development and verification of nested pcr assay for detection … · 2015-03-22 · is required...
TRANSCRIPT
![Page 1: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/1.jpg)
Journal of Bacteriology and Virology 2015. Vol. 45, No. 1 p.54 – 61 http://dx.doi.org/10.4167/jbv.2015.45.1.54
Development and Verification of Nested PCR Assay for Detection of Tobacco rattle virus in Plant Quarantine
Siwon Lee1, Jin-Young Lee2, Yong-Gil Shin2, Su-Heon Lee3* and Tae-Young Ahn4*
1Environmental Infrastructure Research Department, National Institute of Environmental Research, Incheon; 2Incheon International Airport Regional Office, Animal and Plant Quarantine Agency, Incheon; 3School of Applied Biosciences, Kyungpook National University, Daegu; 4Department of Microbiology, College of Natural Sciences,
Dankook University, Cheonan, Korea
Tobacco rattle virus (TRV) is a plant pathogen belonging to the Group IV positive-sense single-stranded RNA viruses. TRV causes disease in various plants (e.g., potato, tomato and tobacco), for which it was classified as a controlled quarantine virus in Korea. This study aimed to develop specific primer sets for the rapid detection of TRV. Two RT-PCR primer sets were developed for specific detection of TRV. Furthermore, nested primer sets were also developed, which is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products had the following sizes: set 5 (1,096→540 bp), and set 7 (878→756 bp), respectively. In addition, a modified positive-control plasmid was also developed for use as a positive control in TRV quarantine. The diagnostic system for TRV detection was verified using samples from Korean quarantine sites for the last five years (2009-2014). A total of 83 cases were detected among various import crops. This system for detection of TRV will continuously contribute to plant quarantine in the future.
Key Words: Tobacco rattle virus, Nested PCR, Quarantine
INTRODUCTION
수입개방화에 따라 다양한 종류의 식물들이 국내로 수
입되고 있으며, 이에 따라 잠재적 또는 동정되지 않은 병
원성 식물바이러스들이 함께 유입될 가능성이 높아지고
있다 (1). 이들은 유입 시 막대한 경제적 피해를 입힐 가
능성을 가지고 있어, 수출입 유통 시 철저한 관리가 필요
하다 (2). 우리나라에서는 위험평가를 통하여, 금지, 관리,
규제-비검역, 비검역 및 잠정규제 등으로 검역바이러스
를 지정하고 있다 (3). 이 중 Tobacco rattle virus (TRV)는
Group IV positive-sense single-stranded RNA virus에 속하는
바이러스로, 전체 핵산은 RNA 1 (약 7 kb)과 RNA2 (약
2~4 kb)로 약 11 kb 길이로 구성되며, 폭 22 nm 길이는
약 190 nm 또는 50~115 nm의 막대형이다. TRV는 식물
병원성 바이러스로 주로 즙액과 선충에 의해 전염되며 감
자, 토마토 및 담배 등 400여종 이상의 숙주를 가지며 자
연상태에서는 가지과 식물, 구근류 및 잡초에 발생할 수
있는 관리급 검역바이러스이다.
농림축산검역본부 예규 제107호와 식물병해충정보시스
템에 따르면, TRV는 수입 식물에서 가장 많은 검사를 수
행해야 하는 바이러스이며, 평균 검사건수는 연간 4,200
54
Received: December 12, 2014/ Revised: February 22, 2015/ Accepted: February 27, 2015
*Corresponding author: Su-Heon Lee. School of Applied Biosciences, Kyungpook National University, Daegu 702-701, Korea. Phone: +82-53-950-5763, Fax: +82-53-950-6758, e-mail: [email protected]
*Corresponding author: Tae-Young Ahn. Department of Microbiology, College of Natural Sciences, Dankook University, Cheonan 330-714, Korea. Phone: +82-41-550-3451, Fax: +82-41-550-3450, e-mail: [email protected]
**The present research was conducted by the Research Fund of Animal and Plant Quarantine Agency in 2006-2008. ○CC This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/license/by-nc/3.0/).
Communication
![Page 2: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/2.jpg)
Development of TRV Nested PCR Assay 55
건이다. TRV는 전 세계적으로 potato (4~6), greenhouse
and field specimens (7), soil (8, 9) 등 다양한 시료로부터의
감염 보고가 있으며, TRV를 진단하기 위한 RT-PCR (4,
6, 10), multiplex PCR (5), real-time RT-PCR (8, 11), real
multiplex PCR (12) 그리고 immunocapture real-time RT-PCR
(9) 검사법 등 다양한 방법이 개발되었다. 그러나 여러 연
구자들에 의해 개발된 PCR 검사법은 적용 조건이 서로
상이하여 여러 병원체를 동시에 검사하는 검역현장에서
의 활용이 불편하였으며, 검역병원체의 양성대조구를 확
보하기 어려워, PCR 검사 시의 실험오차 및 증폭 여부를
정확히 판정하기 어려운 한계점이 발견되었다 (2). 따라
서 본 연구에서는, TRV를 신속, 정확하게 진단하기 위하
여, 검역현장 요구에 부응하는 검사법이자 검출감도가 높
고 많은 연구로 안정성이 뛰어난 2단계 PCR 방법(RT-
PCR, nested PCR)을 개발하였으며, 실험실 오염으로 인한
거짓-양성반응을 판단할 수 있는 유전자변형-양성대조
구를 개발하였다. 또한 본 연구에서 개발한 방법을 사용
하여 최근 6년(2009-2014) 동안 검역현장에서 실증된 실
험 결과를 보고하고자 한다.
MATERIALS AND METHODS
시료수집
TRV 종 특이적 primer 선발에 사용할 TRV 및 10개의
참고바이러스 주[Alfalfa mosaic virus (AMV), Arabis mosaic
virus (ArMV), Cucumber mosaic virus (CMV), Pepper mottle
virus (PepMoV), Potato virus Y (PVY), Ribgrass mosaic virus
(RMV), Tobacco mild green mosaic virus (TMGMV), Tobacco
mosaic virus (TMV), Tomato mosaic virus (ToMV) 및 Tomato
spotted wilt virus (TSWV)] 이병시료, RNA 또는 cDNA는
금지품 수입허가를 통하여 구매(Adgen, England; Bione,
Korea) 또는 농촌진흥청 농업과학원 등의 유관기관에서
협조를 받아서 분석에 사용하였다.
Primer 설계
TRV 종 특이적인 진단용 primer 설계하기 위하여, TRV
RNA1을 코딩하는 염기서열(AF314165, AF406990, AF-
166084, X06172, D00155, AF034622 및 AJ586803)과 참고
바이러스 주 Pepper ringspot virus strain CAM (L23972)과
Pea early-browing virus strain SP5 (X14006)의 유전자 염기
서열을 National center for biotechnology information (NCBI)
로부터 확보하였다. Primer 제작은 이전에 기술되었던 방
법 (3)과 동일하게 DNAMAN software package version 6.0
(Lynnon Biosoft, Canada)을 사용하여 종 특이적인 염기서
열을 탐색하였다.
핵산 추출 및 primer 선발
시료에서 RNA 추출, one step RT-PCR, nested PCR, 전기
Figure 1. Map of primer design for detection of TRV
![Page 3: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/3.jpg)
56 S Lee, et al.
Table 1. RT-PCR amplification sets and product size for the detection of TRV
Set Forward primer (location) Reverse primer (location) Product size (bp)
1 TRV-N50 (6,233~6,257) TRV-C10 (6,572~6,593) 340
2 TRV-N40 (4,998~5,021) TRV-C20 (5,246~5,270) 273
3 TRV-N30 (4,540~4,561) TRV-C20 (5,246~5,270) 731
4 TRV-N30 (4,540~4,561) TRV-C30 (4,995~5,019) 480
5 TRV-N20 (2,782~2,805) TRV-C40 (3,857~3,877) 1,096
6 TRV-N10 (1,459~1,481) TRV-C50 (2,459~2,477) 1,019
7 TRV-N10 (1,459~1,481) TRV-C60 (2,314~2,338) 880
A
B
Figure 2. Results of selection of TRV RT-PCR primer sets. Panel (A), First selection of specific RT-PCR primer sets for the detection ofTRV. M, 100 bp step DNA Ladder maker (Genepia, Korea); dot, selected PCR primer set; Lane number, primer set for detection of TRV. Panel (B), Second selection of specific RT-PCR primer sets for the detection of TRV. Lane M, 100 bp step DNA Ladder maker (Genepia); lane AM, Alfalfa mosaic virus; lane Ar, Arabis mosaic virus; lane CM, Cucumber mosaic virus; lane Pe, Pepper mottle virus; lane PY, Potatovirus Y; lane RM, Ribgrass mosaic virus; lane TG, Tobacco mild-green mosaic virus; lane TM, Tobacco mosaic virus; lane To, Tomato mosaicvirus; lane TS, Tomato spotted wilt virus.
![Page 4: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/4.jpg)
Development of TRV Nested PCR Assay 57
영동 및 특이적 primer 선발 방법은 이전에 수행했던 방
법과 동일한 방법을 사용하였으며 (3), 검출감도를 검정
하기 위하여 TRV RNA를 10-8까지 10배 단계 희석하여
분석에 사용하였다.
유전자변형-양성대조구 제작
검역현장에서 사용할 수 있는 PCR 진단시스템을 개발
을 위한 TRV 유전자변형-양성대조구 플라스미드를 제작
하기 위하여, pGEM®-T easy vector (Promega, USA)와 site-
directed mutagenesis kit (Enzynomics, Korea)를 사용하였다
(13).
현장검증
본 연구에서 개발한 RT-PCR, nested PCR 및 유전자변형
-양성대조구 등의 진단시스템을 사용하여, TRV와 관련된
수입 작물 (14)에서 2009년부터 2014년까지 6년간 검사를
수행하였다. 검사에 대한 기록은 농림축산검역본부 병해
충정보시스템을 통해 확인하였다.
Table 2. Final selection of RT-PCR and nested primer sets for the detection of TRV
Primer Sequence (5'→3') Product size (bp)
Set 5 TRV-N20 CGCGGTCGAAAGGATGAGTGATTA
1,096 TRV-C40 TCCCGGAAACAAAGCGTCGTA
Nested primer of set 5 TR-N22 GTAAGTCGACAATGATTGTC
543 TR-C45 GAAGGAAAGTTATGTACTGAG
Set 7 TRV-N10 GGCCGTGAAGAACAAGCAAAGTG
880 TRV-C60 TTGTACCGCTTGTTTCCCCTCTT
Nested primer of set 7 TR-N11 GATTCTCGAGATTTACAGTTG
760 TR-C62 TGCTCCATGATCTCCTCATC
Figure 3. RT-PCR sensitivity test on the selective primer sets for TRV.
Figure 4. Result of selected RT-PCR and nested-PCR productsfor the detection of TRV. Lane M, 100 bp step DNA Ladder; lane1, final selected primer set #5 (1,096 bp); lane 2, nested-PCRproduct from primer set #5 (543 bp); lane 3, final selected primerset #7 (880 bp); lane 4, nested-PCR product from primer set #7(760 bp).
![Page 5: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/5.jpg)
58 S Lee, et al.
RESULTS AND DISCUSSION
TRV를 특이적으로 검출하기 위한 primer는 총 12개(정
방향 7개, 역방향 8개)를 제작하였고(Fig. 1), 제작된 primer
들을 조합하여 273~1,096 bp 크기의 PCR 산물로 증폭이
가능한 7개의 조합을 구성하였다(Table 1). TRV 주형 RNA
및 참고바이러스 주 들의 총 핵산의 최초 농도는 약 20~
500 ng/μl였다. TRV를 주형으로 한 종 특이적 실험 결과,
7개 조합 중 반응강도가 뛰어나고 진단에 장해가 되는
비특이적 반응을 보이지 않는 6개의 조합을 선발하였다
(Fig. 2A). 1차로 선발된 6개 primer 조합으로 TRV 유연
관계 바이러스 또는 기주 식물과 관련된 10가지 바이러
스와의 특이적 반응을 보이지 않는 조합 5 (1,096 bp)와
조합 7 (878 bp) (Fig. 2B)을 최종 선발하였으며(Table 2),
최종 선발한 두 조합의 검출감도를 실험한 결과 각각
10-2와 10-4으로 분석되어(Fig. 3), TRV를 검출하기에 적합
한 primer 조합으로 확인되었다. 또한, 최종 선발된 TRV
RT-PCR 조합 5의 nested PCR primer는 540 bp를 조합 7의
nested PCR primer는 756 bp 크기의 PCR 산물을 각각 증
Figure 5. BamH I sequence insertion of the TRV genetically modified-positive control plasmids.
![Page 6: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/6.jpg)
Development of TRV Nested PCR Assay 59
Table 3. Results of detection for TRV from plant quarantine sites in 2009-2014
Item Year (number of detection)
Total 2009 2010 2011 2012 2013 2014
Bulb (119 cases) Gladiolus 5 5
Nectaroscordum 1 1
Dahlia 1 1
Leucocoryne 1 2 3
Ranunculus 1 1
Garlic 1 1
Druce 1 1
Poison 1 1
Lily 1 1 2
Narcissus 3 11 1 2 6 15 38
Snowflake 1 1
Anemone 1 2 4 8 15
Amaryllis 1 1
Iris 1 1
Alium 1 12 5 18
Alstromeria 1 1
Ornithogalum 1 1
Orange Daylily 1 1
Calochortus 1 1
Crocus 1 1 4 6
Tulip 3 3
Puschkinia 1 1
Ornamental Plants Etc. 1 4 5
Hemerocalis 1 1
Hyacinth 5 1 3 9
Seed (16 cases) Hot pepper 3 3 6
Iceland Poppy 1 1 2
Tomato 1 1 1 3 6
Paprika 1 1 2
Etc. (1 case) Shallot 1 1
Total 9 19 3 14 28 63 136
![Page 7: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/7.jpg)
60 S Lee, et al.
폭하였다(Fig. 4 and Table 2).
본 연구에서 개발한 TRV 종 특이적 primer 조합은
TRV strain ppK20 RNA1 (NCBI accession number AF314165)
을 기준으로 조합 5 (location 2,782~3,877)와 조합 7
(location 1,459~2,336)로, 이것을 증폭하는 산물을 얻기가
어려워 조합 5와 7에 대한 각각의 유전자변형-양성대조
구 플라스미드를 개발하였다. 그 결과, 조합 5는 염기서
열 'GGA'를, 조합 7은 염기서열 'GG'가 삽입된 것이 분석
되어 nested PCR 증폭산물 부위에 제한효소 site (BamH I;
GGATCC)를 삽입이 확인되었다(Fig. 5). 따라서 양성대조
구로부터 오염이 있을 경우 다음의 2가지 증상이 나타날
것이라고 예상된다; i) 각각의 nested PCR 산물에서 제한
효소 BamH I가 반응하면 조합 5는 362와 561 bp 크기의,
조합 7은 364, 396 bp 크기의 PCR 산물이 생산되어 각각
2개씩의 밴드가 관찰될 것이고, ii) nested PCR 산물의 염
기서열을 multiple sequence alignment하면 조합 5와 7에서
는 삽입한 각각 3개와 2개의 염기서열이 추가로 분석될
것이다(Supplementary Fig. S4).
TRV는 국내에서는 농림축산검역본부 예규 제 107호
에 의거하여 다음의 다양한 수입 종자 및 식물로부터
검사를 수행한다; 종자류[감자(Solanum tuberosum), 고추
(Capsicum annuum)(파프리카 포함), 사탕무(Beta vulgaris var.
saccharifera), 양귀비(Papaver rhoeas), 토마토(Lycopersicon
esculentum), 팬지(Viola tricolor var. hortensis)], 식물류[감
자(Solanum tuberosum), 강낭콩(Phaseolus vulgaris), 고추
(Capsicum annuum)(파프리카 포함), 글라디올러스속(Gladi-
olus spp.), 다알리아속(Dahlia spp.), 담배(Nicotiana tabaccum),
라넌큘러스구근(Ranunculus repens), 류코코리네속(Leuco-
coryne spp.), 배추속(Brassica spp.), 백합속(Lilium spp.), 사
탕무(Beta vulgaris), 상추(Lactuca sativa), 수선화속(Narcissus
spp.), 스노우드롭구근(Galanthus nivalis), 시클라멘속
(Cyclamen spp.), 아네모네속(Anemone spp.), 아이리스속
(Iris spp.), 아티초크(Cynara cardunculus), 알리움속(Allium
spp.), 알스트로메리아속(Alstromeria spp.), 옥잠화속(Hosta
spp.), 이키시아속(Ixia spp.), 칼라속(Zantedeschia spp.), 쿠
르쿠마속(Curcuma spp.), 크로커스속(Crocus spp.), 토마토
(Lycopersicon esculentum), 튤립속(Tulipa spp.), 팬지(Viola
tricolor), 풀협죽도속(Phlox spp.), 프리지아속(Freesia spp.),
호밀(Secale cereale) 및 히야신스 구근(Hyacinthus orientalis).
농림축산검역본부 인트라넷인 병해충정보시스템에 의하
면, TRV는 최근 6년(2009-2014) 동안 약 133종류의 작물
로부터 약 23,000건의 검사가 수행되었다. 이 중 검출 건
수는 총 83건으로, 우리나라 식물검역바이러스 100종
(14) 중 Cucumber green mottle mosaic virus에 이어 2번째
로 많은 검출이 분석되고 있는 것으로 확인되었다. 연도
별 검출 경향을 살펴보면, TRV는 2009년 9건, 2010년
19건, 2011년 3건, 2012년 14건, 2013년에 28건 및 2014년
63건으로 검출이 증가하는 추세가 분석된다. 또한 최근
6년간 수선구근(38건), 알리움구근(18건), 아네모네구근
(15건) 및 히야신스구근(9건) 등 구근류 119건으로 TRV
검출이 높았으며, 종자 16건 및 기타(종구용 쪽파 1건)으
로 총 136건이었다(Table 3).
식물검역에 사용하는 검사법 개발에는 첨단 검사법을
활용한 정밀성 확보와 함께 검사의 용이성과 검사법 개
발의 표준화가 매우 중요하며, 대량 수입검역검사에 반드
시 필요한 편의성과 검사결과에 대한 진위여부를 검증할
수 있는 시스템이 포함하여야 한다 (15). 본 연구에서 개
발한 TRV 검역진단 시스템은, 앞서 보고된 방법(1~3, 16)
들과 함께 향후 식물검역에 기여할 것이라고 기대된다.
REFERENCES
1) Lee S, Kang EH, Heo NY, Kim SM, Kim YJ, Shin YG.
Detection of Carnation necrotic fleck virus and Carnation
ringspot virus using RT-PCR. Res Plant Dis 2013;19:36-44.
2) Lee S, Kang EH, Chu YM, Shin YG, Ahn TY. Development
of PCR diagnosis system for plant quarantine seed-borne
Wheat streak mosaic virus. Korean J Microbiol 2013;49:112-7.
3) Lee S, Shin YG. Development and practical use of RT-PCR
for seed-transmitted Prune dwarf virus in quarantine. Plant
Pathol J 2014;30:178-82.
4) Nicolaisen M, Bösze Z, Nielsen SL. Detection of Tobacco
rattle virus in potato tubers using a simple RT-PCR procedure.
Potato Research 1999;42:173-9.
5) Wei T, Lu G, Clover GRG. A multiplex RT-PCR for the
detection of Potato yellow vein virus, Tobacco rattle virus and
Tomato infectious chlorosis virus in potato with a plant internal
amplification control. Plant Pathology 2009;58:203-9.
6) Pérez EE, Weingartner DP, Hiebert E, McSorley R. Tobacco
rattle virus detection in potato tubers from northeast Florida
by PCR and tissue blotting. Amer J of Potato Res 2012;77:
363-8.
7) Riga E, Larsen R, Eastwell K, Guerra N, Guerra L, Crosslin JM.
![Page 8: Development and Verification of Nested PCR Assay for Detection … · 2015-03-22 · is required for high sensitivity detection in plant quarantine. The RT-PCR and nested PCR products](https://reader033.vdocument.in/reader033/viewer/2022041801/5e5181a66793ce52cb735e7f/html5/thumbnails/8.jpg)
Development of TRV Nested PCR Assay 61
Rapid detection of Tobacco rattle tobravirus in Viruliferous
paratrichodorus allius from greenhouse and field specimens. J
Nematol 2009;41:60-3.
8) Kenyon DM, Handy CL, Thomas JE. Detection of Tobacco
rattle virus in soil using real-time PCR. Aspects of Applied
Biology 2005;76:77-9.
9) Yang JG, Wang FL, Chen DX, Shen LL, Qian YM, Liang ZY,
et al. Development of a one-step immunocapture real-time
RT-PCR assay for detection of Tobacco mosaic virus in soil.
Sensors 2012;12:16685-94.
10) Xu H, Nie J. Molecular detection and identification of potato
isolates of Tobacco rattle virus. Canadian J Plant Pathol 2006;
28:271-9.
11) Holeva R, Phillips MS, Neilson R, Brown DJF, Young V,
Boutsika K, et al. Real-time PCR detection and quantification
of vector trichodorid nematodes and Tobacco rattle virus. Mol
Cell Probes 2006;20:203-11.
12) Mumford RA, Walsh K, Barker I, Boonham N. Detection of
Potato mop top virus and Tobacco rattle virus using a multi-
plex real-time fluorescent reverse-transcription polymerase
chain reaction assay. Phytopathology 2000;90:448-53.
13) Shin YG, Rho JY. Development of a PCR diagnostic system
for Iris yellow spot tospovirus in quarantine. Plant Pathol J
2014;30:440-4.
14) Animal, Plant and Fisheries Quarantine and Inspection Agency.
List of plant quarantine viruses in Korea newly revised in
2013. Res Plant Dis 2013;19:67-75.
15) Shin YG. An advanced quarantine system for the inspection of
seed-borne viruses in Korea. 2009.
16) Lee S, Kang EH, Shin YG, Lee SH. Development of RT-PCR
and nested PCR for detecting four quarantine plant viruses
belonging to Nepovirus. Res Plant Dis 2013;19:220-5.