M:FoodMicrobiology&

Safety

Development and Application of ReverseTranscription Loop-Mediated IsothermalAmplification for Detecting Live Shewanellaputrefaciens in Preserved Fish SampleChenghua Li, Qi Ying, Xiurong Su, and Taiwu Li

Abstract: Given that live Shewanella putrefaciens is one of the major causes of spoilage for aquatic products even in chillstorage, the rapid and accurate detection process is the first priority. In the present study, a novel reverse transcriptionloop-mediated isothermal amplification (RT-LAMP) detecting assay was developed by targeting internal transcribedspacer (ITS) sequence between 16S and 23S rRNA. At the same time, a new procaryotic mRNA isolation strategywas also established by introducing a polyA tail to RNA during cDNA synthesis step. Under the optimal reaction time(60 min) and temperature (64.1 ◦C), S. putrefaciens could be specially identified from a variety of other tested bacteria byRT-LAMP. The sensitivity analysis showed that RT-LAMP could be identified as lower as 5.4 copies per reaction, whichis over 200-fold higher than that of standard PCR (1.08 × 103 copies per reaction). The method could be effectivelyidentified S. putrefaciens in artificially contaminated or spoilaged fish samples with dose-dependent manners. To ourknowledge, this is the first report using RT-LAMP assay to detect live S. putrefaciens in fish.

Keywords: live bacteria, ITS, RT-LAMP, Shewanella putrefaciens

Practical Application: The study provided a rapid and accurate detection method for live bacteria in aquatic food andestablished a new procaryotic mRNA isolation strategy at the same time, which will be useful for food preservation.

IntroductionFood spoilage is one of global concerns as more than 25% of

the food produced worldwide is lost in postharvest every year,especially for aquatic product. A combination of various factorslike light, oxygen, heat, humidity, and microorganisms has beendemonstrated to be the potential cause for this phenomena, inwhich microbial degradation manifests itself as the key one com-pared to the other counterparts (Gram and Dalgaard 2002). Livebacteria could produce amines, sulfides, alcohols, aldehydes, ke-tones, and organic acids during aquatic product preservation, re-sulting in unpleasant and unacceptable off-flavors. On contrast,the presence of dead bacteria in food do not cause any change onthe quality of food (Skjerdal and others 2004).

Shewanella putrefaciens, also known as Pseudomonas putrefaciens,was one of species in Alteromonadales, Shewanellaceae, She-wanella. The bacteria attracted much attention because it had beenconsidered as the crucial bacterium for cold stored fish spoilage.Given that the economic importance for aquatic fish perserva-tion, development, and implication of a rapid detection methodfor the bacteria is the first priority (Caipang and others 2010).Several methods have been established to detect S. putrefaciens in

MS 20111236 Submitted 10/11/2011, Accepted 1/5/2012. Authors C. Li, Ying,Su, and T. Li are with the School of Marine Science, Ningbo Univ., Ningbo, Zhejiang315211, China. Author T. Li is with Ningbo City College of Vocational Tech-nology, Ningbo, Zhejiang 315110, China. Direct inquiries to author Xiurong Su(E-mail: chli@yic.ac.cn, suxiurong@nbu.edu.cn).

food products or in fields. Traditional culture methods such asselective and differential microbiological media can effectively de-tect and identify S. putrefaciens from preserved fish. However, themethod is very time-consuming even though it has been widelyused in many laboratories (Miller and others 2011). Polymerasechain reaction (PCR) method has been developed to detect thebacterial strains in the food products rapidly and accurately. A 16SrRNA-targeted oligonucleotide probe specific for S. putrefacienswas constructed by Dichristina and DeLong (1993). Plate-assay-based screening techniques was also employed to identify Mn(IV)reduction-deficient (Mnr) mutants (Brian and others 1998). How-ever, the presence of dead cells limited its use in microbiologicaldetection of aquatic food samples (Chaiyanan and others 2001).Nowadays, several researchers have attempted to utilize productsof real time PCR targeted to specific mRNA (Miller and oth-ers 2010; Reimann and others 2010; Techathuvanan and others2010) or rRNA (Kurabachew and others 1998; Hirawati and oth-ers 2006) as an alternative marker, and internal transcribed spacer(ITS) is attracting much more attention for its higher resolutionof bacteria detection (Cangelosi and others 1996). The majordisadvantage to this method is expensive instrument needed andspecialized expert required for data analysis.

Loop-mediated isothermal amplification (LAMP) is consid-ered to be one of the most promising analytical methods for itsadvantage of rapid, simple, highly sensitive, and on-site conve-nience (Zhao and others 2009; Caipang and others 2010). LAMPis based on the principle of strand-displacing Bst DNA poly-merase to amplify the target sequence with high selectivity. DNA

C© 2012 Institute of Food Technologists R©M226 Journal of Food Science � Vol. 77, Nr. 4, 2012 doi: 10.1111/j.1750-3841.2012.02636.x

Further reproduction without permission is prohibited

M:Fo

odMi

crobio

logy

&Sa

fety

RT-LAMP detecting live S. putrefaciens . . .

amplification is performed under isothermal conditions (60–65 ◦C) without the thermal cycler. Furthermore, positive sam-ples could exhibit increased turbidity of the reaction solution withthe process of LAMP amplification. LAMP has been widely usedfor rapid detection of bacteria in environment and host (Savanand others 2004; Song and others 2005; Aoi and others 2006;Yeh and others 2006; Criado-Fornelio 2007; Plutzer and others2010). The major obstacle for the conventional LAMP methodwas its poor ability to distinguish live cells from dead ones. Tak-ing account into the fact that the most common approach fordetecting live bacteria was to detect messenger RNA (mRNA)by RT-PCR (Myint 2002), therefore, reverse transcripted LAMP(RT-LAMP) technique, combination of RT-PCR and LAMP,might be the right answer to resolve the above disadvantage.Although RT-LAMP was used in virus detection to some ex-tend (Christopher and others 2004; Tohru and others 2006; Yinand others 2010), rare study was conducted on its implication inbacteria detection to our knowledge.

The main purposes of the present study were: (1) to developa novel diagnostic method for the rapid detection of growingS. putrefaciens, (2) to establish bacteria cDNA purification strategythat could remove all traces of genomic DNA contamination,(3) to optimize reaction condition for RT-LAMP, (4) to put thetechnique into use in simulant or spoilaged fish sample detection.

Materials and Methods

Bacterial strainsSeven reference strains (see Table 1) including three Gram-

positive and four Gram-negative bacteria were utilized to developand evaluate the specificity and sensitivity of RT-LAMP assays.

Cloning and analysis intergenic spacer regionsA fragment of S. putrefaciens in internal transcribed spacer was

amplified with bacterial gene specific primers BSF and BSR (Chenand others 2005), and was subjected to 1.5% agarose electrophore-sis analysis. The smaller amplicons were excised from the gel andpurified by the Gel DNA Purification Kit (Generay London, UK).The purified PCR products were subcloned into the pMD18-T

Table 1. Reference strains used in this study

Species Strain

Bacillus pumilus GIM 1.225a

Bacillus licheniformis GIM 1.283Bacillus thuringiensis GIM 1.27Listeria welshimeri GIM 1.232Shewanella putrefaciens GIM 1.305Pseudomonas fluorescens GIM 1.209Aeromonas hydrophila ATCC 21763b

aGIM: Guangdong Microbial Culture Collection Center, China.bATCC: American Type Culture Collection.

vector (TAKARA, Dalian, Liaoning province, China) and trans-formed to competent E. coli DH5α for sequencing.

Design of primers for RT-LAMPSets of RT-LAMP primers (Table 2) were designed with

the aid of the online software Primerexplorer V4 (http://primerexplorer.jp/elamp4.0.0/index.html) based on the ITSsequences of S. putrefaciens.

Preparation bacterial total RNAThirty milliliters of bacterial cultures at exponential growth

stage (OD600 = 0.8) was chilled on ice. Cells were harvested im-mediately by centrifugation at 5000 × g for 10 min at 4 ◦C andhomogenized vigorously to a fine powder using a homogenizerwith a cooling jacket full of liquid nitrogen. The powder was sus-pended in 1 mL of RNAisol reagent (TAKARA, Dalian, Liaoningprovince, China) and RNA was extracted by adding 0.25 mL ofchloroform followed by centrifugation at 12 000 × g for 15 minat 4 ◦C. The RNA-containing aqueous phase was collected andthe RNA was precipitated by adding 750 μL of isopropanol andcentrifuge at 7500 × g for 10 min at 4 ◦C. After being washedwith 75% ethanol and dried at room temperature for 10 min, theRNA pellet was resuspended in 20 μL DEPC water by gentlypipetting up and down. RNA concentration was determined bymeasurement of the optical density at 260 nm. Another 30 mL S.putrefaciens culture was autoclaved at 120 ◦C for 20 min and RNAwas collected to serve as a negative control for RT-LAMP analysis(Ying and others 2011).

cDNA synthesis and purificationPolyA-B3 primer was introduced for bacterial cDNA synthesize

to replace conventional primer in commercial cDNA synthesis kit(TAKARA, Dalian, Liaoning province, China). The first strandwas synthesis in a 20 μL synthesis reaction mixture containing1.5 μg total RNA, 2 μL of 10 pmol polyA-B3 primer, 200 unitsof M-MLV reverse transcriptase, 4 μL of 5× first strand buffer,1 μL of dNTPs (10 mM), and 1 μL of RNase inhibitor. Thereaction was incubated at 42 ◦C for 1 h followed by 2 min ofimmediate incubation at –20 ◦C. PolyA-ITS cDNA was isolatedfrom genomic DNA using Oligotex mRNA Mini Kit (Qiagen,Hilden, Germany).

Optimize conditions for RT-LAMP assayFour microliters of the purified polyA-ITS cDNA was used

for RT-LAMP amplification. The standard RT-LAMP assay wasperformed in a total volume of 12.5 μL reaction mix contain-ing 4.0 μL of cDNA, 0.8 μL of each FIP and BIP (10 pmol)(Table 2), 0.2 μL (10 pmol) of F3 and B3 (Table 2), 5.25 μLof PCR grade water, 1.25 μL 10× ThermoPol Reaction Buffer,and 0.5 μL Enzyme Mix of Bst DNA polymerase (NEB). To opti-mize the reaction condition, the reaction temperature was carried

Table 2 Primers used in this study

Primer Sequence (5’–3’) Length (nt)

F3 CTTTTGAGTGTTCACACAGA 20B3 GACCAAAGAAGTGGACGC 18LF ATGTTTCGCTCTACCCGT 18BSR GGGTTYCCCCRTTCRGAAAT 20BSF GTGAATACGTTCCCGGGCCT 20PolyA-B3 AAAAAAAAAAAAAAAAGACCAAAGAAGTGGACGC 34FIP TCCAAATTGTTAAAGAACTACATCGACTTGCTTGTTCATCCTGTCT 46BIP CGAAAGCATTGAACATTGAGTTCTGCCTTAGACTTGAATATTCAAGAC 48

Vol. 77, Nr. 4, 2012 � Journal of Food Science M227

M:FoodMicrobiology&

Safety

RT-LAMP detecting live S. putrefaciens . . .

out at 61.0, 61.7, 63.3, 64.1, and 64.9 ◦C and reaction time wasset up at 30, 45, 60, and 75 min, respectively. The reaction wasterminated by heating at 80 ◦C for 2 min in the end. After thereaction finished, RT-LAMP products were subjected to 2.0%agarose electrophoresis analysis.

Determination of RT-LAMP sensitivity and specificityThe sensitivity of the RT-LAMP assay was investigated by com-

paring with conventional PCR using the same serially dilutedcDNA template at the same concentrations. RT-LAMP was per-formed according to optimal condition in the above section. PCRwas carried out in 25 μL reaction mixtures containing 4 μLcDNA, 2 μL dNTP (2.5 mM), 2 μL MgCl2 (25 mM), 0.2 μLTaq DNA polymerase (Takara), 2.5 μL 10×buffer, 1.0 μL eachprimer (F3 and B3), and 12.3 μL of PCR grade water. PCR con-ditions were as follows: 35 cycles of denaturing at 94 ◦C for 15 s,annealing at 55 ◦C for 15 s and extension at 72 ◦C for 15 s, thenfollowed by a final extension at 72 ◦C for 10 min.

To assess the specificity of RT-LAMP, seven different bacterialstrains (see Table 1) including S. putrefaciens were selcted as refer-ence. The autoclaved sample was used as the negative control.

Figure 1–Effect of temperature on amount of RT-LAMP product. M: DL2000Marker, Lane 1: negative control, Lane 2: amplification at 61 ◦C, Lane 3: am-plification at 61.7 ◦C, Lane 4: amplification at 63.3 ◦C, Lane 5: amplificationat 64.1 ◦C, Lane 6: amplification at 64.9 ◦C.

Figure 2–Effect of reaction time on RT-LAMP. M: DNA Marker, Lane 1: 75mim, Lane 2: 60 min, Lane 3: 45 min, Lane 4: 30 min.

Application of RT-LAMP in spoilaged or artificiallycontaminated fish samples

In order to evaluate the feasibility of RT-LAMP assay in fishsample, cultured S. putrefaciens was homogenated with 1 g pre-served large yellow croaker (Pseudosciaena crocea) (collected fromJinhong Food Co. Ltd) sample in 10 mL water, and the final con-centrations of bacteria in the homogenation were kept at 5000,500, and 50 cfu/μL, respectively. The spoilage fish sample wasserved as positive control.

Results

Sequence analysis of the ITSA 676 bp fragment representing the complete ITS sequence

from S. putrefaciens GIM 1.305 was cloned with bacterial genespecific primers BSF and BSR. Blastn analysis confirmed that thesequence had high similarity to ITS sequence from other bacteria.The sequence was deposited in the GenBank database under acces-sion number HQ007351. tRNAscan-SE v.1.21 analysis indicatesno tRNA genes sequence was existed in the sequence.

Optimization of RT-LAMP conditions for detectingS. putrefaciens

The reaction temperature and time for RT-LAMP assay wereoptimized and determined using polyA ITS cDNA of S. putrefa-ciens as a template (Fig. 1 and Fig. 2). 64.1 ◦C was considered to beoptimal reaction temperature and 60 min was as the most suitablereaction time.

Sensitivity of RT-LAMP and PCRThe sensitivity of the RT-LAMP assay was determined and

shown in Fig. 3. RT-LAMP method was able to detect up to5.4 copies per reaction, while PCR strategy could generate posi-tive signal when bacteria concentration reached up to 1.08 × 103

copies per reaction. In another words, the sensitivity of LAMP was200-fold greater compared to that of the standard PCR method.

Specificity of RT-LAMP and PCRAssay for special detection of S. putrefaciens was investigated with

six bacterial strains as control (Table 1) and the result was shown inFig. 4a. RT-LAMP could specially detect S. putrefaciens, consistentwith the result of PCR method (Fig. 4b).

RT-LAMP in detecting live S. putrefaciensThe result of RT-LAMP in detecting live S. putrefaciens was

shown in Fig. 5. RT-LAMP products were only observed in thepositive control group and group with live S. putrefaciens. No signalwas identified in the autoclaved bacterial sample and negativecontrol group.

Figure 3–Sensitivity of RT-LAMP (a) compared toPCR assay (b). M: DL2000 Marker, Lane 1: cDNAof 5.4 × 105 copies, Lane 2: cDNA of 5.4 × 104

copies, Lane 3: cDNA of 5.4 × 103 copies, Lane 4:cDNA of 5.4 × 102 copies, Lane 5: cDNA of 5.4 ×101 copies, Lane 6: cDNA of 5.4 copies.

M228 Journal of Food Science � Vol. 77, Nr. 4, 2012

M:Fo

odMi

crobio

logy

&Sa

fety

RT-LAMP detecting live S. putrefaciens . . .

RT-LAMP in detecting spoilaged fish sampleThe result of RT-LAMP in detecting S. putrefaciens in fish sam-

ple was shown in Fig. 6. RT-LAMP could identify S. putrefaciensnot only from artificially contaminated fish samples with dose-dependent manners, but from spoiaged sample. No bands weredetected in the negative control groups.

DiscussionIn this study, we set up a set of highly specific LAMP primers

targeting the ITS of S. putrefaciens and developed a RT-LAMP

Figure 4–Specificity of LAMP (a) and PCR assay (b). M: DL2000 Marker, C:negative control, Lane 1: cDNA from Shewanella putrefaciens GIM 1.305,Lane 2: cDNA from Bacillus pumilus GIM 1.225, Lane 3: cDNA from Bacilluslicheniformis GIM 1.283, Lane 4: cDNA from Bacillus thuringiensis GIM1.27, Lane 5: cDNA from Listeria welshimeri GIM 1.232, Lane 6: cDNAfrom Pseudomonas fluorescens GIM 1.209, Lane 7: cDNA from Aeromonashydrophila ATCC 21763.

Figure 5–Detection of live S. putrefaciens by RT-LAMP. M: DL2000 Marker,Lane 1: cDNA from autoclaved S. putrefaciens, Lane 2: cDNA from activeS. putrefaciens, Lane 3: negative control, Lane 4: positive control.

Figure 6–RT-LAMP detection S. putrefaciens in fish sample. M: DL2000Marker, Lane 1: Distrilled water, Lane 2: supertanant from fish homogena-tion without S. putrefaciens, Lane 3: 5000 copies S. putrefaciens in fishhomogenation, Lane 4: 500 copies S. putrefaciens in fish homogenation,Lane 5: 50 copies S. putrefaciens in fish homogenation, Lane 6: positivecontrol.

method to specially detect live bacteria. The conditions for RT-LAMP were optimized to be incubated at 64.1 ◦C for 60 min,which was consistent with the optimized condition for virus de-tection by Yin and others (2010). The sensitivity of RT-LAMPcould be identified by the lower concentration of bacteria to5.4 copies/reaction, whereas that of PCR method was 1.08 ×103 copies/reaction, indicating that LAMP method is 200-foldsensitive than the standard PCR. The sensitivity of LAMP systemwas about 100-fold higher than a conventional RT-PCR, as alsoreported by other researchers (Caipang and others 2010; Wang andothers 2011). Aoi and others (2006) also indicated the sensitivityof LAMP could be down to 102 DNA copies of target DNA inmonitoring ammonia-oxidizing bacteria. Concerning the speci-ficity of the method, RT-LAMP allowed the detection of bothfish sample artificially contaminated by S. putrefaciens strains andspoilage fish samples. Shao and others (2011) developed a higherspecificity LAMP method named mLAMP-RFLP for simultane-ous detection of Salmonella strains and Shigella strains in milk with5 CFU/10 mL. From the above analysis, RT-LAMP was preferableto other molecular methods in detecting the existence of spoilageS. putrefaciens with rapidity (≤ 60 min), sensitivity and simplicityadvantages.

RT-LAMP had been reported to be widely used in the detectionof RNA-viruses in many references (Christopher and others 2004;Tohru and others 2006; Masahiro and others 2006). The qualityof RNA extraction was considered to be a key factor for the suc-cess of the method. In order to apply the method for detectinglive bacteria, RNA quality was the most important compared toRNA-virus for traces of DNA contamination would also signif-icantly affect the results. Therefore, establishing a high efficiencyRNA isolation strategy was very important to improve its speci-ficity. Nowadays, many commercial kits are available for mRNApurification from the eukaryotic cells based on the polyadeny-lated nature of eukaryotic mRNA. However, it was unfeasible topurify prokaryotes mRNA for its absence of polyadenylated tail.To overcome its disadvantage and collect RNA without DNAcontamination, poly A was added to the tails of ITS mRNA.Consistent with our hypothesis, the method could be clearly ableto differentiate live bacteria from the dead ones (Fig. 5).

ConclusionThe developed-RT-LAMP assay is an extremely sensitive, spe-

cific, and rapid diagnostic method for live S. putrefaciens detection.The method requires only simple conditions and less time to ob-tain a result compared with traditional gel electrophoresis. To ourknowledge, this is the first report to use the RT-LAMP techniquefor the detection of live bacteria. We recommend that this tech-nique be applied routinely in farm cultures and food processingfactories to eliminate early-stage contamination.

AcknowledgmentsThis work was financially supported by State Oceanic Ad-

ministration of the People Republic of China (Nr 2011418007),Ningbo Science Bureau of China (Grant Nr 2008C50027) and K.C. Wong Magna Fund at Ningbo Univ.

ReferencesAoi Y, Hosogai M, Tsuneda S. 2006. Real-time quantitative LAMP (loop-mediated isothermal

amplification of DNA) as a simple method for monitoring ammonia- oxidizing bacteria.J Biotechnol 125: 484–91.

Brian SB, Michael JM, Thomas JD. 1998. Design and application of two rapid screening tech-niques for isolation of Mn(IV) reduction-deficient mutants of Shewanella putrefaciens. ApplEnviron Microbiol 2716–20.

Vol. 77, Nr. 4, 2012 � Journal of Food Science M229

M:FoodMicrobiology&

Safety

RT-LAMP detecting live S. putrefaciens . . .

Caipang CM, Kulkarni A, Brinchmann MF, Korsnes K, Kiron V. 2010. Detection of Francisellapiscicida in Atlantic cod (Gadus morhua L) by the loop-mediated isothermal amplification(LAMP) reaction. Vet J 184:357–61.

Cangelosi GA, Brabant WH, Britschgi TB, Wallis CK. 1996. Detection of rifampin- andciprofloxacin-resistant Mycobacterium tuberculosis by using species-specific assays for precursorrRNA. Antimicrob Agents Chemother 40:1790–5.

Chaiyanan S, Huq A, Maugel T, Colwell RR. 2001. Viability of the nonculturable Vibrio choleraeO1 and O139. Syst Appl Microbiol 24:331–41.

Chen CC, Teng LJ, Kaiung S, Chang TC. 2005. Identification of clinically relevant viridansstreptococci by an oligonucleotide array. J Clin Microbiol 43:1515–21.

Christopher A, Caipang M, Ikumi H, Tsuyoshi O, Ikuo H, Takashi A. 2004. Rapid detectionof a fish iridovirus using loop-mediated isothermal amplication (LAMP). J Virol Methods121:155–61.

Criado-Fornelio A. 2007. A review of nucleic-acid-based diagnostic tests for Babesia and Theileria,with emphasis on bovine piroplasms. Parassitologia 1:39–44.

Dichristina TJ, DeLong EF. 1993. Design and application of rRNA-targeted oligonucleotideprobes for the dissimilatory iron- and manganese-reducing bacterium Shewanella putrefaciens.Appl Environ Microbiol 12:4152–60.

Gram L, Dalgaard P. 2002. Fish spoilage bacteria—problems and solutions. Curr Opin Biotech-nol 13:262–6.

Hirawati KK, Chauhan DS, Singh HB, Sharma VD, Singh M, Kashyap M, Katoch VM. 2006.Detection of M. leprae by reverse transcription-PCR in biopsy specimens from leprosy cases:a preliminary study. J Comm Dis 38:280–7.

Kurabachew M, Wondimu A, Ryon JJ. 1998. Reverse transcription-PCR detection of Mycobac-terium leprae in clinical specimens. J Clin Microbiol 36:1352–6.

Masahiro I, Masahiro W, Naoko N, Toshiaki I, Yoshinobu O, Notomi T. 2006. Rapid detectionand typing of influenza A and B by loop-mediated isothermal amplification: comparison withimmunochromatography and virus isolation. J Virological Methods 135:272–27.

Miller ND, Davidson PM, D’Souza DH. 2011. Real-time reverse-transcriptase PCR forSalmonella Typhimurium detection from lettuce and tomatoes. LWT – Food Sci Technol44:1088–97.

Miller ND, Draughon FA, D’Souza DH. 2010. Real-time reverse-transcriptase- polymerasechain reaction for Salmonella enterica detection from jalapeno and serrano peppers. FoodbornePathog Dis 7:367–73.

Myint S. 2002. Recent advances in the rapid diagnosis of respiratory tract infection. Br MedBull 61:97–114.

Plutzer J, Torokne A, Karanis P. 2010. Combination of ARAD microfibre filtration and LAMPmethodology for simple, rapid and cost-effective detection of human pathogenic Giardiaduodenalis and Cryptosporidium spp. in drinking water. Lett Appl Microbiol 50:82–8.

Reimann S, Grattepanche F, Rezzonico E, Lacroix C. 2010. Development of a real-time RT-PCR method for enumeration of viable Bifidobacterium longum cells in different morphologies.Food Microbiol 27:236–42.

Savan R, Igarashi A, Matsuoka S, Sakai M. 2004. Sensitive and rapid detection of edwardsiel-losis in fish by a loop-mediated isothermal amplification method. Appl Environ Microbiol70:621–4.

Shao Y, Zhu S, Jin C, Chen F. 2011. Development of multiplex loop-mediated isothermalamplification-RFLP (mLAMP-RFLP) to detect Salmonella spp. and Shigella spp. in milk. IntJ Food Microbiol 148(2):75–9.

Skjerdal OT, Lorentzen G, Tryland I, Berg JD. 2004. New method for rapid and sensitivequantification of sulphide-producing bacteria in fish from arctic and temperate waters. Intl JFood Microbiol 93:325–33.

Song T, Toma C, Nakasone N, Iwanaga M. 2005. Sensitive and rapid detection of Shigella andenteroinvasive Escherichia coli by a loop-mediated isothermal amplification method. FEMSMicrobiol Lett 243:259–63.

Techathuvanan C, Draughon FA, D’Souza DH. 2010. Real-time reverse transcriptase PCRfor the rapid and sensitive detection of Salmonella typhimurium from pork. J Food Protect73:507–14.

Tohru M, Tomoya K, Ram S, Masahiro S, Jiraporn K, Terutoyo Y, Toshiaki I, 2006. Detection ofyellow head virus in shrimp by loop-mediated isothermal amplication (LAMP). J VirologicalMethods 135:151–6.

Wang C, Lien K, Wang T, Chen TY, Lee GB. 2011. An integrated microfluidic loop-mediated-isothermal-amplification system for rapid sample pre-treatment and detection of viruses.Biosen Bioelectron 26:2045–52.

Yeh HY, Shoemaker CA, Klesius PH. 2006. Sensitive and rapid detection of Flavobacteriumcolumnare in channel catfish Ictalurus punctatus by a loop-mediated isothermal amplificationmethod. J Appl Microbiol 100:919–25.

Ying Q, Li T, Su X, Li Y, Zhou J, Cui J, Wang Z, Li S. 2011. Establishment of loop-mediated isothermal amplification method for detection of Bacillus pumilus. Biotechnol Bul-letin 2:179–83.

Yin S, Shang Y, Zhou G, Tian H, Liu Y, Cai X, Liu X. 2010. Development and evaluation ofrapid detection of classical swine fever virus by reverse transcription loop-mediated isothermalamplication (RT-LAMP). J Biotechnol 146:147–50

Zhao X., Li Y, Wang L, You L, Xu Z, Li L, He X, Liu Y, Wang J, Yang L, 2009.Development and application of a loop-mediated isothermal amplification method onrapid detection Escherichia coli O157 strains from food samples. Mol Biol Reports 37:2183–8.

M230 Journal of Food Science � Vol. 77, Nr. 4, 2012