutralization titers of the eight epitope-replaced mutantviruses and the parental virus controls are shown in Fig. 4. Exceptwith one epitope-replaced mutant virus, no significant differences(P � 0.05) in the neutralization titers were observed betweenSAT2/ZIM/7/83 and any of the epitope-replaced mutants, whenmeasured against the SAT2/ZIM/7/83 and the SAT2/KNP/19/89sera. In contrast, the TQQS¡ETPV mutation in the N-terminalpart of the �G-�H loop of VP1 resulted in a significant increase(P 0.05) of 40% in the neutralization titer with the SAT2/ZIM/7/83 serum compared to that of parental SAT2/ZIM/7/83 (Fig. 4).

Next, we determined the avidity index of the convalescent-phase bovine reference sera (SAT2/ZIM/7/83 or SAT2/KNP/19/89) against the parental virus SAT2/ZIM/7/83 and threeepitope-replaced viruses, namely, the vKNPS5SAT2 mutant vi-rus (TQQS¡ETPV), vKNPDHRSAT2, and vKNPNKGSAT2.Higher neutralization titers were observed for these three viruses,and it was investigated whether these increased titers were a resultof increased avidity. The TQQS¡ETPV (site 5) mutation signifi-cantly increased (P 0.001) the avidity index of the vKNPS5SAT2virus to the SAT2/ZIM/7/83 serum (Fig. 5A). The avidity index ofthe vKNPDHRSAT2 and vKNPNKGSAT2 epitope-replaced mutantviruses to the SAT2/ZIM/7/83 serum was not significantly differ-ent from that obtained for the parental virus (Fig. 5A). Interest-ingly, the avidity index of vKNPS5SAT2 and vKNPDHRSAT2 to theSAT2/KNP/19/89 serum was significantly higher (P 0.001) thanthat of SAT2/ZIM/7/83 (Fig. 5B). No significant difference in the

TABLE 3 Parental and recombinant viruses containing the epitope-replaced mutations in the outer capsid proteins VP1 and VP2

VirusEpitopemutation

Infectivitytiter(log PFU/ml)

Passagehistory

Predominantplaque sizeson BHK-21cellsa

vSAT2 (wild type) 5.4 106 BHK4 S-M-LSAT2/ZIM/7/83 4.2 106 B1BHK8 M-LSAT2/KNP/19/89 1.0 108 PK1RS2BHK4 M-LvKNPS2aSAT2 SD¡PE 3.2 106 BHK4 M-LvKNPS2bSAT2 KD¡RN 3.4 106 BHK4 M-LvKNPS3SAT2 AFA¡TFN 1.5 107 BHK6 S-M-LvKNPS5SAT2 TQQS¡ETPV 1.2 106 BHK6 M-LvKNPS1SAT2 TKHK¡IKHK 1.6 107 BHK4 M-LvKNPDHRSAT2 EHE¡DHR 4.6 106 BHK4 M-LvKNPNKGSAT2 HNN¡NKG 4.4 106 BHK5 S-M-LvKNPCtSAT2 HAD¡YAS 7.4 106 BHK5 M-L

a Plaque sizes are defined as small (S) ( 2 mm), medium (M) ( 3 to 5 mm), and large(L) (6 to 8 mm).

FIG 4 Antigenic profiles of the epitope-replaced mutant viruses, as indicated,and SAT2/KNP/19/89, SAT2/ZIM/783, and vSAT2 tested against SAT2 anti-sera (KNP/19/89 and ZIM/7/83). Convalescent-phase cattle antisera were pre-pared at TADP by intradermolingual inoculation of cattle with 104 TCID50 ofSAT2/KNP/19/89 or SAT2/ZIM/7/83, and blood was collected at 21 days post-inoculation. Significant differences between the parental and the epitope-re-placed mutant viruses are indicated by the *. The data are means � standarddeviations (SD) of results from four independent experiments.

Epitope Dominance of FMDV SAT2

August 2014 Volume 88 Number 15 jvi.asm.org 8313

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

avidity indexes between the vKNPNKGSAT2 mutant (with theSAT2/KNP/19/89 serum) and the SAT2/ZIM/7/83 virus was ob-served (Fig. 5B).

Antigenic profiling of epitope-replaced and parental viruseswith SAT2-specific MAbs. The epitope-replaced viruses and theparental SAT2 viruses were characterized on the basis of theirreactivity to SAT2-specific MAbs. None of the MAbs were shownto neutralize the viruses in vitro, using virus neutralization assays.The binding profiles of the SAT2-specific MAbs were subse-quently examined using a sandwich ELISA (Fig. 6). All five of theMAbs reacted to SAT2/ZIM/7/83 and vSAT2. However, two dis-tinct clusters were observed with regard to the reactivities of theMAbs to SAT2/KNP/19/89 and the epitope-replaced mutant vi-ruses. MAbs 1D5, GG1, GE11, and DA10 reacted with vSAT2,SAT2/ZIM/7/83, vKNPS2bSAT2, vKNPDHRSAT2, vKNPNKGSAT2,vKNPS1SAT2, vKNPS3SAT2, vKNPS5SAT2, and vKNPCtSAT2 butnot with SAT2/KNP/19/89 or vKNPS2aSAT2. In the second clus-ter, MAb GD12 reacted with all eight epitope-replaced viruses aswell as vSAT2, SAT2/ZIM/7/83, and SAT2/KNP/19/89, albeit withdifferent binding reactivities. The MAb GD12 showed less than55% reactivity to vKNPS2aSAT2, vKNPS2bSAT2, vKNPDHRSAT2,vKNPNKGSAT2, and SAT2/KNP/19/89, compared to vSAT2 andSAT2/ZIM/7/83, in the ELISA (Fig. 6). Interestingly, GD12 wasthe only MAb that was able to distinguish between 146S and 12Sparticles, as was evidenced by a decrease in the absorbance readingfollowing heat treatment of the purified virus particles of SAT2/ZIM/7/83 (data not shown).

The four MAbs that did not react to SAT2/KNP/19/89 andvKNPS2aSAT2 could be divided into two principal binding sub-clusters (Fig. 6). One subcluster, consisting of MAbs GG1 andDA10, recognized vSAT2, SAT2/ZIM/7/83, and seven epitope-replaced viruses (vKNPS2bSAT2, vKNPDHRSAT2, vKNPNKGSAT2,vKNPS1SAT2, vKNPS3SAT2, vKNPS5SAT2, and vKNPCtSAT2)with the same binding reactivity as in the ELISA. The second bind-ing subcluster, consisting of MAbs 1D5 and GE11, reacted poorlywith vKNPS2bSAT2 and vKNPS3SAT2, i.e., exhibiting less than55% reactivity.

DISCUSSION

Little is known about the neutralizing epitopes for the three SATserotype viruses. In this study, the role of structurally exposedloops on a SAT2 capsid in the antigenicity of the virus was inves-tigated. Following an epitope replacement strategy, we measuredthe antigenic diversity of eight epitope-replaced viruses with poly-clonal antisera raised against SAT2/ZIM/7/83, used as the genetic

FIG 5 Avidity indexes of the parental SAT2/ZIM/7/83 virus and three epitope-replaced mutant viruses. The avidity index of the parental virus, SAT2/ZIM/7/83,and those of the epitope-replaced mutant viruses vKNPS5SAT2, vKNPDHRSAT2, and vKNPNKGSAT2 with the SAT2/ZIM/7/83 serum (A) and the SAT2/KNP/19/89 serum (B) are indicated. The avidity indexes of the three epitope-replaced mutant viruses were compared to that of the parental SAT2/ZIM/7/83 virus.Significant differences are indicated by ***. The data are means � SD of results from duplicate experiments.

FIG 6 Reactivities of the epitope-replaced mutant viruses and parental viruseswith SAT2-specific MAbs. A sandwich ELISA was performed using a 1:10dilution of the indicated viruses and a 1:40 dilution of the MAbs. The ELISAwas performed in duplicate, and the results of one experiment are shown, asthe same trend was observed for both ELISAs. The reactivity scales in relationto the interaction of the MAbs to the epitope-replaced mutant viruses are asfollows: white boxes, 0 to 15%; half-black boxes, 15 to 55%; and black boxes, 55to 100%.

Opperman et al.

8314 jvi.asm.org Journal of Virology

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

background, and SAT2/KNP/19/89, used as the epitope donor.One of these replacements significantly increased not only theneutralization titer but also the avidity index to the SAT2/ZIM/7/83 serum compared to those of the parental SAT2/ZIM/7/83virus. Furthermore, antigenic profiling of the epitope-replacedand parental viruses with SAT2-specific MAbs identified twonovel nonneutralizing epitopes, both encompassing residues 71 to72 of VP2. Noteworthy, residues 71 to 72 of VP2 are variable in analignment of SAT2 viruses. The first antigenic region includes, inaddition to residues 71 to 72 of VP2, residues 133 to 134 of VP2and 48 to 50 of VP1, while the second region includes residues 133to 134 of VP2 as well as residues 84 to 86 and 109 to 111 of VP1.

A commonly used method to assess the antigenic matching ofFMDV within a serotype is the comparison of VN titers. However,the role of the surface-exposed loops of the FMDV outer capsidproteins on antigenicity and their interaction with antibodies withdifferent affinities and avidities are still obscure. The results re-ported here suggest that critical residues located in surface-ex-posed loops contribute significantly to the stability of antigen-antibody complexes and blocking of virus entry into cells, eitherby direct contact with the antibody or indirect contact by localdistortion of side chains. It has been shown that the affinity ofantigen-antibody complexes could be strongly reduced by muta-tions of specific side chains within the in-contact epitope (45, 46).

Each of the modified viruses used in this study had two to fourcritical, variable residues located on structurally exposed loops ofthe outer capsid proteins changed from the SAT2/ZIM/7/83 se-quence to the SAT2/KNP/19/89 sequence. By making use of thisstrategy, it was expected that the corresponding epitopes withinSAT2/ZIM/7/83 would be modified, thus abrogating antibody in-teraction. Studies have indicated both in FMDV (47) and in po-liovirus (48) that mutations within antigenic sites completely ab-rogate binding with relevant virus-specific antibodies. Thus,antibodies produced against an intact or naive epitope will notrecognize the mutated epitope. Crowther et al. (18) reported thata 15% decrease in VN titers of postvaccination cattle sera wasobserved following a single amino acid mutation. Similarly, stud-ies using synthetic peptides have indicated that adding, removing,or changing a single amino acid within peptides alters the bindingor reactivity of the peptide to an MAb (49).

The neutralization profiles of seven of the epitope-replacedmutant viruses were not significantly different than the neutral-

ization profiles of SAT2/ZIM/7/83 and the recombinant vSAT2virus with the SAT2/ZIM/7/83 and the SAT2/KNP/19/89 antisera.The avidity index of the HNN¡NKG mutant virus with theSAT2/ZIM/7/83 and SAT2/KNP/19/89 antisera was not signifi-cantly different from that for the SAT2/ZIM/7/83 parental virus.The avidity index of the EHE¡DHR mutant did not significantlyincrease with the SAT2/ZIM/7/83 serum; however, a significantincrease was observed with the SAT2/KNP/19/89 serum. The in-crease in avidity index with the SAT2/KNP/19/89 serum may bedue to the presence of nonneutralizing antibodies present in theantiserum that have high avidity to the mutant virus.

Noteworthy, the neutralization profile of the epitope-replacedmutant virus containing the TQQS¡ETPV mutation revealed asignificantly higher neutralization titer with the SAT2/ZIM/7/83antisera. The TQQS¡ETPV mutation also resulted in a signifi-cant increase in the avidity index of the SAT2/ZIM/7/83 serum tothis epitope-replaced mutant virus compared to that of the paren-tal SAT2/ZIM/7/83 virus. High avidity indexes have previouslybeen linked to high neutralization titers (50). The increased neu-tralization profile seen for the TQQS¡ETPV mutation may bedue to the increased stability of a neutralizing epitope, as a result ofthe amino acids changes introduced, thus increasing the bindingavidity of the neutralizing antibodies to the epitope.

In an attempt to more precisely dissect the role of each pre-dicted SAT2 epitope in its interaction with antibodies, we mea-sured the reactivity of each mutant virus against five MAbs in asandwich ELISA, as opposed to the traditional generation of virusescape mutants, and identified at least two novel discontinuousepitopes. None of the SAT2-specific MAbs neutralized any of theepitope-replaced or parental viruses, indicating that these novelepitopes are nonneutralizing. The different reactivity patterns ob-served for the five MAbs against the epitope-replaced and parentalviruses may be explained on a structural level. The failure of MAbs1D5, GG1, GE11, and DA10 to react to SAT2/KNP/19/89 andvKNPS2aSAT2 is likely due to the mutation of serine to proline atposition 71 in the �B-�C loop of VP2 (Table 2; Fig. 7). Therefore,MAbs 1D5, GG1, GE11, and DA10 have a common interactionsite encompassing residues 71 to 72 of VP2, confirming, for thefirst time, the role of this site as an epitope for SAT2 viruses.

Two of the four MAbs, i.e., 1D5 and GE11, also showed a sig-nificant reduction in reactivity (�45%) to viruses with mutationsat residues 133 to 134 of VP2 (equivalent to type O site 2B) and 48

FIG 7 Ribbon protein diagram depicting the proposed binding footprint of the SAT2-specific MAbs onto the capsid protein of a modeled SAT2 pentamer. (A)The critical reactivity residue for MAbs 1D5, GG1, GE11, and DA10, encompassing residues 71 to 72 (SD¡PE) of VP2, is indicated with red spheres. The othertwo contact points for 1D5 and GE11 are indicated with orange spheres, and the putative footprint for the last two MAbs is shown by the broken line. (B) Theputative contact points for MAb GD12 are shown by the yellow spheres, and a putative footprint is indicated by the broken line. The estimated distances betweenthe residues that make contact with the MAbs are also indicated. The black pentagon and triangle indicate the 5- and 3-fold axes of the virion, respectively.

Epitope Dominance of FMDV SAT2

August 2014 Volume 88 Number 15 jvi.asm.org 8315

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

to 50 of VP1 (equivalent to type O site 3). The critical residuesubstitution in the �E-�F loop of VP2 is the replacement of anegatively charged aspartic residue with a weak positive aspara-gine at position 134 and may explain the lower reactivity of the twoMAbs to vKNPS2bSAT2 (Table 2; Fig. 7). The A48¡T andA50¡N (hydrophilic and bulky) substitutions in the �B-�C loopof VP1 may contribute to the lower reactivity to vKNPS3SAT2(Table 2; Fig. 7). Taken together, the results suggest that residues71 to 72 of VP2 are the major contact point for 1D5 and GE11.Furthermore, the binding footprint of these MAbs includes resi-dues 133 to 134 of VP2 and 48 to 50 of VP1. Structurally, residues48 to 50 of VP1 and 133 to 134 of VP2 are located approximately51 Å and 16 Å from residues 71 to 72 of VP2, respectively (Fig. 7A).The binding footprint of the MAbs GG1 and DA10 on the SAT2capsid overlaps that of the above-mentioned MAbs at the criticalresidues 71 to 72 of VP2. However, MAbs GG1 and DA10 reactedsimilarly to the seven remaining epitope-replaced vSAT2 andSAT2/ZIM/7/83 mutant viruses and thus do not have the samebinding footprint of MAbs 1D5 and GE11. Although we do nothave direct structural evidence, it can be hypothesized that thesetwo MAbs may bind to the �B-�C loop of VP2 on opposite sidesof the 2-fold axis of the virus.

Our data provided evidence of a second unique MAb bindingfootprint, that of GD12, which encompasses residues 71 to 72 and133 to 134 of VP2 (site 2) and residues 84 to 86 and 109 to 111 ofVP1. MAb GD12 presented a different epitope specificity to SAT2viruses, as elucidated by its ability to react to both vKNPS2aSAT2and SAT2/KNP/19/89, albeit with lower reactivity. Lower reactiv-ity was also observed for viruses with amino acid substitutions atresidues 84 to 86 (�E-�F) and 109 to 111 (�F-�G) of VP1 andresidues 133 to 134 of VP2. Residues 71 to 72 and 133 to 134 ofVP2 and 84 to 86 of VP1 are surface exposed in the length of ashallow groove formed by the interaction of VP2, VP3, and VP1and located ca. 16 Å and 33 Å from each other (Fig. 7B). However,the role of residues 109 to 111 of VP1 in the interaction with thisMAb is not as evident, as it is located in a depression at the 5-foldaxis of the virion. This is the first time that this second antigenicregion, incorporating residues 71 to 72 and 133 to 134 of VP2 (site2) and residues 84 to 86 and 109 to 111 of VP1, has been described.

A nonneutralizing, conformational epitope at the N terminusof VP2 has been reported for Asia-1 and other FMDV serotypes(50, 51). Furthermore, a structural relationship between antigenicsites situated on the exposed loops of different capsid proteins hasbeen noted previously. For Asia-1, a structural relationship existsbetween antigenic site 2 (residues 67, 72, 74, 77, and 79 of VP2)and antigenic site 4 (residues 58 and 59 of VP3) (52). Similarly,antigenic site 3 of serotype A encompasses residues 82 to 88 in the�B-�C loop of VP2 and residues 58 to 61 in the �B-�C loop, 136to 139 in the �E-�F loop, and 195 in the �H-�I loop of VP3 forA10 (53). Also, the major discontinuous antigenic site of serotypeC, site D, includes several loops of VP1 (subsite D1), VP2 (subsiteD2), and VP3 (subsite D3) (54). This is the first time, however,that the �E-�F and �F-�G loops of VP1 are implicated as havinga role in the antigenicity of FMDV. In a previous study, it wasfound that antibodies against discontinuous epitopes in serotypesO and A can distinguish between the 12S and 146S particles (55).These antibodies recognize conformational epitopes and thus de-pend on the native structure of virus particles, which is likely thecase with MAb GD12 in this study.

Unlike previous reports where the identification of epitopes

relied on residue changes that abrogate binding of MAbs, but withno information on how different epitopic units contribute to theinteraction with the MAb, our report describes the complete bind-ing footprint of an antibody within the FMD capsid. The comple-mentary determining regions (CDRs) of the heavy- and light-chain variable regions of an antibody interact with an antigen, andCDR3 is the most diverse (56, 57). Unlike in mouse antibodies, thebovine Ig heavy chain has a very long CDR3, which can be morethan 60 residues in length (58, 59) and may span a spatial distanceof up to 45 Å. As the CDR3 region is the most heterogenous, thethree-dimensional structure of the antigen-binding site is influ-enced by its length (60). Therefore, the structural design of engi-neered vaccines with increased antigenicity will need to incorpo-rate the entire binding footprint identified in this study, i.e., allthree contact points of the binding antibody.

The results reported in this paper provide evidence that di-rected evolution or rational engineering of antigenic sites throughmutation of a few of the antigenically relevant positions maychange the cross-reactivity of antibodies to a heterologous viruswithin a serotype of FMDV. The change in cross-reactivity may bedirectly linked to the avidity of antibodies to the virus. However,further structural and functional studies are necessary to betterunderstand the structural basis of antigenic variation and the in-teraction of the FMDV epitopes in antibody binding.

ACKNOWLEDGMENTS

Research findings documented in this paper are in part the results of acooperative research and development agreement between the Agricul-tural Research Council, Onderstepoort Veterinary Institute of SouthAfrica, and the U.S. Department of Agriculture, Agricultural ResearchService, entitled “Genetic Engineering of Antigenically Stable Strains ofFoot-and-Mouth Disease Virus for Vaccine Production” (agreementnumber 58-3K95-M-894). Additional financial support was receivedfrom MSD Animal Health (previously Intervet/Schering Plough), TheNetherlands. Pamela Opperman was supported by a bursary from theSouth African Department of Science and Technology (DST).

We thank Geoff Fosgate for his assistance with statistical analysis. Wealso thank Otto Koekemoer and Alri Pretorius for commenting on andcritically reading the manuscript.

REFERENCES1. Kong R, Li H, Georgiev I, Changela A, Bibollet-Ruche F, Decker JM,

Rowland-Jones SL, Jaye A, Guan Y, Lewis GK, Langedijk JP, Hahn BH,Kwong PD, Robinson JE, Shaw GM. 2012. Epitope mapping of broadlyneutralizing HIV-2 human monoclonal antibodies. J. Virol. 86:12115–12128. http://dx.doi.org/10.1128/JVI.01632-12.

2. Sun L, Lu X, Li C, Wang M, Liu Q, Li Z, Hu X, Li J, Liu F, Li Q, BelserJ, Hancock K, Shu Y, Katz J, Liang M, Li D. 2009. Generation, charac-terization and epitope mapping of two neutralizing and protective humanrecombinant antibodies against influenza A H5N1 viruses. PLoS One4:e5476. http://dx.doi.org/10.1371/journal.pone.0005476.

3. Morrell DJ, Mellor EJ, Rowlands DJ, Brown F. 1987. Surface structureand RNA-protein interactions of foot-and-mouth disease virus. J. Gen.Virol. 68:1649 –1658. http://dx.doi.org/10.1099/0022-1317-68-6-1649.

4. Acharya R, Fry E, Stuart D, Fox G, Rowlands D, Brown F. 1989. Thethree-dimensional structure of foot-and-mouth disease virus at 2.9 Å res-olution. Nature 337:709 –716. http://dx.doi.org/10.1038/337709a0.

5. Samuel AR, Knowles NJ. 2001. Foot-and-mouth disease type O virusesexhibit genetically and geographically distinct evolutionary lineages (to-potypes). J. Gen. Virol. 82:609 – 621.

6. Bronsvoort BM, Radford AD, Tanya VN, Nfon C, Kitching RP, MorganKL. 2004. Molecular epidemiology of foot-and-mouth disease viruses inthe Adamawa province of Cameroon. J. Clin. Microbiol. 42:2186 –2196.http://dx.doi.org/10.1128/JCM.42.5.2186-2196.2004.

7. Garland AJ. 1999. Vital elements for the successful control of foot-and-

Opperman et al.

8316 jvi.asm.org Journal of Virology

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

mouth disease by vaccination. Vaccine 17:1760 –1766. http://dx.doi.org/10.1016/S0264-410X(98)00443-5.

8. Mahapatra M, Hamblin P, Paton DJ. 2012. Foot-and-mouth diseasevirus epitope dominance in the antibody response of vaccinated animals.J. Gen. Virol. 93:488 – 493. http://dx.doi.org/10.1099/vir.0.037952-0.

9. Parida S. 2009. Vaccination against foot-and-mouth disease virus: strat-egies and effectiveness. Expert Rev. Vaccines 8:347–365. http://dx.doi.org/10.1586/14760584.8.3.347.

10. Pay TW, Hingley PJ. 1987. Correlation of 140S antigen dose with theserum neutralizing antibody response and the level of protection inducedin cattle by foot-and-mouth disease vaccines. Vaccine 5:60 – 64. http://dx.doi.org/10.1016/0264-410X(87)90011-9.

11. McCullough KC, Pullen L, Parkinson D. 1992. The immune responseagainst foot-and-mouth disease virus: influence of the T lymphocyte growthfactors IL-1 and IL-2 on the murine humoral response in vivo. Immunol. Lett.31:41–46. http://dx.doi.org/10.1016/0165-2478(92)90008-C.

12. Salt JS. 1993. The carrier state in foot-and-mouth disease—an immuno-logical review. Br. Vet. J. 149:207–223. http://dx.doi.org/10.1016/S0007-1935(05)80168-X.

13. Kitson JD, McCahon D, Belsham GJ. 1990. Sequence analysis of mono-clonal antibody resistant mutants of type O foot and mouth disease virus:evidence for the involvement of the three surface exposed capsid proteinsin four antigenic sites. Virology 179:26 –34. http://dx.doi.org/10.1016/0042-6822(90)90269-W.

14. Ciurea A, Klenerman P, Hunziker L, Horvath E, Senn BM, Ochsen-bein AF, Hengartner H, Zinkernagel RM. 2000. Viral persistence invivo through selection of neutralizing antibody-escape variants. Proc.Natl. Acad. Sci. U. S. A. 97:2749 –2754. http://dx.doi.org/10.1073/pnas.040558797.

15. Baxt B, Vakharia V, Moore DM, Franke AJ, Morgan DO. 1989. Analysisof neutralizing antigenic sites on the surface of type A12 foot-and-mouthdisease virus. J. Virol. 63:2143–2151.

16. Bolwell C, Clarke BE, Parry NR, Ouldridge EJ, Brown F, Rowlands DJ.1989. Epitope mapping of foot-and-mouth disease virus with neutralizingmonoclonal antibodies. J. Gen. Virol. 70:59 – 68. http://dx.doi.org/10.1099/0022-1317-70-1-59.

17. Thomas AA, Woortmeijer RJ, Barteling SJ, Meloen RH. 1988. Evidencefor more than one important, neutralizing site on foot-and-mouth diseasevirus. Brief report. Arch. Virol. 99:237–242. http://dx.doi.org/10.1007/BF01311072.

18. Crowther JR, Farias S, Carpenter WC, Samuel AR. 1993. Identificationof a fifth neutralizable site on type O foot-and-mouth disease virus follow-ing characterization of single and quintuple monoclonal antibody escapemutants. J. Gen. Virol. 74:1547–1553. http://dx.doi.org/10.1099/0022-1317-74-8-1547.

19. Mateu MG, Martinez MA, Capucci L, Andreu D, Giralt E, Sobrino F,Brocchi E, Domingo E. 1990. A single amino acid substitution affectsmultiple overlapping epitopes in the major antigenic site of foot-and-mouth disease virus of serotype C. J. Gen. Virol. 71:629 – 637. http://dx.doi.org/10.1099/0022-1317-71-3-629.

20. Sanyal A, Venkataramanan R, Pattnaik B. 1997. Antigenic features offoot-and-mouth disease virus serotype Asia1 as revealed by monoclonalantibodies and neutralization-escape mutants. Virus Res. 50:107–117.http://dx.doi.org/10.1016/S0168-1702(97)00058-0.

21. Bittle JL, Houghten RA, Alexander H, Shinnick TM, Sutcliffe JG, LernerRA, Rowlands DJ, Brown F. 1982. Protection against foot-and-mouthdisease by immunization with a chemically synthesized peptide predictedfrom the viral nucleotide sequence. Nature 298:30 –33. http://dx.doi.org/10.1038/298030a0.

22. Pfaff E, Mussgay M, Bohm HO, Schulz GE, Schaller H. 1982. Antibodiesagainst a preselected peptide recognize and neutralize foot-and-mouthdisease virus. EMBO J. 1:869 – 874.

23. Grazioli S, Moretti M, Barbieri I, Crosatti M, Brocchi E. 2006. Use ofmonoclonal antibodies to identify and map new antigenic determinantsinvolved in neutralization of FMD viruses type SAT 1 and SAT 2, p 287–297. In Proceedings of the 35th Meeting of the European Commission forthe Control of Foot-and-Mouth Disease. International Control of Foot-and-Mouth Disease: Tools, Trends and Perspectives, Paphos, Cyprus, 16to 20 October 2006.

24. McCahon D, Crowther JR, Belsham GJ, Kitson JD, Duchesne M, HaveP, Meloen RH, Morgan DO, De Simone F. 1989. Evidence for at leastfour antigenic sites on type O foot-and-mouth disease virus involved inneutralization; identification by single and multiple site monoclonal anti-

body-resistant mutants. J. Gen. Virol. 70:639 – 645. http://dx.doi.org/10.1099/0022-1317-70-3-639.

25. Crowther JR, Rowe CA, Butcher R. 1993. Characterization of monoclonalantibodies against a type SAT 2 foot-and-mouth disease virus. Epidemiol.Infect. 111:391–406. http://dx.doi.org/10.1017/S0950268800057083.

26. Opperman PA, Maree FF, Van Wyngaardt W, Vosloo W, Theron J.2012. Mapping of antigenic determinants on a SAT2 foot-and-mouth dis-ease virus using chicken single-chain antibody fragments. Virus Res. 167:370 –379. http://dx.doi.org/10.1016/j.virusres.2012.05.026.

27. Storey P, Theron J, Maree FF, O’Neill HG. 2007. A second RGD motif inthe 1D capsid protein of a SAT1 type foot-and-mouth disease virus fieldisolate is not essential for attachment to target cells. Virus Res. 124:184 –192. http://dx.doi.org/10.1016/j.virusres.2006.11.003.

28. van Rensburg HG, Henry TM, Mason PW. 2004. Studies of geneticallydefined chimeras of a European type A virus and a South African Territo-ries type 2 virus reveal growth determinants for foot-and-mouth diseasevirus. J. Gen. Virol. 85:61– 68. http://dx.doi.org/10.1099/vir.0.19509-0.

29. Jones BV, Howard CJ. 1995. Production of stable bovine-murine inter-species hybrids. Methods Mol. Biol. 45:41– 47.

30. Maree FF, Blignaut B, Esterhuysen JJ, de Beer TA, Theron J, O’NeillHG, Rieder E. 2011. Predicting antigenic sites on the foot-and-mouthdisease virus capsid of the South African Territories types using virusneutralization data. J. Gen. Virol. 92:2297–2309. http://dx.doi.org/10.1099/vir.0.032839-0.

31. Schneider TD, Stephens RM. 1990. Sequence logos: a new way to displayconsensus sequences. Nucleic Acids Res. 18:6097– 6100. http://dx.doi.org/10.1093/nar/18.20.6097.

32. Sali A, Blundell TL. 1993. Comparative protein modelling by satisfactionof spatial restraints. J. Mol. Biol. 234:779 – 815. http://dx.doi.org/10.1006/jmbi.1993.1626.

33. Logan D, Abu-Ghazaleh R, Blakemore W, Curry S, Jackson T, King A,Lea S, Lewis R, Newman J, Parry N, Rowlands D, Stuart D, Fry E. 1993.Structure of a major immunogenic site on foot-and-mouth disease virus.Nature 362:566 –568. http://dx.doi.org/10.1038/362566a0.

34. Ho SN, Hunt HD, Horton RM, Pullen JK, Pease LR. 1989. Site-directedmutagenesis by overlap extension using the polymerase chain reaction.Gene 77:51–59. http://dx.doi.org/10.1016/0378-1119(89)90358-2.

35. Bastos AD. 1998. Detection and characterization of foot-and-mouth dis-ease virus in sub-Saharan Africa. Onderstepoort J. Vet. Res. 65:37– 47.

36. Vangrysperre W, De Clercq K. 1996. Rapid and sensitive polymerasechain reaction based detection and typing of foot-and-mouth diseasevirus in clinical samples and cell culture isolates, combined with asimultaneous differentiation with other genomically and/or symptom-atically related viruses. Arch. Virol. 141:331–344. http://dx.doi.org/10.1007/BF01718403.

37. Rieder E, Bunch T, Brown F, Mason PW. 1993. Genetically engineeredfoot-and-mouth disease viruses with poly(C) tracts of two nucleotides arevirulent in mice. J. Virol. 67:5139 –5145.

38. Office International des Epizooties. 2009. Manual of diagnostic tests andvaccines for terrestrial animals 2009, chapter 2.1.5, p 1–25. Office Inter-national des Epizooties, Paris, France.

39. Rweyemamu MM, Booth JC, Head M, Pay TW. 1978. Microneutraliza-tion tests for serological typing and subtyping of foot-and-mouth diseasevirus strains. J. Hyg. (Lond.) 81:107–123. http://dx.doi.org/10.1017/S002217240005381X.

40. Knipe T, Rieder E, Baxt B, Ward G, Mason PW. 1997. Characterizationof synthetic foot-and-mouth disease virus provirions separates acid-mediated disassembly from infectivity. J. Virol. 71:2851–2856.

41. Doel TR, Mowat GN. 1985. An international collaborative study onfoot-and-mouth disease virus assay methods. 2. Quantification of 146Sparticles. J. Biol. Stand. 13:335–344.

42. Reference deleted.43. Lavoria MA, Di-Giacomo S, Bucafusco D, Franco-Mahecha OL, Perez-

Filgueira DM, Capozzo AV. 2012. Avidity and subtyping of specificantibodies applied to the indirect assessment of heterologous protectionagainst foot-and-mouth disease virus in cattle. Vaccine 30:6845– 6850.http://dx.doi.org/10.1016/j.vaccine.2012.09.011.

44. Reeve R, Blignaut B, Esterhuysen JJ, Opperman P, Matthews L, Fry EE,de Beer TA, Theron J, Rieder E, Vosloo W, O’Neill HG, Haydon DT,Maree FF. 2010. Sequence-based prediction for vaccine strain selectionand identification of antigenic variability in foot-and-mouth disease virus.PLoS Comput. Biol. 6:e1001027. http://dx.doi.org/10.1371/journal.pcbi.1001027.

Epitope Dominance of FMDV SAT2

August 2014 Volume 88 Number 15 jvi.asm.org 8317

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

45. Verdaguer N, Sevilla N, Valero ML, Stuart D, Brocchi E, Andreu D,Giralt E, Domingo E, Mateu MG, Fita I. 1998. A similar pattern ofinteraction for different antibodies with a major antigenic site of foot-and-mouth disease virus: implications for intratypic antigenic variation. J. Vi-rol. 72:739 –748.

46. Shiroishi M, Tsumoto K, Tanaka Y, Yokota A, Nakanishi T, KondoH, Kumagai I. 2007. Structural consequences of mutations in interfa-cial Tyr residues of a protein antigen-antibody complex. The case ofHyHEL-10-HEL. J. Biol. Chem. 282:6783– 6791. http://dx.doi.org/10.1074/jbc.M605197200.

47. Dunn CS, Samuel AR, Pullen LA, Anderson J. 1998. The biologicalrelevance of virus neutralisation sites for virulence and vaccine protectionin the guinea pig model of foot-and-mouth disease. Virology 247:51– 61.http://dx.doi.org/10.1006/viro.1998.9175.

48. Rezapkin G, Neverov A, Cherkasova E, Vidor E, Sarafanov A, Kouia-vskaia D, Dragunsky E, Chumakov K. 2010. Repertoire of antibodiesagainst type 1 poliovirus in human sera. J. Virol. Methods 169:322–331.http://dx.doi.org/10.1016/j.jviromet.2010.07.037.

49. Meloen RH, Puyk WC, Meijer DJ, Lankhof H, Posthumus WP,Schaaper WM. 1987. Antigenicity and immunogenicity of synthetic pep-tides of foot-and-mouth disease virus. J. Gen. Virol. 68:305–314. http://dx.doi.org/10.1099/0022-1317-68-2-305.

50. Rana SK, Bagchi T. 2008. Partial sequence analysis of VP1 of Indianisolates of foot-and-mouth disease virus type Asia-1. Virus Genes 37:60 –68. http://dx.doi.org/10.1007/s11262-008-0236-y.

51. Freiberg B, Rahman MM, Marquardt O. 1999. Genetical and immunolog-ical analysis of recent Asian type A and O foot-and-mouth disease virus iso-lates. Virus Genes 19:167–182. http://dx.doi.org/10.1023/A:1008183312319.

52. Grazioli S, Fallacara F, Brocchi E. 2013. Mapping of antigenic sites offoot-and-mouth disease virus serotype Asia 1 and relationships with sites

described in other serotypes. J. Gen. Virol. 94:559 –569. http://dx.doi.org/10.1099/vir.0.048249-0.

53. Thomas AA, Woortmeijer RJ, Puijk W, Barteling SJ. 1988. Antigenicsites on foot-and-mouth disease virus type A10. J. Virol. 62:2782–2789.

54. Lea S, Hernandez J, Blakemore W, Brocchi E, Curry S, Domingo E, FryE, Abu-Ghazaleh R, King A, Newman J, Stuart D, Mateu MG. 1994. Thestructure and antigenicity of a type C foot-and-mouth disease virus. Struc-ture 2:123–139. http://dx.doi.org/10.1016/S0969-2126(00)00014-9.

55. Yang M, Holland H, Clavijo A. 2008. Production of monoclonal anti-bodies against whole virus particles of foot-and-mouth disease virus sero-type O and A and their potential use in quantification of intact virus forvaccine manufacture. Vaccine 26:3377–3382. http://dx.doi.org/10.1016/j.vaccine.2008.04.062.

56. Amit AG, Mariuzza RA, Phillips SE, Poljak RJ. 1986. Three-dimensionalstructure of an antigen-antibody complex at 2.8 Å resolution. Science233:747–753. http://dx.doi.org/10.1126/science.2426778.

57. Elgert KD. 2009. Antigens and antibodies, p 105–138. Immunology: un-derstanding the immune system. John Wiley and Sons, Inc, Hoboken, NJ.

58. Saini SS, Farrugia W, Ramsland PA, Kaushik AK. 2003. Bovine IgMantibodies with exceptionally long complementarity-determining region3 of the heavy chain share unique structural properties conferring re-stricted VH � Vlambda pairings. Int. Immunol. 15:845– 853. http://dx.doi.org/10.1093/intimm/dxg083.

59. Saini SS, Allore B, Jacobs RM, Kaushik A. 1999. Exceptionally longCDR3H region with multiple cysteine residues in functional bovine IgMantibodies. Eur. J. Immunol. 29:2420 –2426. http://dx.doi.org/10.1002/(SICI)1521-4141(199908)29:08 2420::AID-IMMU2420�3.0.CO;2-A.

60. Reth M. 1994. B cell antigen receptors. Curr. Opin. Immunol. 6:3– 8.http://dx.doi.org/10.1016/0952-7915(94)90026-4.

Opperman et al.

8318 jvi.asm.org Journal of Virology

on April 22, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from