development of a screening assay for homologous ...€¦ · of the crispr/cas9 system through...

Ghent University – Department of Plant Biotechnology and Bioinformatics

VIB – Center for Plant Systems Biology

Research Group: Plant Genome Editing

Development of a screening assay for

homologous recombination and optimization

of the CRISPR/Cas9 system through promoter

analysis

Ward Develtere

Student number: 01306137

Promotors: Prof. Moritz Nowack and Dr. Thomas Jacobs

Scientific supervisor: Ward Decaestecker

Master’s dissertation submitted to Ghent University to obtain the degree of Master of Science in Biochemistry and

Biotechnology. Major Plant Biotechnology

Academic year: 2018 - 2019

Table of contents

List of abbreviations .......................................................................................................................

Abstract .........................................................................................................................................

I. Introduction ...................................................................................................................... 1

1. Double-strand break repair ................................................................................................... 4

2. Editing efficiency .................................................................................................................... 7

3. Germline-editing .................................................................................................................. 13

II. Aim ................................................................................................................................. 15

III. Results ............................................................................................................................ 16

1. Promoter comparison .......................................................................................................... 16

2. BFP-to-GFP conversion assay ............................................................................................... 25

IV. Discussion ....................................................................................................................... 37



3. Conclusions .......................................................................................................................... 44

V. Materials and methods ................................................................................................... 45



3. Acknowledgments ............................................................................................................... 49

VI. References ...................................................................................................................... 50

VII. Addendum ..........................................................................................................................

1. Primers .....................................................................................................................................

2. Protocols ..................................................................................................................................

3. Additional results .....................................................................................................................

List of abbreviations

ABE Adenosine base editor

ALS ACETOHYDROXYACID SYNTHASE

a-NHEJ/MMEJ Alternative NHEJ pathway/Microhomology-mediated end joining

AS Acetosyringone

bp Base pair

BY-2 Tobacco Bright Yellow-2

CaMV Cauliflower mosaic virus

Cas CRISPR-associated

CBE Cytosine base editor cgRNA Chimeric single-guide RNA

c-NHEJ Classical NHEJ pathway

CRISPR Clustered regularly interspaced short palindromic repeats

crRNA CRISPR-RNA

D-loop Displacement loop

DNA-PK DNA-dependent protein kinase DSB Double-strand break

DSBR Double-strand break repair

eGFP/eBFP Enhanced GFP/BFP

FACS Fluorescence-activated cell sorting

FAST Fluorescence-accumulating seed technology

FSC Foward scatter gDonor gRNA-donor DNA conjugate GFP/BFP/RFP Green/Blue/Red fluorescent protein

GL1 GLABRA1

gRNA Guide RNA

GT Gene targetting HR Homologous recombination

Indel Insertion and/or deletion

KO Knockout

MES 2-( N -morpholino) ethanesulfonic acid

MRN/MRX MRE11-RAD50-NBS1/MRE11-RAD50-XRS2

MSMO MS medium with minimal organics NHEJ Non-homologous end joining

NLS Nuclear localization signal

OLE1 OLEOSIN1

ORF Open reading frame

PAM Protospacer-adjacent motif

PDS PHYTOENE DESATURASE RGS Rifampicine, Gentamycin, Streptinomycin SaCas9 Cas9 from Staphylococcus aureus

SAM Shoot apical meristem

SDSA Synthesis-dependent strand-annealing

SMRT Single-molecule real-time

SpCas9 Cas9 from Streptococcus pyogenes

SPL SPOROCYTELESS

SSC Side scatter

ssDNA Single-strand DNA

TAD Transcriptional activation domain TALEN Transcription activator-like effector nuclease

TIDER Tracking insertions, deletions and recombination events

TLR Traffic light reporter

tracrRNA Trans-activating RNA

ZFN Zinc finger nuclease

Abstract

Genome editing has seen immense progress with CRISPR/Cas-mediated genome engineering. Mutations can be generated with high specificity and efficiency. The technique is particularly suitable in reverse genetics to create knockouts of genes of interest, although it is often still a struggle to generate mutations that are passed on to the next generation, i.e. mutations fixed in the germline. In this study, several promoters for Cas9 were evaluated and compared in Arabidopsis to find the promoters that are optimal in generating these fixed mutations. Promoters from genes with different expression patterns were tested: PcUBI, RPS5A, YAO, EC1, CLV3, P16, and HMG. Our data show that the egg cell-specific (EC1) and constitutively active promoters PcUBI, RPS5A, and HMG are two to three times more efficient in the creation of heritable mutations than the tissue-specific promoters YAO and CLV3. We conclude that the HR efficiency was not

significantly improved by replacing the standard promoter PcUBI with another constitutive or tissue-specific promoter.

Although HR has many applications in genome editing (such as specific nucleotide substitutions or complete gene insertions), in plants it only occurs 0.01 to 1% of the time (compared to 5 - 20% in animal cells), making it a very inefficient process. Assays to measure the HR frequency have predominantly been reported for animal systems. Here, we developed a screening method in tobacco Bright Yellow-2 and Arabidopsis PSB-D cell cultures. The assay employs a reporter line stably expressing a blue fluorescent protein (BFP). The reporter line is transformed with Cas9 targeting the BFP gene, and a template containing the necessary substitution to convert BFP to GFP. An estimate on the HR frequency can be made based on the number of GFP-expressing cells. Using the assay, we compared three different guides and four templates with different homology

arm lengths in their efficiency to repair a DSB using the HR pathway. The data showed that the guide choice can have a large impact on the HR efficiency. Based on this, it is recommended to include multiple guides in CRISPR/Cas studies to increase the chance for high HR efficiency. Additionally, we observed that increasing the length of the homology arms from 50 to 200 bp resulted in a 5.5-fold HR increase. This suggests that increasing the homology arms could be used as a way to boost HR.

Introduction

1

I. Introduction

Mutations are a key ingredient for evolution. Through changes in the DNA sequence, new characteristics can be introduced. These changes include point mutations, inversions, deletions, duplications, expansions and so on. Mutations can occur naturally or be induced through human activity. Humans have been using mutation-inducing agents, such as radiation or chemical compounds (e.g. ethyl methanesulfonate) for over 70 years in search for more favorable organisms. Mutations created through these methods are largely random however, resulting in unpredictable changes. In agriculture, crop varieties often have to complete a long and rigorous selection process to obtain the crop with the traits of interest. During the 1970s and 1980s the first targeted gene editing procedures were performed (Scherer, 1979; Smithies et al, 1985; Thomas et al, 1986). The editing was done through homologous recombination but was very inefficient at the

time. It was not until the discovery that double-strand DNA breaks (DSB) significantly increase the frequency of homologous recombination that specific genome editing became a real possibility

(Rudin et al, 1989; Plessis et al, 1992; Rouet et al, 1994). A DSB can be repaired through two major pathways: non-homologous end joining (NHEJ) or homologous recombination (HR). In NHEJ, the generated ends are processed and ligated back together. This is often accompanied by a frameshift mutation that can lead to a premature stop-codon and thereby rendering the translated protein non-functional. For HR to take place, a homologous sequence is required that can be used as a template for repair. Even in the presence of a suitable template, NHEJ is the preferred repair mechanism in higher eukaryotes (Feng et al, 2014).

Zinc-finger nucleases (ZFN) were one of the first gene-targeting tools. The system is based on zinc

finger domains in certain transcription factors. Each domain recognizes and binds three base pairs (bp). Zinc finger domains for each of the 64 codons have been identified, meaning in theory, every sequence can be targeted. Next to the zinc finger domains, the system contains a DNA-cleavage domain, the FokI nuclease catalytic domain, which is able to introduce a DSB in any targeted DNA sequence. FokI requires dimerization for its function, increasing its specificity. The construction of the ZFN system is, however, quite complex and has a high failure rate. A second generation programmable nuclease is transcription activator-like effector nuclease (TALEN). The system is similar to that of ZFN, but the zinc finger domains are replaced by a series of transcription activator-like effectors (TALEs). TALEs are naturally occurring proteins produced by the plant pathogenic bacteria Xanthomonas. They are injected into plant cells and bind promoter sequences to stimulate transcription of genes required for further infection. TALEs have the advantage over zinc fingers,

because they recognize specific nucleotides individually, as opposed to three nucleotides. This allows for greater design flexibility. Due to the highly repetitive nature of TALEs, cloning of the system can be more challenging, however. The focus of this thesis is on a third generation of genome editing tools, CRISPR/Cas, which will be more extensively discussed.

Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) (Jansen et al, 2002) are found in the genomes of prokaryotes and archaea. They are composed of direct repeats, separated by unique sequences (spacers) of various lengths. Genes associated with these CRISPR loci are aptly named CRISPR-associated (Cas) genes. Many Cas genes have been discovered (Zhang et al, 2014; Makarova et al, 2015; Koonin & Makarova, 2017). It was suggested by Mojica et al (2005), and later

Introduction

2

verified in several studies, that the CRISPR/Cas system is involved in the defense against foreign DNA (Mojica et al, 2005; Bolotin et al, 2005; Barrangou et al, 2007; Hale et al, 2009; Horvath & Barrangou, 2010; Marraffini & Sontheimer, 2008; Barrangou & Marraffini, 2014; Brouns et al, 2008). The spacers between the repeats are derived from previous infection events. In a process known as ‘adaptation’, a DNA fragment of an invader, most commonly a phage, is incorporated into the CRISPR array (Barrangou et al, 2007). Upon infection, the CRISPR array is transcribed and further processed into CRISPR-RNAs (crRNAs), containing one spacer each (Brouns et al, 2008). The crRNA, together with a trans-activating RNA (tracrRNA), forms a complex with one or more Cas endonucleases (Nishimasu & Nureki, 2017; Mekler et al, 2016) and functions as a guide to the intruding DNA (or RNA for some Cas systems). After recognition, Cas cleaves the target DNA, preventing its proliferation (Jinek et al, 2012). Importantly, for Cas to be able to introduce a DSB, a

protospacer-adjacent motif (PAM) sequence is required to be present following the target sequence. The PAM sequence is 2 - 6 bp long and is specific for each Cas endonuclease (e.g. NGG for Cas9). The PAM sequence is absent from the bacterial CRISPR locus, allowing Cas to distinguish

between the invading DNA and foreign DNA collected from a previous infection in the CRISPR locus. Next to attacking viral targets, the CRISPR/Cas adaptive immune system has been shown to additionally block horizontal gene transfer in staphylococci (Marraffini & Sontheimer, 2008) and play a role in gene regulation, DNA repair, and genome evolution by self-targeting (Westra et al, 2014).

The CRISPR/Cas system can be used as a programmable RNA-guided endonuclease capable of producing mutations with high specificity. Using a crRNA (or single guide RNA; (Jinek et al, 2012)) complementary to the target sequence of interest, a specific DSB can be generated by Cas (Fig. 1).

The advantage of the CRISPR/Cas method for generating targeted mutations over other methods such as ZFN and TALEN, is its multiplexing capabilities (targeting multiple sequences) (Cong et al, 2013), its versatility and efficiency, and the relative ease of the design and assembly of the constructs. Important drawbacks of the CRISPR/Cas system compared to ZFN and TALEN are the necessity of a PAM in the target sequence and the higher off-target mutation frequency (Fu et al, 2013; Hsu et al, 2013; Pattanayak et al, 2013). However, the off-target mutation tendencies of CRISPR/Cas can be used as an advantage. Endo et al (2015) showed that the lower specificity can be exploited to induce multihomeologous and multiparalogous gene knockouts. Cas9 from Streptococcus pyogenes (SpCas9) has been, and still, is the most popular Cas endonuclease to create DSBs in CRISPR/Cas editing studies, most likely because of its short PAM sequence: NGG. It has, however, been shown that the smaller Cas9 endonuclease from Staphylococcus aureus

(SaCas9) is more efficient due to its higher reaction turnover (Yourik et al, 2019; Wolter et al, 2018; Huang & Puchta, 2019). Cas9 contains a nuclease lobe with two nuclease domains, RuvC and HNH. RuvC cleaves the strand non-complementary to the guide sequence, while HNH cuts the complementary strand (Nishimasu et al, 2014).

Building upon the targeting system of CRISPR/Cas9, a mechanism for base editing, without the introduction of DSBs, has been developed (Komor et al, 2016). CRISPR base editors consist of a gRNA, a Cas9 nickase (or dead Cas9), and a cytidine or adenine deaminase (Gaudelli et al, 2017). The endonuclease function of Cas9 is partially destroyed in the Cas9 nickase variant by changing critical amino acids in the RuvC or HNH nuclease domains (or both domains in dead Cas9). The

Introduction

3

gRNA can direct the Cas9 to a specific sequence, but no DSB can be introduced. The DNA deaminase is fused to the Cas9 and thus also guided to the sequence of interest. The cytosine base editors (CBE) convert cytosine into uracil by removing the amine group. Through the cell’s base excision repair mechanism the resulting uracil-guanosine mismatch is resolved into uracil-adenosine and finally to thymine-adenine. Therefore, CBEs can be used to convert cytosine into thymine. Similarly, adenosine base editors (ABE) convert adenosine in guanosine. Together they can create all four transitions by targeting either the sense or antisense strand. Transversions are not possible using the base editors.

The base editor is most active in a particular catalytic window in a relative distance from the PAM sequence, depending on the nuclease and deaminase. The editing efficiency is the highest in the catalytic window, which is approximately five bp. These editors can generate precise mutations

without the need for DSBs, avoiding random mutations such as insertions and deletions (indels)

NHEJ HR

Figure 1: CRISPR/Cas-mediated DNA engineering. The Cas endonuclease forms a complex with the guide RNA (gRNA) and

scans the DNA for a sequence complementary to crRNA. Once the CRISPR/Cas complex found its target and a PAM

sequence is present, the Cas endonuclease cuts DNA resulting in a double-strand DNA break (DSB). DSBs are repaired

either by non-homologous end joining (NHEJ) or homologous recombination (HR). Figure adapted and modified from

Synthego.

Introduction

4

(although a low frequency of indels after base editing has been reported (Komor et al, 2017)). Furthermore, the system does not depend on homologous recombination, resulting in a much higher editing efficiency compared to homology-directed repair mechanisms. The main disadvantage is the requirement of a PAM sequence in a specific window from the base of interest. Using different nucleases (either different Cas nucleases, e.g Cas12a, or Cas nucleases from different species, such as SaCas9), PAM sequences that are recognized can be changed. Still, it might be challenging to find a nuclease that is ideal for the sequence of interest. In addition, when multiple cytosines (or adenosine in the case of ABE) are present in the catalytic window, it is very challenging to modify one specific cytosine. Nevertheless, the base editing system has a lot of potential for future applications in medical therapies and can already be used in plants (Zong et al, 2017; Hua et al, 2018; Yan et al, 2018).

1. Double-strand break repair

DNA damage can originate from within the cell, due to replication errors, reactions with reactive oxygen species, transposons (Morisato & Kleckner, 1984) or post-translational modifications. Damage can also be the result of external factors, such as radiation, DNA-intercalating compounds, and other physical and chemical agents. The DNA lesions can occur on one or both DNA strands, in the form of single-strand breaks, alkylation, oxidation, base losses, and double-strand breaks respectively. In plants, a common form of DNA damage is pyrimidine dimers, caused by UV radiation. Unrepaired damages can lead to aberrant or lethal phenotypes. To avoid the accumulation of damaged DNA, several repair mechanisms exist. Lesions on a single strand are

typically repaired by photo-reactivation (specifically for pyrimidine dimers), base excision repair, nucleotide excision repair or mismatch repair. The two major repair pathways for double-strand breaks are non-homologous end joining (NHEJ) and homologous recombination (HR). In the context of genome editing, a focus is placed on double-strand break repair, since editing is often done by cutting both strands and relying on the plant’s repair mechanisms to make the desired change. Although NHEJ is more error-prone, it is the predominant form of DSB repair in higher eukaryotes. Both pathways are, however, not strictly competitors, but often work together to help maintain genome integrity. It has been shown that mice containing a mutation in both an NHEJ and HR protein results in decreased survival compared to mice with a mutation in a protein of one of the pathways (Couëdel et al, 2004). Similar experiments have yet to be performed in plants. The choice of repair type depends on several aspects such as cell type, the phase in the cell cycle, and

the type of DNA damage.

Non-homologous end joining

The NHEJ pathway has predominantly been studied in animal and yeast cells but appears to be considerably conserved among all eukaryotes. The pathway is independent of a homologous template for repair. Double-strand breaks are recognized by KU70/KU80 heterodimer complexes within seconds (Mari et al, 2006). They bind at the DSB, where they protect the ends from nucleases and bring them closer together. The complex is part of a larger NHEJ component: the

Introduction

5

DNA-dependent protein kinase (DNA-PK). Next to the KU70/80 DNA binding complex, DNA-PK contains a kinase subunit, DNA-PKcs, which activates itself and other NHEJ factors by phosphorylating their serine and threonine residues (Uematsu et al, 2007). A homolog for the DNA-PKcs in plants has not yet been identified. The ends are processed (to introduce correct phosphor- and hydroxyl groups) and are ligated back together by ligase IV, with the help of XRCC4 (Francis et al, 2014). NHEJ is often accompanied by sequence rearrangements such as indels or substitutions. If the rearrangement occurs in an open reading frame (ORF), it could knock out the protein as a result of a frameshift or as a result of a substitution of one or several essential amino acids. Rearrangements in regulatory sequences might also alter the expression of their corresponding genes. Next to the classical NHEJ pathway (c-NHEJ), an alternative pathway (a-NHEJ), also known as microhomology-mediated end joining (MMEJ), has been identified. This mechanism is

independent of the KU70/KU80 complex and XRCC4. It makes use of a short homologous sequence (5 - 25 bp), DNA polymerase θ, and always results in a deletion (McVey & Lee, 2008). The c-NHEJ pathway is active throughout the complete cell cycle. The a-NHEJ is only active in the absence of

c-NHEJ (e.g. due to a lack of DNA ligase or components of the KU complex) (Chang et al, 2017).

Homologous recombination

A more accurate repair mechanism is HR, which requires a donor template to repair the damaged DNA (Fig. 2). Studies on HR have mainly been conducted on yeast and animal cells. The process starts by recruitment of the CtIP endonuclease and the MRE11-RAD50-NBS1/MRE11-RAD50-XRS2 (MRN/MRX, in mammals and yeast respectively) complex to the DSB. The complex is thought to be

involved in resection of the 5’ end by facilitating access for nucleases, such as EXO1 and DNA2, and the SGS1 helicase (Llorente & Symington, 2004; Mimitou & Symngton, 2008). The resulting 3’ single-strand DNA (ssDNA) stretches are a binding site for the ATPase RAD51. Replication protein A has a strong binding affinity for ssDNA, hence a few of mediator proteins are required for their displacement, giving access to RAD51. Mediators include BRCA2 in mammalian cells (Zhao et al, 2015), and RAD52 in mammalian and yeast cells (Sugiyama & Kowalczykowski, 2002). Formation of the RAD51 nucleoprotein filament, also called presynaptic filament, requires binding, but not

hydrolysis of ATP (Sung & Stratton, 1996). The presynaptic filament searches for a sequence homologous to the 3’ overhang. Through an ATP-dependent process, the strand invades the homologous DNA donor, giving rise to a displacement loop (D-loop). The strand invasion activity of RAD51 is strongly stimulated by the interaction with the ATPase RAD54 (Petukhova et al, 1998).

The DNA polymerase then extends the invading 3’, using the donor sequence as a template, thereby forming a so-called Holliday junction (Fig. 2A). The donor sequence is often found on the homologous chromosome.

After these initial steps, two main pathways can be followed: the double-strand break repair (DSBR) (Fig. 2B) or synthesis-dependent strand-annealing (SDSA) (Fig. 2C) pathway. In the DSBR model, also known as the double Holliday model, the 5’ end not involved in the strand invasion anneals to the D-loop, creating a second Holliday junction. The double Holliday junction can then be resolved by an endonuclease of the resolvase family. The product of the cleavage is a crossover between both DNA molecules.

Introduction

6

Figure 2: Repair pathway of double-strand

DNA breaks by homologous recombination.

(A) Repair of a DSB by HR starts with

resection of the 5’ ends, resulting in

overhanging 3’ ends, allowing strand

invasion and formation of the D-loop and

Holliday junction. Next, the break is repaired

either through double-strand break repair

(DSBR) or synthesis-dependent strand

annealing (SDSA). (B) In DSBR, a second

Holliday junction is formed and gaps are

repaired. Resolved Holliday junctions can

result in either crossover or non-crossover

products. (C) In SDSA, the Holliday junction

is displaced, ends are ligated back together,

and gaps are repaired. SDSA can only result

in a non-crossover product. RPA, Replication

protein A

DSBR SDSA

A

B C

Introduction

7

Non-crossover occurs when SGS1 (yeast) or BLM (vertebrates) helicase pushes the Holliday junction towards each other, in a process called branch migration, and is resolved by Topoisomerase III (Wu & Hickson, 2003). During meiosis, DSBR is a prominent recombination mechanism. In somatic cells, however, most of the DSBs are repaired through SDSA (Puchta, 1998). The SDSA model lacks a second Holliday junction. Instead, the existing Holliday junction is moved, through branch migration, in the same direction as the extension to release the newly synthesized strand. The released strand can then anneal to the other end of the DSB. In yeast, SRS2 is identified as the helicase required for branch migration in SDSA (Miura et al, 2012). The SDSA pathway always results in recombinant non-crossover DNA. Double-strand break repair through homologous recombination occurs most frequently in the S and G2 phase where a sister chromatid is present after replication.

Even though NHEJ appears to be more error-prone compared to HR, it is still the predominant form of repair in higher eukaryotes. Plants have a genome rich in repeats, which increases the chance

for ectopic recombination, leading to chromosome rearrangements. These types of damages might be more detrimental than indels caused by NHEJ, which could explain the difference in occurrence frequency between NHEJ and HR. Moreover, because of the sessile lifestyle of plants, adaptations to the environment are crucial. Mutations created by NHEJ might accelerate the evolution towards these adaptations.

(Sung & Klein, 2006)

2. Editing efficiency

Repair of DSBs by NHEJ can be useful in genome editing applications for targeted mutagenesis. If

no template is provided, the targeted DSB will be repaired by NHEJ, often leading to destructive mutations. Targeted mutagenesis has proven to be very helpful in reverse genetic screens to unravel the function of genes and elucidate biological pathways. Also in the search for the improvement of crops, targeted mutagenesis can play a pivotal role. The usefulness compared to gene targeting (GT), in which a template is used for repair, is rather marginal, however. Changes made in the target sequence through GT can be specifically chosen, severely reducing the screening needed to find plant lines with the phenotype of interest. As opposed to the random indels created through NHEJ, HR can be used to replace, insert or delete large regions with high specificity. As such, GT allows the introduction of foreign genes into the genome, broadening the applications for genome editing. However, due to the low occurrence frequency of HR in higher eukaryotes, large experiments and intense screening procedures are required to identify desired

edits. In plants, the efficiency of HR generally varies between 0.01% and 1% (Fauser et al, 2012; Shaked et al, 2005).

Increasing HR efficiency

Many systems have been proposed to increase HR for genome editing purposes, some of which have been summarized in table 1. Several are based on the inhibition of the NHEJ pathway or the stimulation of the HR pathway. A 5-to 16-fold increase in HR was attained in ku70 mutant Arabidopsis plants and a 3-to 4-fold HR increase was observed in lig4 mutants (Qi et al, 2013). Both

Introduction

8

KU70 and ligase IV are essential components in the NHEJ pathway. In mammalian cells it was shown that applying the small molecule Scr7, a ligase IV inhibitor, increased HR efficiency up to 19-fold (Li et al, 2017). Another small molecule, RS-1, stimulates the binding of RAD51 to ssDNA (required for strand invasion), resulting in an 11-fold increase in D-loop formation (Jayathilaka et al, 2008). While it was not directly measured in the study, this result suggests an increase in HR.

In an effort to stimulate HR, Even-Faitelson et al (2011) expressed RAD54, involved in the HR pathway, under an egg-cell specific promoter (EASE). The expression of RAD54 then coincides with the timing of floral dip. A 10-fold increase in HR compared to WT was reported in Arabidopsis. Introducing the RAD54 ortholog from yeast (expressed from a 35S promoter) in Arabidopsis resulted in a 27-fold increase (Shaked et al, 2005). Further expanding on increasing HR efficiency by stimulating the HR pathway, Charpentier et al (2018) fused an N-terminal fragment of CtIP, an

endonuclease required early in the HR pathway, to Cas9. The study was done on human fibroblast cells, iPS cells and rat zygotes, and a 2-fold increase in HR was obtained. Similarly, fusing RAD52 or

MRE11 to Cas9 promoted HR up to 2-fold in human HEK cells (Tran et al, 2019). Since HR is predominantly active during the S and G2 phase, a DSB is more likely to be repaired via HR when the break occurs during those phases. Fusion of the cyclinB2 (Vicente et al 2019) and Geminin (Gutschner et al 2016), two cell cycle regulators, resulted in the degradation of the fusion protein in the G1 phase, resulting in less DSBs during the G1 phase in which NHEJ is more active than HR. This lead, in both cases, to a 1.8-fold HR increase compared to WT human cell lines.

Next to protein-protein fusions, fusions in which the template is bound to the Cas9 have been tested (Savic et al, 2018; Aird et al, 2018; Gu et al, 2018; Carlson-Stevermer et al, 2017; Ma et al, 2017). Several methods to link the template to Cas9 were used, all of which use a protein fused to

Cas9 with an affinity for a specifically labeled template. A 2-to 30-fold increase in HR was achieved. Lee et al (2017) proposed a system in which the DNA template is linked to the guide RNA as opposed to Cas9. An azide terminated donor DNA was conjugated to a gRNA containing a complementary alkyne functional group, producing a gRNA-donor DNA conjugate (gDonor). An 8% HR efficiency increase was observed in human cell lines. Since chemically modified DNA and RNA molecules are required, Cas9 and the gDonor need to be delivered directly into the cells, making it less efficient and useful.

In yeast, it was first shown that RNA can also act as a repair template (Storici et al, 2007). Butt et al (2017) developed a system in which the template is transcriptionally fused to the gRNA (chimeric single-guide RNA; cgRNA), and thus an RNA molecule serves as the template for HR. In rice

protoplasts, the efficiency was highest with a template complementary to the strand not targeted by the guide. Using a 200 bp template with two mutations, an efficiency of 16.88% was reached.

It has been suggested that the low HR frequency is in part due to insufficient donor DNA. As a way of circumventing this issue, Baltes et al (2014) used geminivirus-based replicons to deliver the template DNA. Through rolling circle replication, the template can be multiplied to high population numbers. Higher template concentrations in the cell lead to higher HR efficiency. In rice and tomato, an HR frequency of 19.4% (Wang et al, 2017) and 25% (Dahan-Meir et al, 2018) was achieved respectively.

Introduction

9

A completely different approach is the in planta GT system (Fauser et al, 2012; Schiml et al, 2014; Wolter et al, 2018; Dahan-Meir et al, 2018). Here, the donor template, integrated in the plant genome, is flanked by the gRNA recognition site, also present at the target sequence. The donor template is excised from the integrated T-DNA construct and simultaneously a DSB is induced at the target locus. Efficiencies of 1% were reported. The method is independent of transformation efficiency, allowing the technique to be used on plants with low transformation efficiencies. The template is instable once it is cut from the genome, requiring HR to occur shortly after its release, diminishing the efficiency of the system. Additionally, because plant lines need to be crossed, the method can become quite laborious.

The origin of the Cas endonuclease might also have an effect on HR efficiency. A study has shown that the reaction turnover of Cas9 from Staphylococcus aureus is higher than that of Streptococcus

pyogenes (Yourik et al, 2019). As a consequence, an SaCas9-induced DSB repaired by NHEJ to its former state can more rapidly be retargeted by Cas9. As the number of DSBs increases, so does

the chance of repair by HR. Indeed, in a study where both Cas9 endonucleases were compared, SaCas9 outperformed SpCas9 at generating lines repaired by HR (Wolter et al, 2018).

The efficiency in which HR occurs may also be optimized by changing the characteristics of the repair template. The length of the homology arms flanking the region to be inserted can have an impact on the choice of the repair pathway. Li et al (2014) showed, in a study on mouse embryonic stem cells, that larger inserts decrease the chance of repair by HR. The increase in insert size can be compensated by an increase in the homology arm length. A template with an insert size of 99 bp and 50 bp homology arms resulted in an efficiency of 36.3%, while for a 720 bp insert with 50 bp arms only 4.3% HR was obtained. Increasing the length of homology arms from 50 bp to 200 bp

improved the frequency of insertion by a factor of eight. A similar conclusion was reached in human cell lines (Hendel et al, 2014). Homology arms of 100 bp, 200 bp, 400 bp, and 800 bp were used for the insertion of seven point mutations in an endogenous gene. An increase in HR was seen between the shorter (100 bp and 200 bp) and larger (400 bp and 800 bp) arms, with a maximum efficiency obtained using the 400 bp arms. The result suggests the HR efficiency increases with the length of the homology arms up until a certain point where longer arms no longer increase HR. Aside from insert size, the impact of the homology length on GT efficiency is most likely also dependent on the organism, cell type, and target locus.

The critical point where an increase in homology length stops improving HR is desirable information. In plants, a size increase of T-DNA (on which the template resides) is associated with

lower transformation efficiencies via Agrobacterium-mediated transformation (Park et al, 2000). For mammalian systems, there is a limit on the DNA/RNA capacity of viruses used for the delivery of DNA. Another motive to refrain from increasing the length of homology arms beyond the critical point comes into play when amplicon sequencing of the desired edit is required. Primers used in amplicon sequencing are preferably located outside of the homology arms to avoid amplification of the transformed template. Because reads produced by next-generation sequencing are limited in length, they might fail to cover the edited region in amplicons exceeding those limits. Finally, the construction of smaller templates can be less complex compared to large assemblies.

Introduction

10

Table 1: Summary of systems proposed to increase homologous recombination. Fold increases are indicated as

compared to their WT counterpart. * Only HR percentage was mentioned.

SYSTEM HR INCREASE ORGANISM REFERENCE

Mutants

Ku70 mutant 5-16 fold Arabidopsis thaliana Qi et al, 2013

Lig4 mutant 3-4 fold Arabidopsis thaliana Qi et al, 2013

Small molecules

Scr7 application 19 fold Porcine fetal fibroblast cells Li et al, 2017

RS-1 application - Human dermal fibroblast cells Jayathilaka et al, 2008

Heterologous expression

RAD54 (EASE) 10 fold Arabidopsis thaliana Even-Faitelson et al, 2011

RAD54 yeast 27 fold Arabidopsis thaliana Shaked et al, 2005

Protein-protein fusion

CtIP fusion 2 fold Human fibroblast cells Charpentier et al, 2018

RAD52/MRE11 fusion 2 fold HEK293T Tran et al, 2019

CyclinB2 fusion 1.8 fold HEK293T Vicente et al, 2019

Geminin fusion 1.8 fold HEK293T Gutschner et al, 2016

Protein-template fusion

BG::Cas9-SNAP 11 fold HEK293T Savic et al, 2018

RNP-RNPD 24 fold HEK293T Savic et al, 2018

ssODN::Cas9 30 fold HEK293T Aird et al, 2018

CAB 2-5 fold HEK293T/mouse embryos Ma et al, 2017

Other

gDonor 8%* HEK293T Lee et al, 2017

cgRNA 16.88%* Rice protoplasts Butt et al, 2017

In planta GT 1%* Arabidopsis thaliana Schiml et al, 2014

Gemini-viral replicon 19.4%* Oryza Sativa Wang et al, 2017

Gemini-viral replicon 25%* Micro-Tom tomato Dahan-Meir et al, 2018

SaCas9 - Arabidopsis thaliana Wolter et al, 2018

Introduction

11

Reporter systems to measure HR frequency

To find methods that increase HR, an assay capable of determining the contribution of the NHEJ and HR pathway in DSB repair, ideally at the same time, is needed. Several reported assays use fluorescent proteins as a way of quantifying HR. A simple method uses a reporter line containing a knocked out fluorescent protein (Porteus & Baltimore, 2003; Li et al, 2017; Mao et al, 2008). After supplying a donor template containing the corrected sequence, fluorescent cells are an indication of HR. It is, however, difficult to distinguish between DSB repaired by NHEJ, untransformed cells, and transformed cells where no DSB was made since neither result in a positive signal.

An assay in which repair by NHEJ creates a positive signal as well is more desirable. One such an assay is the Traffic Light Reporter (TLR) (Certo et al, 2011). The TLR system consists of a green fluorescent protein (GFP; or enhanced GFP, eGFP) linked to a red fluorescent protein (mCherry).

Between both fluorescent proteins, a T2A element is inserted (Fig. 3A). T2A is a ribosome skipping sequence (Donnelly et al, 2001), allowing the GFP and mCherry proteins to be separated during translation. In the sequence coding for GFP, a nuclease target site is inserted, which contains a stop codon. The mCherry coding sequence is out of frame. In the default state, neither the GFP nor mCherry are functional. After DSB induction, repair can occur by HR or NHEJ (Fig. 3B). For HR to occur, an exogenous donor template of a truncated GFP, without the inserted nuclease cleavage site, needs to be supplied. Homologous recombination repair results in a correction of the (ORF), producing functional GFP. A two bp frameshift as a result of NHEJ repair places mCherry in frame. Cells can then be counted according to their fluorescent signal (green in case of HR, red in case of NHEJ) by fluorescence-activated cell sorting (FACS). Since only a two bp frameshift is capable of shifting mCherry in frame, a fraction of the DSBs repaired by NHEJ is underestimated. Furthermore,

deletion of the stop codon in the nuclease target site by NHEJ can reinstall GFP, resulting in an overestimation of HR.

Another assay based on fluorescent proteins accounts for these under- and overestimations: the GFP-to-BFP conversion assay (Glaser et al, 2016). The reporter system exploits the ability of GFP to be converted to BFP by a single mutation (T196C). In a GFP-containing reporter line, a gRNA guides Cas9 to a specific site in the GFP gene. The base substitution can be achieved by HR repair using a

template containing the required mutation to transform GFP to BFP. Cells in which no DSB was induced remain blue, cells repaired through HR or NHEJ are green and non-fluorescent respectively. This reporter system can also be used to determine the efficiency of base editors (Coelho et al, 2018).

Shaked et al (2005) developed a system based on the endogenous CRUCIFERIN gene from Arabidopsis. A vector containing a promoterless GFP ORF flanked by sequences homologous to CRUCIFERIN is floral dipped in Arabidopsis. HR results in a fusion of the CRUCIFERIN promoter to the GFP ORF. CRUCIFERIN is specifically expressed in the seed. Integration by HR gives fluorescent seeds, while random integration gives non-fluorescent seeds.

Introduction

12

A general disadvantage of fluorescent reporters is their inability to determine efficiencies at endogenous loci. A non-fluorescent method is based on single-molecule real-time (SMRT) DNA-sequencing (Eid et al, 2009). SMRT sequencing is able to generate sufficiently long reads (up to 15 kb) and can be used without a reporter line. Additionally, the method is independent of the transcriptional status of the gene, allowing the analysis of silent loci. Hendel et al (2014) devised a strategy using SMRT sequencing to quantify NHEJ and HR in different cell types, using different editing techniques, and targeting several different loci. By comparing their approach to gel-based assays and single-cell clone analysis, they affirmed that SMRT sequencing is a reliable tool for measuring NHEJ and HR frequencies at endogenous loci. However, sample processing, such as adapter ligation and PCR, are required, limiting its usefulness in a high-throughput set-up.

Another approach is based on acquired herbicide tolerance by mutating endogenous genes such as acetohydroxyacid synthase (ALS). Specific base substitutions are known to confer resistance to certain herbicides (Lee et al, 1988). Using this information, a donor template can be constructed containing the required substitutions for resistance. HR results in survival, while NHEJ results in death on herbicide-containing medium. Testing this assay using tobacco protoplasts revealed that a significant fraction of herbicide-resistant protoplasts arose due to spontaneous mutations or other unknown reasons (Townsend et al, 2009), diminishing the reliability of the method.

Figure 3: The Traffic Light Reporter (TLR). (A) The TLR consist of a fusion construct of eGFP, T2A, and mCherry . The

arrow indicates the eGFP start codon. The reading frames relative to the eGFP start codon are indicated in parentheses.

(B) A double-strand break (DSB) repaired by homology-directed repair (HDR) reconstitutes the full eGFP sequence. A

DSB repaired by mutagenic NHEJ (mutNHEJ) results in an eGFP translated out of frame (GibberishFP) and T2A and

mCherry are rendered in frame. Figure adapted from Certo et al (2011).

A

B

Introduction

13

A perfect assay has yet to be developed. Nevertheless, the existing systems can be used to get an estimate on the HR/NHEJ ratio. Depending on the goal and the organism used in the study different assays might be more valuable. Some of these systems have been described only in a single organism. Translating it to other organisms might prove challenging.

3. Germline-editing

Next to specific substitutions or knock-ins through HR, genome editing tools are also frequently used to knock out genes through the generation of random mutations by NHEJ. Especially in reverse genetic approaches, knockouts can prove very useful. While CRISPR/Cas has seen many improvements over the years, the efficiency of the system is not yet optimal. The outcome in floral

dipped Arabidopsis plants e.g. often results in somatic mutations (giving a mosaic phenotype), while for most applications a mutation in germline cells is needed to obtain a complete phenotype

in the next generation. In rice, on the other hand, efficiencies of up to 100% in T0 have been described (Tang et al, 2016). Rice and most other crops are most commonly transformed via Agrobacterium through a callus and regeneration phase, as opposed to floral dip in Arabidopsis.

For mutations to be heritable, they need to occur in the early embryo or cells which will contribute to the germline, such as egg or pollen cells. Some studies have been done using different promoters to express Cas9 in an attempt to increase the heritability of the generated mutations in Arabidopsis. Most commonly strong ubiquitous promoters are used to attain high Cas9 levels in each cell type. Cas9 expressed by ubiquitous promoters has shown to be moderately efficient in generating heritable mutations in floral dipped Arabidopsis plants (Bortesi et al, 2016; Belhaj et al,

2013). In the early days of CRISPR/Cas9 as a genome editing tool, the Cauliflower mosaic virus (CaMV) 35S promoter was a popular choice for Cas9. CaMV 35S is not highly active in early embryos when transformed via floral dip, resulting in somatic rather than germline mutations (Feng et al, 2013a; Ma et al, 2015). The constitutive promoters from Petroselinum crispum ubiquitin (PcUBI) and the ribosomal protein 5A (RPS5A), on the other hand, have been shown to be more efficient at producing heritable mutations (Tsutsui & Higashiyama, 2017; Ordon et al, 2019).

Other studies have been performed using tissue-specific promoters to increase Cas9 expression in germline cells. Wang et al (2015) used egg cell-specific promoters, EC1.1 (AT1G76750) and EC1.2 (AT2G21740; also known as DD45), and a fusion of the EC1.2 enhancer with the EC1.1 promoter. In the T1 generation homozygous or bi-allelic mutants were obtained (which lack in plants using

35S promoters) and up to 13.1% of plants had a non-mosaic phenotype. The efficiencies of the egg cell-specific promoters are determined for a large part on the terminator being used (Wang et al, 2015). Using a meristem-specific promoter such as the promoter from CLV3 (AT2G27250) or a constitutive promoter that is most active in meristematic tissues like HMG (AT1G76110) lead to the production of non-mosaic plants with a similar efficiency as the EC1 promoters with the TALENS editing system (Forner et al, 2015). Other meristem-specific promoters tested include the YAO promoter, expressed predominantly in the tissues undergoing active cell division, such as the shoot apical (SAM) and root meristem, and highly expressed in the embryo, endosperm, and pollen; the SPOROCYTELESS (SPL) promoter, active specifically in sporogenous cells and microsporocytes; and the LAT52 promoter from tomato, which is specific for pollen cells. The YAO promoter, as opposed

Introduction

14

to the SPL promoter, was able to induce mutations in the T1 generation (Yan et al, 2015; Mao et al, 2016). Using the LAT52 promoter homozygous T2 mutants were obtained, while only heterozygotes were found in T2 using the SPL promoter (Mao et al, 2016). Additionally, using the YAO promoter Cas9-free mutants could be found in the T2 generation, while for the SPL promoter only in the T3 generation were such mutants found. Hetero-or homozygosity was not mentioned for mutants produced by Cas9 expressed by the YAO promoter (Yan et al, 2015).

Although tissue-specific promoters have shown to perform better than certain ubiquitous promoters at creating heritable non-mosaic mutations, these strategies still produce for the most part somatic mutations, which complicates the identification of heritable mutations. Comparison between the described systems is difficult since the set up between the studies differs in several aspects (such as target genes and terminator use). Also, different aspects were measured between

the studies (homozygosity, heritability, mosaicism, expression levels of Cas9). A screen for suitable promoters used in the same conditions is required, with a focus on germline-specific promoters

that are able to produce Cas9-free mutants in the T2 generation (indicating the heritability of the mutation).

Aim

15

II. Aim

Floral dip is by far the most popular method for the transformation of Arabidopsis thaliana. It is an easy and fast method as it does not require callus formation. However, when gene-editing tools are transformed via floral dip, the resulting edits are often somatic mutations rather than the desired germline mutations. Some studies have been done using other promoters to express Cas9 to increase the heritability of the generated mutations, with some promising results for tissue-specific promoters. The goal of this study is to compare different promoters in a large-scale setting in which the conditions across all promoters are equal. Their capabilities in generating heritable mutations will be evaluated. Promoters being tested include constitutive (PcUBI, RPS5A) and egg-cell specific (EC1.2enhancer/EC1.1promoter; written as EC1) promoters, and promoters highly active in stem-cells (CLV3, P16, HMG, YAO). PcUBI is currently the standard promoter used in the

lab. A frequently used target to study GT efficiency is the PHYTOENE DESATURASE (PDS) gene. A knockout of pds results in the arrest of chloroplast development which leads to an albino

phenotype. The phenotype is clearly visible, making it ideal to screen for mutants. Plants with the albino phenotype, however, cannot grow sufficiently to produce a T2 generation. In our study, it is important to analyze the T2 generation to screen for mutants without the CRISPR/Cas9 construct, making the PDS target unusable. Here, GLABRA1 (GL1; AT3G27920) is used as a target to easily identify mutant plants. A mutation in the gl1 gene disables trichome formation but has no effect on the development or survivability of the plant in the lab. For each promoter, two guides (GL1-1 and GL1-2) will be tested. By analyzing the T1 and T2 generation for trichome development, the efficiency of promoters in generating heritable mutations can be compared.

Targeted insertion through HR can be used in many applications. It is a rare event in eukaryotic cells, however. To increase the occurrence of HR after DSBs, the components of the CRISPR/Cas systems should be optimized. A high-throughput system is required to evaluate multiple designs on their HR efficiency. A relative new reporter system is based on the conversion of GFP to BFP using a single base substitution. Through HR, GFP-expressing cells can be converted to BFP-expressing cells. This approach has been tested in human cell lines. Whether the reporter is functional in plant systems remains to be tested. In this study, the assay will be tested in tobacco Bright Yellow-2 cells and Arabidopsis PSB-D cells. Since GFP is a more intense fluorescent reporter, a BFP-expressing reporter line will be used which can be converted to GFP to easier identify HR events. Once the BFP-to-GFP conversion assay is established, several variables in the CRISPR/Cas system can be tested on their ability to increase the HR/NHEJ ratio. Here, different template

lengths will be tested for their efficiency. Templates with homology arms of 50, 100, 150 and 200 bp on either side of the insert will be compared using the assay. Analysis of the fluorescence of the cells will be done via the fluorescence microscope and through fluorescence-activated cell sorting. The number of conversions from BFP to GFP is an estimate on the HR efficiency.

Summarized, seven different Cas9-driving promoters will be tested on their efficiency to create heritable mutations in Arabidopsis and an assay to measure HR efficiency will be developed and tested in BY-2 and PSB-D cells.

Results

16

III. Results

1. Promoter comparison

Inheritable DNA mutations are desired in many genome editing studies. Seven promoters expressing Cas9 were evaluated on their ability to generate mutations that are passed on to the next generation in Arabidopsis thaliana.

Vector cloning

Cloning of the expression vectors was done via Golden Gate, vector digestion, and Gibson assembly as shown in figure 4. The final vectors contain one of the seven promoters (PcUBI, RPS5A, YAO,

EC1, CLV3, P16, HMG), the SpCas9 gene with an SV40 nuclear localization signal (NLS) linked via a P2A element to mCherry with an NLS and a G7 terminator. The P2A peptide functions as a ribosome skipping module, separating Cas9 and mCherry during translation (Donnelly et al, 2001). For every promoter, a vector was made containing one of two guides targeting GL1 (PAM is underlined): GL1-1 (5’- GGAAAAGTTGTAGACTGAGATGG-3’) and GL1-2 (5’-TTGAGCCCTAATGTGAACAAAGG-3’). Both guides target the second exon of the GL1 gene. The gRNAs are expressed from an AtU6-26 promoter (Fauser et al, 2014). The scaffold is fused to the gRNA forming a single gRNA. A fluorescence‐accumulating seed technology (FAST) module allows for easy screening of T1 seeds containing the vector of interest (Shimada et al, 2010). The module contains a red fluorescent protein, mRuby3, translationally fused to OLEOSIN1 (OLE1) which is expressed from the endogenous promoter of OLE1. The OLE1 protein is located in the oil body membrane of the seed.

Seeds containing the T-DNA can thus be selected on account of their fluorescence.

The target

GLABRA1 is a MYB transcription factor (TF). The protein has two MYB domains, R2 and R3, required for DNA-binding. A putative transcriptional activation domain (TAD) is present at the C-terminal

end (Fig 5). GL1 forms a complex with the WD-repeat protein TTG1 and the bHLH TFs GL3/EGL3 to activate downstream genes involved in trichome initiation, such as GL2 and TTG2. The GL1 gene was chosen as a target as opposed to downstream genes GL2 or TTG2 since these genes are also regulated by other factors. In addition, they are pleiotropic and would thus have an effect on multiple characteristics. The GL1 gene has previously been shown to be a good visual marker for

genome editing (Hahn et al, 2017).

A paralog of GL1, MYB23, is involved in trichome branching and initiation. The proteins have a sequence similarity of 63% and function in a very similar way. Due to differences in regulations of the genes, their role in trichome development differs (Kirik, 2005). Trichome formation on the leaf blade is initiated by GL1, while trichome initiation on the leaf edge is redundantly regulated by both GL1 and MYB23 (Kirik, 2005). As a consequence, trichomes on the edge of the leaves might still be formed in a gl1 knockout line. In this study, two guides were used that target the second

Results

17

exon of GL1 in the MYB domain (full arrows in Fig. 5). Mutations can result in the complete knockout of the gene through frameshifts or can impair binding to MYB binding sites in downstream genes.

Figure 4: Cloning scheme used to construct the expression vectors containing different promoters. Six entry vectors

were assembled in the destination vector through a Golden Gate reaction. An AarI digestion removed the sacB negative

selection marker. Via PCR, a construct containing the guide promoter (AtU6-26), selection markers ccdB and CmR, and

the scaffold were amplified. Additionally, compatible AarI overhangs were introduced to insert the PCR construct in the

vector through Gibson assembly. Oligos were annealed to create two different gRNAs with BsaI overhangs. A second

Golden Gate reaction replaces the ccdB-CmR module by one of the gRNAs. LB, left border; RB, right border; CmR,

Chloramphenicol resistance; FAST, fluorescence‐accumulating seed technology; S, scaffold.

Results

18

Phenotyping and genotyping of T1

For each expression vector, three Arabidopsis plants were floral dipped. Per plant, 30 FAST-positive

T1 seeds were selected and grown on MS medium. The first two true leaves and the first cauline leaf of every plant were scored with having either no trichomes, an intermediate number of trichomes, or WT phenotype. Examples of the complete knockout (no trichomes) and WT phenotypes (trichomes) as seen in the T2 generation are shown in figure 6A. As the intermediate phenotype was only seen in T1 and no photos were taken of the T1 generation, an image of the intermediate phenotype is not presented.

For the true leaves, the phenotype (intermediate and complete) was observed the most with plants containing the constitutive promoters (Fig. 6B). The PcUBI promoter reached an efficiency of 100%, promoter RPS5A an efficiency of up to 97%. For both, the majority of edits resulted in a complete phenotype. The YAO promoter, a ubiquitous promoter with highest expression activity in embryo,

pollen, and endosperm (Li et al, 2010), showed mostly an intermediate phenotype (42% for GL1-1, 10% for GL1-2), and only a small fraction showed the complete phenotype (17% for GL1-1, 0% for GL1-2). Other promoters highly active in proliferating cells, P16 and HMG, gave rise to plants with the phenotype with a higher frequency, up to 96% and 93% respectively. For P16, the GL1-1 guide produced the complete phenotype for the most part, while for GL1-2 the majority of the plants had an intermediate phenotype. In the HMG line, the intermediate/complete phenotype ratio is roughly 50%. The CLV3 promoter, active in the SAM (Brand et al, 2002), produced only very

few plants with a visible phenotype. A frequency of maximum 10% was obtained for GL1-1, and no plants with the mutant phenotype was produced with GL1-2. Finally, the egg cell-specific promoter/enhancer EC1, reached a total frequency of 7% with GL1-1 and a frequency of 61% with GL1-2, both for the most part resulting in the complete phenotype.

In contrast with the true leaves, the majority of phenotypes of the cauline leaves were intermediary (Fig. 6C). The intermediate phenotype consisted primarily out of leaves with trichomes found only on the edges. Similarly to the true leaves, a high number of plants showing the phenotype (> 90%) for the constitutive promoters, PcUBI and RPS5A, and the promoters P16 and HMG (strongly expressed in stem cells) was observed. The YAO promoter reached a comparable maximum efficiency with GL1-1 (85%). Lower efficiencies were obtained with the CLV3 and EC1 promoter (a maximum of 47% and 42% respectively). The GL1-1 guide consistently produced more leaves with a phenotype than GL1-2, except for lines containing the EC1 promoter.

Figure 5: Genome and protein structure of GLABRA1 (GL1). The GL1 gene consists of three exons, indicated by the blue

bars, and two introns. The GL1 protein consists of three domains, indicated in grey: the MYB domains (R2 and R3) and

the transcription-activation domain (TAD). Both guides, GL1-1 and GL1-2 (full arrows), target the second exon in the

MYB domains of the GL1 gene. Primers used for the genotyping analysis are indicated by half arrows (Oligo 690 and

Oligo 691).

Results

19

To verify the guides were not switched in the EC1 lines, the guide region in the genomic DNA of several EC1 lines was PCR amplified and sequenced.

The scored true leaves were harvested, genotyped with Sanger sequencing (Oligo 690 and Oligo 691 in Fig. 5) and analyzed with the program ICE from Synthego. ICE is a software program that can determine the editing efficiency and types of edits. ICE provides an ICE score which represents the percentage of the cell population that has insertions or deletions. In addition to the ICE score, a knockout (KO) score is given. The KO score is a measurement for the percentage of the cell population of which the editing resulted in a frameshift or a 21+ bp indel.

Figure 6D shows the ICE score for every promoter/guide combination with the phenotypes of all T1 plants mapped on the data points. Most commonly the KO score is very similar to the ICE score. Comparable to the phenotyping data, the constitutive promoters produced most edited plants.

The mean score for both promoters was 87% for GL1-1. The mean for GL1-2 was 70% and 72% for PcUBI and RPS5A respectively, which is still higher compared to the other promoters. The third-

highest scoring promoter was HMG (70% for GL1-1 and 48% for GL1-2). The YAO and P16 promoter had similar ICE scores. For the YAO promoter, however, the GL1-1 (60%; 21% for GL1-2) produced a higher score, while for P16, GL1-2 (59%; 19% for GL1-1) gave the highest score. A lower ICE score was obtained with the EC1 promoter, reaching a score of 22% and 31% with the GL1-1 and GL1-2 guides respectively. Corresponding with the phenotyping data, the lines containing CLV3 promoter obtained the lowest scores for both guides (16% and 1% respectively).

A similar pattern is seen as in the phenotyping data concerning the two different guides. Generally, the GL1-1 performs better at creating mutations than GL1-2, aside from two exceptions (EC1 and

P16). The phenotyping data is often not in accordance with the ICE and KO score. CLV3 with guide GL1-1 showed no complete phenotypes and low ICE scores, while P16 with guide GL1-1 had similar low ICE scores but were mostly scored with the complete phenotype. Plants without the phenotype, but with a high ICE score (as seen in PcUBI/GL1-2, YAO/GL1-1, and HMG/GL1-2) have a KO score that is equally as high as their ICE scores.

The score distribution differs between promoters. While P16 and HMG have an almost continuous distribution, the data points for the constitutive promoters are more densely packed toward the upper ICE scores. The data points for CLV3 and YAO/GL1-2, on the other hand, compile together near the lower scores. Not many intermediate scores are found with YAO/GL1-1 and EC1, rather a bimodal score distribution is found.

Results

20

Figure 6: Phenotyping and genotyping of the Arabidopsis T1 generation. (A) No trichomes (left) and WT phenotype (right).

Photos shown were taken from the T2 generation (Cas9-free) as no photos were taken from T1. (B) Phenotyping of the first two

true leaves. (C) Phenotyping of the cauline leaves. (D) Genotyping of the first true leaves. Each data point represents the ICE

score of one Arabidopsis plant. The mean ICE score is represented by a horizontal bar. The phenotype of each plant is mapped

on their corresponding genotype score. Due to non-germinated seeds, early death of seedlings, or unsuccessful DNA extraction,

the number of plants analyzed per promoter/guide combination (n) is generally lower than 30.

A

B C

D

Results

21

Phenotyping of T2

To study the inheritance of the targeted mutations, the CRISPR/Cas cassette should be absent so as to avoid de novo somatic mutations from interfering with the analysis. From each line (promoter/guide combination), three plants were chosen to select and sow 50 non-fluorescent (Cas9-free) T2 seeds. Three plants were chosen with a low, intermediate and high ICE score respectively. Additionally, only plants were chosen of which the seeds showed a 1:4 non-fluorescent/fluorescent ratio to select for plants containing a single copy of the construct. The criteria were not always fully satisfied due to the absence of plants with the desired seed distribution in the ICE score category of interest (low, intermediate, high). The first two true leaves were scored based on their trichome presence as was done for T1. Due to time limitations, plants were not genotyped.

As opposed to the T1 generation, no intermediate phenotypes were observed in T2. Intermediate phenotypes are the consequence of mutations that occur in later stages of development (i.e. somatic mutations). As a result, only a fraction of the cells are edited, allowing the remaining unedited cells to produce trichomes. Because seeds were selected that presumably lacked Cas9, no additional targeted mutations could be produced during development and thus either leaves with or without trichomes are formed (Fig. 6A).

Using the GL1-1 guide, all except the CLV3 promoter had with at least one of the three selected plants, seedlings without trichomes (Fig. 7A). Generally, plants with high ICE scores produced most seedlings with the complete phenotype. For both RPS5A and EC1, 100% of the seedlings from their high ICE score T1 plant (100% and 91% ICE score respectively) showed the gl1 phenotype. The

PcUBI and HMG promoter had a similar percentage of seedlings with the phenotype in the high ICE score category, 90% (from a plant with 98% ICE score) and 91% (from a plant with 94% ICE score) respectively. The ICE score of the plant in the high score category for the P16 promoter was almost half compared to the other promoters (51%). Still, 74% of its seedlings showed a complete phenotype. Aside from CLV3, the YAO promoter (97% ICE score) produced the least seedlings with the phenotype, being 38%.

The intermediate ICE score for RPS5A (88%) is still relatively high compared to other intermediate ICE scores. In correlation, a high percentage of seedlings with the phenotype was obtained: 86%. A slightly higher percentage, 90%, was obtained with the HMG promoter, while the intermediate ICE score was lower (50%). The EC1 and P16 promoters obtained 27% and 22% seedlings showing the phenotype respectively, which correlates with the ICE score of their T1 plant (38% and 27%).

While the difference between the intermediate and high ICE score for PcUBI is relatively small (23%), a significant drop was observed in seedlings showing the gl1 phenotype, from 80% to 3%. Both the YAO and CLV3 promoter produced only seedlings with WT phenotypes.

The HMG promoter produced many seedlings with the complete phenotype in all three ICE score categories, with 94% of seedlings showing the gl1 phenotype from a low scoring T1 plant (21% ICE score). The PcUBI promoter produced significantly more seedlings with the phenotype in the low ICE score category (47% ICE score) compared to the intermediate category (75% ICE score), obtaining 80% seedlings with the phenotype. The percentage of seedlings with the phenotype containing the YAO promoter also increased in the low-score category (67% ICE score) compared

Results

22

to the intermediate score category from 0% to 17%. A significant drop was observed for the RPS5A promoter from 86% in the intermediate category (88% ICE score) to 10% in the low category (53% ICE score). No gl1 phenotypes were observed for EC1 and CLV3 in the low ICE score category (4% and 7% ICE score respectively).

The GL1-2 guide was less successful in creating plants with the phenotype (Fig. 7B). Here the trend was also observed that plants with a high ICE score produce more seedlings showing the gl1 phenotype. For all promoters, the highest percentage of seedlings with no trichomes was obtained in the high ICE score category. For both the YAO promoter and CLV3 promoter, no gl1 seedlings were observed. Plants containing the PcUBI promoter obtained the most (93%; 98% ICE score) followed by RPS5A (91%; 100% ICE score), HMG (87%; 98% ICE score), EC1 (76%; 95% ICE score), and P16 (29%; 98% ICE score). Plants with an intermediary ICE score produced only gl1 seedlings

with the RPS5A, EC1, and HMG promoter (with a frequency of 14%, 33%, and 6% respectively). Even with a T1 ICE score of 0%, the EC1 promoter produced seedlings showing the phenotype with

a rate of 6%. The RPS5A was also able to create gl1 seedlings (10%) in the low category (51% ICE score).

A high number of T1 lines carrying the egg cell-specific promoter lacking fluorescent seeds were observed. The seeds of 311 T1 plants were analyzed on their fluorescence. Of those 311 T1 plants, 32 plants produced only FAST-negative seeds, 15 of which were plants containing the EC1 promoter (Fig. 8). A possible explanation for a complete batch of FAST-negative seeds is an untransformed T1 plant, i.e. escapes. However, some of these plants have a relative high ICE score (up to 25%). Such high scores are likely obtained due to the activity of the CRISPR/Cas9 system. Three of the 32 plants had the gl1 phenotype. A PCR on the genomic DNA of T1 plants was done.

The Cas9 and PDS gene, and FAST module were amplified. The FAST module was present in 23 of the 32 plants. Of those 23, the Cas9 gene was absent for 11. However, the PDS gene was successfully amplified in only 15 of 32 plants, suggesting the PCR was not successful for all samples. The absence of a positive signal for Cas9 and the FAST module could thus be as a result of the absence of the gene/module or the failure of the amplification.

Results

23

Figure 7: Phenotyping of the Arabidopsis T2 generation. Per construct three plants were selected with a low,

intermediate, and high ICE score respectively. From each plant, 50 non-fluorescent seeds were sown. The first two

true leaves were scored based on the trichome presence. Bars represent the percentage of analyzed plants (n) with

no trichomes. The ICE score of the T1 plant from which the T2 seeds were harvested is given. (A) Constructs

containing the GL1-1 guide. (B) Constructs containing the GL1-2 guide.

A

B

Results

24

Figure 8: ICE score of T1 plants with exclusively FAST-negative seeds. The ICE scores of all T1 plants are represented by

dots. The red dots are plants of which the seeds were all non-fluorescent. Grey dots represent plants of which at least

parts of the seeds were fluorescent. n, number of plants analyzed.

Results

25

2. BFP-to-GFP conversion assay

Editing the genome by specifically replacing, substituting or inserting larger DNA fragments can be done through homologous recombination. Since HR is very inefficient in plants and other higher eukaryotes, a lot of attention has been invested to develop methods to increase the occurrence of HR. A tool is needed that can measure the frequency of HR events so different hypotheses to increase HR can be tested. In this study, an assay was developed for plant systems based on the screening method from Glaser et al (2016) in HEK293T cells. In this project, Tobacco Bright Yellow-2 (BY-2) and PSB-D (Arabidopsis) cultures were used to develop the assay. The assay requires a reporter line expressing BFP. The reporter line is transformed with CRISPR/Cas9 armed with a guide complementary to a particular site in the BFP gene. Additionally, a template containing the BFP gene with a specific substitution (C196T) is co-delivered. The substitution results in a tyrosine-to-

histidine replacement, which converts the BFP signal in a GFP signal. Cas9 creates a DSB near the 196C nucleotide in the BFP gene present in the reporter line (Fig. 9A). Repair of the DSB by NHEJ

results in loss of the BFP signal, repair by HR results in green fluorescent cells (Fig. 9B). By counting the green and non-fluorescent cells, an estimate can be made on the HR/NHEJ ratio.

Figure 9: Concept of the BFP-to-GFP conversion assay. (A) The sequence of eBFP. The C196T substitution required for

BFP-to-GFP conversion is indicated in red. (B) A cell line containing the eBFP gene is transformed with a vector

containing the CRISPR/Cas9 (linked to mCherry, a red fluorescent protein (RFP)), a guide complementary to the eBFP

gene, and a GFP template. Cas9 introduces a DSB close to 196C in the eBFP gene. Repair through homologous

recombination (HR) results in an eGFP-positive cell, repair via non-homologous end joining (NHEJ) results in loss of the

fluorescent signal. RFP-positive cells are an indication for transformation.

A

B

Results

26

In the assay developed by Glaser et al (2016), a GFP-to-BFP conversion is used to determine the HR frequency. Since BFP has a much lower fluorescent intensity than GFP, we reasoned that detecting a GFP signal after HR as opposed to a BFP signal is more practical. Thus a BFP-to-GFP instead of a GFP-to-BFP conversion assay was developed. Here, the enhanced GFP (eGFP) and BFP (eBFP) variant were used to increase intensity.

GFP-to-BFP conversion

To create an eBFP gene and to test whether the reported T196C substitution is sufficient to convert

GFP to BFP, a vector containing the nucleotide replacement was made. Nicotiana benthamiana leaves were infiltrated with the eGFP and eBFP vectors separately (Fig. 10). A clear fluorescent signal was visible in the GFP channel of eGFP-infiltrated leaves. The signal in the BFP channel was likely as a result of bleed through (weak emission of eGFP converted to a blue signal) as the signal intensity was lower and less demarcated. No signal was seen in the GFP channel of eBFP-infiltrated leaves. An intense blue fluorescent signal was visible in the BFP channel, suggesting the eGFP gene was successfully converted to eBFP by the single mutation, as expected. The uninfiltrated leaf

shows no background fluorescence in either channel. The eBFP vector was transformed in BY-2 and PSB-D to create stable eBFP-expressing cell cultures.

Testing of the assay

The length of the repair template can play a significant role in the frequency of DSB repair by HR. To test the functionality of the assay and to test the impact of the template length on HR efficiency in plant systems, four repair templates were constructed with 50 bp, 100 bp, 150 bp, and 200 bp homology arms on either side of an insert (Fig. 11A). The insert (13 bp) contains the mutation that converts eBFP to eGFP (C196T) and three additional mutations to avoid retargeting after HR. Aside from template length, the guide choice can have a large impact on the editing efficiency (Liang et al, 2016). For every template, three different guides (referred to as BFP1, BFP2, and BFP3) were chosen to increase the chance of successful editing (Fig. 11B). A negative control guide targeting

Figure 10: Agroinfiltration of GFP and BFP vectors in Nicotiana benthamiana leaves. The eBFP gene was constructed

by substituting 196T to 196C in the eGFP gene. The vectors were infiltrated in N. benthamiana leaves with

Agrobacterium and analyzed with a fluorescence microscope.

Results

27

the endogenous OLE1 (AT4G25140) gene in combination with each template was included in the screen. The control gene was chosen because the guide was already available in the lab. In total, 16 vectors were made (four templates in combination with four guides).

The vectors were transformed via Agrobacterium into eBFP-expressing BY-2 cells. After transformation, the cells were transferred to a plate containing selection medium to allow callus

growth. The plates were screened two to three weeks later using a fluorescence microscope. A cluster of eGFP-positive cells was counted as one HR event since it is highly likely that all eGFP-positive cells clustered together arose from an HR event in a single cell (Fig. 12).

Cas9 was linked via a P2A peptide to mCherry, allowing the visualization of transformed cells. In

most cases, however, no or very weak mCherry signal was observed in eGFP+ cells. A high exposure time was needed to visualize mCherry. The probability that a BFP-to-GFP conversion occurred in the absence of Cas9 is minimal. The ribosome skipping P2A element might be a contributing factor to the absence of the mCherry signal in edited cells. If the element is not functioning properly, accumulation of the fluorescent protein can be blocked, resulting in low mCherry concentrations.

A

B

Figure 11: Visualization of the templates and guides used in the BFP-to-GFP conversion assay. (A) Four templates were

constructed, each with different homology arm lengths: 50 bp, 100 bp, 150 bp, 200 bp. Both the 5’ homology arm and

3’ homology arm were equal in size per template. The red bar indicates the mutation needed for BFP-to-GFP conversion.

The blue bars indicate mutations introduced to prevent the guide from binding the insert after HR. (B) Three guides were

used separately for eBFP targeting. The colors of the nucleotides correspond to the mutations shown in (A).

Results

28

Even though the intensity of eBFP is also rather low, the blue signal was visible in many cells. As expected, all of the observed eGFP+ cells lost their blue signal. It is possible, however, for a cell to contain multiple inserted eBFP genes. In these cells, repair could have occurred by both NHEJ and HR. In case an eGFP+ cell contains an intact eBFP gene, the cell would express both eBFP and eGFP.

Figure 12: Analysis of the BFP-to-GFP conversion assay in BY-2. In the assay, eBFP is converted to eGFP in case of an

HR event. Plates were screened and eGFP+ clusters were counted. Cas9 was tagged with the red fluorescent protein

mCherry, which serves as an indication for transformed cells. Scale bars represent 250 µm.

Results

29

There was a clear difference in transformation efficiency between WT BY-2 and eBFP-expressing BY-2 culture. A vector carrying the eGFP gene was transformed via Agrobacterium in both cultures as a positive control. The WT culture had many more transformed eGFP+ cells than the supertransformed eBFP-expressing culture (Fig. 13). Why there is such a large difference in efficiency between transformation and supertransformation is not clear.

In total, the experiment was performed twice. In the first attempt, the assay was done with a light and a dense culture. The analysis was done 20 days after transformation with Agrobacterium. In the second attempt, all samples were tested four times (two times using a low-density culture and two times using a denser culture). The plates were screened 17 days after transformation. In all of the cases, the negative control plates lacked eGFP clusters, indicating a targeted DSB at the eBFP locus is needed for HR to occur with a detectable efficiency.

The assay worked with both the light and dense culture, although plates analyzed 20 days after transformation produced only a total of two clusters with the dense culture while a total of 45

clusters were observed using the light culture (Fig. 14A-B). In the second attempt, the difference in total clusters observed was less significant with 115 and 100 clusters for the light and dense culture respectively (Fig. 14C-D). The data suggests a less dense culture is more susceptible to transformation, has a higher HR frequency, or the eGFP clusters are more easily visible with a lighter culture. More replications are required to confirm these observations are not coincidental.

A general trend is seen each time the assay was performed, being an increase in the number of clusters with longer homology arms. All clusters accumulated, the 50 bp, 100 bp, 150 bp, and 200 bp homology arms produced 19, 64, 74, and 105 clusters respectively. Increasing homology arm

length from 50 bp to 200 bp resulted in a 5.5-fold increase in HR efficiency. In all cases, templates with the shortest homology arms were least successful in converting eBFP to eGFP, producing zero to a maximum of five clusters. A maximum of 15 clusters was achieved, twice with the 200 bp/BFP3 combination, which was the highest observed number of clusters on an individual plate. These data suggest that HR is more efficient with longer homology arms.

Figure 13: Transformation of WT (left) and eBFP-expressing (right) BY-2 cell cultures with eGFP. Scale bars represent 2

mm.

Results

30

Figure 14: Number of clusters counted per template/guide combination. The number of clusters is plotted

against the different template (50 bp, 100 bp, 150 bp, 200 bp) and guide (BFP1, BFP2, BFP3) combination.

Plates were analyzed either 20 days (A-B) or 17 days after transformation (C-D). The assay was done with a

light (A-C) and dense culture (B-D). The assay of which the plates were analyzed after 17 days was done in

duplicate for each culture density.

A

B

C

D

Results

31

The BFP3 guide produced significantly more clusters compared to BFP1 and BFP2, while BFP1 outperformed BFP2 to some extent: an accumulated 65, 51, and 146 clusters for BFP1, BFP2, and BFP3 respectively. Whether the difference between BFP3, and BFP1 and BFP2 is caused by the strand the guide targets (sense or antisense) remains to be tested. The data show that the choice of the guide is an important aspect of HR repair.

To verify whether eGFP+ cell clusters were indeed the result of an HR event, green fluorescent calli from a few samples were picked for genotyping. A transformed callus (indicated by an mCherry signal) that was neither blue nor green fluorescent was also selected to verify the NHEJ event. Genomic DNA was extracted from the calli, and three different loci were PCR amplified: Cas9, to confirm the presence of the T-DNA construct in the genome; the endogenous PDS gene, to determine if the DNA extraction was successful; and a region covering parts of the eBFP/eGFP gene

and its promoter (to avoid amplifying the template on the transformed vector). The eBFP/eGFP PCR product was Sanger sequenced and analyzed via the Tracking of Insertions, DEletions and

Recombination events (TIDER) software (Brinkman et al, 2018) (Table 2). TIDER is a tool to assess genome editing rate by HR based on Sanger sequencing data. The non-fluorescent callus, taken from the 150 bp/BFP1 sample, had a total editing (NHEJ + HR) efficiency of 69.4% of which 4.50% (p = 0.18) was through HR. Due to the high p-value, the observed HR rate might represent technical variations from using the system. The overall efficiency from a callus that was largely eGFP+ from 150 bp/BFP1 was 60.3% with an HR rate of 45.60% (p = 9.2e-62). From the 200 bp/BFP1 sample, a total editing and HR efficiency of 74.8% and 49.70% (p = 1.3e-130) were obtained respectively from a green fluorescent callus. Three chimeric calli were picked from the 100 bp/BFP2 sample. The total editing efficiency observed was 86.2%, 82.6%, and 83.3% respectively and their

corresponding HR efficiency was 79.50% (p = 0), 76.80% (p = 0), and 76.60% (p = 0). These observations indicate that the eGFP+ cell clusters were indeed produced by an HR event, which converted eBFP into eGFP. All, except the 150 bp/BFP1, samples had an R² (goodness-of-fit measure) higher than the recommended 0.90, indicating that the analysis was reliable for almost all samples.

Table 2: Genotyping of BY-2 callus with TIDER. Total editing refers to repair by both NHEJ and HR. The

p-value corresponds to the HR efficiency.

SAMPLE PHENOTYPE TOTAL EFFICIENCY (%) R² HR (%) P-VALUE

150 bp/BFP1 non-fluorescent 69.4 0.88 4.50 0.18

150 bp/BFP1 eGFP+ 60.3 0.96 45.60 9.2e-62

200 bp/BFP1 eGFP+ 74.8 0.97 49.70 1.3e-130

100 bp/BFP2 chimeric 86.2 0.99 79.50 0.0

100 bp/BFP2 chimeric 82.6 0.99 76.80 0.0

100 bp/BFP2 chimeric 83.3 0.99 76.60 0.0

Results

32

Using the cell sorter for automatic cell counting

Screening BY-2 callus plates using a fluorescence microscope for eGFP+ cell clusters has some disadvantages. First, due to the dense cell clustering, many eGFP clusters might be covered, leading to an underestimation of the HR frequency. Second, to get an indication on the HR/NHEJ frequency, the number of eGFP+ cells and non-fluorescent cells is needed, which is practically impossible via this screening method. Third, the time needed to analyze all plates is linearly correlated with the number of plates, decreasing its usefulness as a high-throughput system. A way of circumventing some of the issues with manual eGFP cluster counting is using an automated cell sorter such as FACS. The cell sorter can count the number of cells expressing a blue, green, and red fluorescent signal. To test whether the cell sorter can be reliably used to count the number of eGFP+ cells, the assay was done using both BY-2 and PSB-D cultures.

Prior to counting with FACS, protoplasting of the cells is required. A protocol for protoplasting BY-2 and PSB-D cells from a liquid culture was available (Bossche et al, 2013). To protoplast cells grown on plates, the cells were transferred to liquid BY-2 or PSB-D medium for three days before protoplasting. The protoplasts were filtered using a 100 µm strainer prior to loading onto the FACS. This avoids clumps of cells and debris, which can obstruct the machine. Generally, the percentage of living cells after protoplasting is lower for cells protoplasted from plates than from liquid for both BY-2 and PSB-D. Living cells were differentiated from dead cells using a plot of the side scatter (SSC) in function of the forward scatter (FSC). The FSC is an indication for the size of the cells, the SSC is an indication for the complexity of the cells. Living cells are usually larger and less complex compared to dead cells or debris. For each sample, the living cells were selected based on these parameters, as shown in figure 15.

Figure 15: Selection of living cell populations from WT BY-2 and PSB-D culture. A BY-2 (left) and PSB-D (right) WT

culture was grown and protoplasted. Protoplasts were run on a FACS. Living cells (gated area) were selected based

on their size and complexity. In the example, 72.4% and 76.6% of the counted events were considered to be living

cells for BY-2 and PSB-D respectively. For both, 20 000 events were captured. FSC, forward scatter; SSC, side scatter.

Results

33

For liquid BY-2 cultures, living cells constituted on average 74% of all counted events. Protoplasting of transformed WT BY-2 culture on plates resulted in 66% living cells, while plates with supertransformed BY-2 culture containing a stable eBFP gene had 53% living cells on average. After protoplasting of liquid PSB-D cell cultures, on average 78% of the counted events were living cells. Transformed WT PSB-D cells and supertransformed eBFP-expressing PSB-D cells protoplasted from plate both had a survival rate of 69% on average. The distinction between living cells and dead cells was less clear for PSB-D than for BY-2 cells. In general, protoplasted BY-2 cells were larger and more complex (higher FSC and SSC) than protoplasted PSB-D cells (Fig. 15). When BY-2 callus was not grown in medium for three days prior to protoplasting the survival rate ranged from 5% to 26%, indicating its importance. The survival rate of the cells is an estimation of the quality of the protoplasting. High survival rates for the protoplasting are desired to obtain the most accurate

representation of the transformation efficiency, and HR and NHEJ frequency. A high variation between the samples was observed, in part due to the somewhat subjective selection of living cells Only living cells were used for further analysis.

The WT, eGFP-, eBFP-, and mCherry-expressing liquid cell cultures were used to determine the FACS gating settings for each fluorescent protein. The green fluorescent cells were easily distinguishable from non-green fluorescent cells. To sort out the green fluorescent cells the fluorescent intensity was plotted against the FSC (i.e. the size of the cells) (Fig. 16A). For the eGFP-expressing BY-2 culture, the gating contained 99.9% of the living cells, while 0% of living WT BY-2 cells were included. Similar results were obtained with the PSB-D cultures: 96.3% of the living cells from the eGFP culture were present in the gated area and almost 0% of the living cells from the WT culture were included (Fig. 16A). There is a difference in population distribution between the

BY-2 and PSB-D cultures. While for BY-2 the eGFP intensity is approximately equal for all cell sizes, for PSB-D culture the fluorescence intensity is more varied with smaller cells.

The fluorescence intensity of the mCherry-expressing BY-2 culture was observed to be rather low when analyzing plates using the fluorescence microscope. While the fluorescence microscope uses a broad light spectrum to excite the fluorophores and filters to sort out the fluorescent signals afterwards, FACS applies lasers with a specific wavelength for maximum excitation. As a result, the mCherry signal is sufficiently intense to allow the distinction of mCherry+ from mCherry- cells using the same parameters as was done for eGFP+ cells (Fig. 16B). The gating included 94.5% of the living cells from the mCherry-expressing BY-2 culture and close to 0% of the living cells of the WT culture were included. Because of time limitations, no PSB-D culture stably expressing mCherry was made.

Because of the low intensity of eBFP, blue fluorescent cells were more difficult to sort from WT cells (Fig. 17A). A slight upward shift of the cell population was visible for the eBFP-expressing BY-2 and PSB-D culture. The shift is not large enough to sort the eBFP+ from the WT cells, however. For BY-2 and PSB-D, only 0.18% and 0.39% of the living cells were captured respectively. An extra gating parameter was used to separate eBFP+ cells as much as possible: the intensity of the autofluorescence (525 nm). The parameters allow for the gate to be positioned closely against the WT population, increasing the detection of the population shift (Fig. 17B). Significantly more eBFP+ cells were captured using these parameters: 42.3% and 14.1% for BY-2 and PSB-D respectively.

Results

34

Next to the liquid cultures, BY-2 callus that was grown on plates was analyzed. The BFP-to-GFP conversion assay was tested with vectors 150 bp/BFP1 and 200 bp/BFP3. The eBFP-expressing BY-2 cultures were supertransformed with a vector containing the 150 bp/BFP1 combination or a vector containing the 200 bp/BFP3 combination. WT BY-2 cultures were also transformed with these vectors as a control. In addition, eBFP-expressing and WT PSB-D cells were (super)transformed with the 150 bp/BFP1 vector. BY-2 plates were manually screened with a fluorescence microscope before protoplasting to ensure the presence of eGFP+ cells. BY-2 supertransformed with 150 bp/BFP1 vector contained 11 eGFP clusters, supertransformed BY-2 with 200 bp/BFP3 contained 15 eGFP clusters. The result of the FACS analysis is summarized in table 2 (gating settings are presented in the addendum (Fig. A1)).

Figure 16: Gating settings for eGFP (A) and mCherry (B) sorting. Liquid WT, eGFP-expressing, and mCherry-expressing

BY-2 cultures and an eGFP-expressing PSB-D culture were protoplasted and analyzed on the FACS. Each time 20 000

events were screened of which only living cells were selected. (A) Gating settings to capture eGFP-expressing BY-2 and

PSB-D cells. (B) Gating settings to capture mCherry-expressing BY-2 cells.

Results

35

The cell sorter was able to detect eGFP+ cells in some cases, albeit only a marginal amount. The eGFP+ cells were only observed when screening a high number of events. For 150 bp/BFP1 and 200

Figure 17: Gating settings for eBFP sorting. A liquid WT and eBFP-expressing BY-2 and PSB-D culture were protoplasted

and analyzed on the FACS. Each time 20 000 events were screened of which only living cells were selected. (A) The

fluorescence intensity is plotted in function of the forward scatter. (B) The intensity of the autofluorescence is plotted in

function of the fluorescence intensity.

Results

36

bp/BFP3 in BY-2, 0.004% and 0.017% of living cells were eGFP+ respectively. For those vectors, a transformation efficiency (indicated by mCherry) of 19% and 6.3% was observed respectively. An HR frequency of 0.021% for 150 bp/BFP1 and 0.25% for 200 bp/BFP3 was thus detected for transformed BY-2 cells. However, of the 17 eGFP+ cells, only ten were mCherry+ for the 150 bp/BFP1 combination and of the 11 eGFP+ cells for 200 bp/BFP3 only six were mCherry+. This is likely due to imperfect gating: either the cells were wrongfully assigned as being eGFP+ or wrongfully assigned as being mCherry-. Another explanation could be silencing of mCherry. All eGFP+ cells were eBFP-. The transformation efficiency in PSB-D was close to zero (0.0097%) and very few eGFP+ cells were observed (0.0032%).

In the assay, the transformation of an eBFP+ cell to a non-fluorescent cell is an indication of NHEJ. Here, the gating of eBFP is not yet optimal due to its low intensity. The number of eBFP+ cells

measured is likely a considerable underestimation. For BY-2, the percentage of eBFP+ cells ranges from 6.96% to 10.4%, which is lower than the corresponding mCherry+ cells (ranging from 6.28%

to 19%). As a consequence, the estimation of NHEJ cannot be reliably calculated. For the case of 150 bp/BFP1 (690 916 events), the data suggest of all transformed cells 99.19% underwent NHEJ (mCherry+; eBFP-; eGFP-), in 7.17% of transformed cells no editing occurred (mCherry+; eBFP+; eGFP-), and in 0.014% of transformed cells HR occurred (mCherry+; eBFP-; eGFP+).

Even though the liquid BY-2 eBFP+ culture was easier to separate from the WT liquid BY-2 (Fig. 17B), the PSB-D cells used for supertransformation in the assay contained more than twice the number of relative eBFP+ cells (25.4% average) compared to BY-2 (9.6% average).

The FACS data affirms the observation that the transformation efficiency of eBFP-expressing

cultures is lower than WT cultures (Fig. 13). The eGFP vector was transformed in WT BY-2 and eBFP-expressing BY-2 cultures with an efficiency of 34.4% and 31.6% respectively. In WT PSB-D culture, eGFP was transformed with an efficiency of 63.2%, while eBFP-expressing PSB-D was supertransformed with an efficiency of 27.6%. mCherry linked to Cas9 was transformed in WT and eBFP-expressing BY-2 and PSB-D. In BY-2, the transformation efficiency of the WT culture was 40.7%, in eBFP-expressing BY-2 18.1%. For PSB-D the efficiency was 31.4% and 0% respectively.

Table 3: FACS data analysis of the BFP-to-GFP conversion assay. Per vector, the sample was measured twice, once

with a lower number of events and once with a higher number of events. Numbers represent counted cells,

numbers between brackets represent percentages. The percentage of living cells is relative to the total events, the

percentage of eBFP+, eGFP+, and mCherry+ cells are relative to the living cells.

CULTURE VECTOR EVENTS LIVING CELLS (%) eBFP (%) eGFP (%) mCherry (%)

BY-2 150 bp/BFP1 20 000 12 215 (61.1) 1249 (10.2) 0 (0) 2215 (18.1)

690 916 388 462 (56.2) 40 424 (10.4) 17 (0.004) 73 651 (19.0)

200 bp/BFP3 10 000 1291 (12.9) 104 (8.06) 0 (0) 94 (7.28)

915 864 63 441 (6.93) 4416 (6.96) 11 (0.017) 3985 (6.28)

PSB-D 150 bp/BFP1 20 000 9932 (49.7) 2601 (26.2) 0 (0) 0 (0)

50 000 30 818 (61.6) 7571 (24.6) 1 (0.0032) 3 (0.0097)

Discussion

37

IV. Discussion


During this project, we selected seven Cas9-driving promoters for a comparison analysis in Arabidopsis thaliana. The chosen promoters include the standard promoter used in most studies, PcUBI; promoters used in previous CRISPR/Cas studies, RPS5A (Tsutsui & Higashiyama, 2017), EC1 (Wang et al, 2015), YAO (Yan et al, 2015); and promoters used in a TALEN study, CLV3, P16, HMG (Forner et al, 2015). In all, but the Forner et al (2015) study, the promoter being investigated was compared to the 35S promoter. The studies concluded that the promoter that was tested performed better than the 35S promoter. Although 35S is a well-known constitutive promoter, it

was shown that the promoter is not constitutively active in the reproductive organs or meristematic tissue of Arabidopsis (Ge et al, 2008). From previous observations, it was indeed

apparent that the 35S is far from ideal as a promoter for Cas9. It is thus difficult to draw any conclusions concerning the best choice of promoter from these studies. The promoters investigated by Forner et al (2015) were used in a TALEN system. The TALEN editing tool uses two protein arms that bind in close proximity to one another on the target. In the study, both arms were expressed from different promoters. The combinations tested were CLV3/HMG, P16/UBQ (ubiquitin), and P16/HMG. The final combination resulted in the highest targeting efficiencies. Although these observations give an insight into the performance of these promoters, they cannot be compared to promoters used in CRISPR/Cas studies. Other factors complicating the comparison of described promoters are the usage of different terminators, targets, study design (number of

plants, replicates etc.), guide design, and measurements. In this study, we were able to make a reliable comparison between the mentioned promoters by keeping the conditions constant over all promoters. Cas9 was equipped with one of two single guides targeting the GLABRA1 (GL1) gene. The presence of trichomes was analyzed in the T1 and T2 generation. DNA was extracted from T1 for additional genotyping analysis

GLABRA1 as a target

We demonstrated that the GL1 gene can be used as a target to visualize the outcome of genome editing. A major advantage over other targets such as PDS (albino phenotype) (Yan et al, 2015) or BRI1 (dwarf phenotype) (Feng et al, 2013b; Yan et al, 2015), is that trichomes are not essential for

development. As such, fully mutant plants can easily be used for further propagation. Furthermore, GL1 is only involved in trichome initiation and thus a knockout of the gene has no impact on other processes. This makes the phenotype less complex as opposed to targets that play a more central role in the development such as CLV3 (club-like silique phenotype) (Forner et al, 2015). However, phenotypes such as albino and dwarf do stand out amongst other WT plants, making them easier to detect when screening a large number of plants. Plants need to be checked individually with a microscope when screening for the gl1 phenotype.

The phenotype of the T1 generation did not always correspond with the genotype (Fig. 6D). Plants with a high ICE/KO score that lacked the gl1 phenotype (as seen with EC1/GL1-2 and HMG/GL1-2)

Discussion

38

and plants with a low ICE/KO score with the gl1 phenotype (RPS5A/GL1-1 and P16/GL1-2) were observed. One explanation for this observation lies in the fact that complete leaves were sampled for the genotyping analysis. As a consequence, the average ICE score for the entire leaf is calculated. For the gl1 phenotype to occur, only epidermal cells need to have the mutant gene. In a situation where mesophyll cells are highly mutated, and epidermis cells are not, high ICE scores could be obtained while no phenotype was observed. The difference in phenotype and genotype in this study might also in part be attributed to errors during phenotyping or contamination between DNA samples. We know from personal communications with members of the lab that the phenotype is in accordance with the genotype in the homozygous T2 generation. The GL1 target has also already successfully been used in other studies (Hahn et al, 2017, 2018).

The glabra1 phenotype

All three phenotypes (WT, intermediate and no trichomes) were present in the T1 generation. The intermediate phenotype can serve as an indication for the time in the development the mutation occurred. Early mutations result in complete phenotypes, mutations created later on can result in intermediate phenotypes (although mutations created later on can also still result in complete phenotypes). The complete phenotype was seen most in the true leaves of the T1 generation, while the intermediate phenotype was significantly more abundant in the cauline leaves of T1. The observation seems counterintuitive since the cauline leaves originate after the true leaves and thus more complete phenotypes are expected. Most of the cauline leaves with the intermediate phenotype had trichomes solely at the edge of the leaf blades. This is a phenotype seen in gl1 Arabidopsis plants reported by Kirik (2005). In the study, gl1 myb23 Arabidopsis leaves completely

lacked trichomes, while gl1 myb23 plants rescued with a functional MYB23 gene (and its regulatory element) restored the presence of trichomes only on the edges of the leaves. Based on those results, we would expect to see no plants with the complete phenotype since the MYB23 gene was not targeted in our study (the gene was not sequenced, but neither guide showed homology with the gene). The MYB23 gene might be more active later in the development of the plant. This would explain why the phenotype most observed in the true leaves was the complete phenotype and the

phenotype with trichomes on the edges was far more plentiful on the cauline leaves. Repeating the experiment in a myb23 mutant background could shed some light on its involvement in the phenotypes seen in the true leaves and cauline leaves. Phenotyping of the cauline leaves of the T2 generation would also have been useful but that data was not collected.

The guides

Two guides, GL1-1 and GL1-2, were tested for each promoter. Both guides target the second exon of the GLABRA1 gene, GL1-2 being twelve nucleotides downstream of GL1-1. The GL1-1 guide was in almost all cases more efficient than GL1-2. For the EC1 promoter, however, the GL1-2 guide consistently produced more mutants than GL1-1 in T1. Both guides have an equal melting temperature and GC content, but different PAM sequence (TGG and AGG respectively).

Discussion

39

In an optimization study, a perfect guide is not always desired. In this study, efficiencies close to 100% were already obtained with GL1-1. Further optimization would not be measured using the GL1-1 guide. The GL1-2 guide would be more interesting since improvements could still result in higher efficiencies.

Comparison between the different promoters

The phenotyping and genotyping data of T1 show that the constitutive promoters, PcUBI and RPS5A, were most efficient in producing plants with the phenotype (intermediate and complete), with efficiencies up to 100% and 97% respectively and mean ICE scores of 87% for both. The P16 and HMG promoters, that are also constitutive but most active in stem cells, were almost equally

efficient according to the phenotyping data (96% and 93% respectively). This trend seemed to hold for the T2 generation (aside from P16). The genotyping data for T1 suggested slightly lower efficiencies for the P16 (up to 59% average) and HMG (up to 70% average). The P16 promoter appeared to be less efficient in T2, but the ICE scores from its corresponding T1 plant were only half compared to PcUBI, RPS5A, and HMG, making the comparison less meaningful. Although the HMG promoter appears to be significantly less active according to a previous study (Klepikova et al, 2016), the editing efficiency in T2 is comparable if not better than the other promoters that were tested.

The YAO (most active in tissue undergoing cell division, including embryo sac and embryo) and EC1 (exclusively active in the egg cell) promoters were less efficient in T1. Although the efficiency of the YAO promoter was relatively high according to the phenotyping and genotyping of T1 (up to

60% according to both), the number of gl1 mutants dropped to 38% in T2 even though the ICE scores of T1 were high (for GL1-1). The EC1 promoter showed a comparable efficiency to the YAO promoter in the phenotyping of true leaves of T1 (61%) but appeared to be less efficient when analyzing the genotyping data from the T1 true leaves (an ICE score up to 31%). However, for EC1/GL1-2, of the eleven plants phenotyped as having no trichomes, the ICE score was successfully obtained from only four plants, while the ICE score from 13 of the 16 plants with the WT phenotype was obtained. This likely had a negative impact on the mean value of the ICE score. For other promoter lines, the difference in the number of plants of which the ICE score was obtained was

less pronounced between WT and gl1 (Table A3). Still, the number of mutant cauline leaves was less for the EC1 promoter (42%) than for the YAO promoter (85%). Since the EC1 promoter should only be active in the egg cell, the chance for Cas9 to create mutations is limited to only a small time

window very early in the embryonic developmental stage. The window for Cas9 driven by the YAO promoter, on the other hand, is larger, increasing the chance for mutations. As opposed to the YAO promoter, the efficiency of the EC1 promoter in T2 (up to 100%) was comparable or higher to the constitutive promoters. While the T1 phenotypes are a result of a combination of somatic and heritable mutations, T2 phenotypes should only be the result of inheritable mutations as only Cas9-free T2 seeds are selected. Seeing as no intermediate phenotypes were observed in the T2 generation, this appeared to be the case. Genotyping of T2 should, however, be done for verification. The data suggest that the YAO promoter is more efficient in creating somatic mutations, while the EC1 promoter is more efficient in the creation of heritable mutations. Similar

Discussion

40

results concerning the heritability of mutations were obtained in previous studies where the EC1.2 and EC1 promoter respectively were compared to, amongst others, the YAO promoter (Miki et al, 2018; Wolter et al, 2018). Although in the latter study, the EC1 promoter showed a higher efficiency already in the T1 generation (using the in planta gene-editing method).

Finally, Cas9 expressed by the CLV3 promoter was the least proficient in the creation of gl1 mutants. The phenotyping and genotyping of T1 showed very little efficiency (10% with the gl1 phenotype and an average ICE score of 16%). Only the cauline leaves of T1 had a moderate number of mutants, up to 47%. Phenotyping of the T2 generation showed no mutants. The CLV3 gene is expressed exclusively in the SAM and axillary meristems, and is required for the homeostasis of the stem cells. The expression of CLV3 is not constitutive but highly regulated. During embryogenesis, the expression of CLV3 is dependent on the WUS concentration in the SAM (Brand

et al, 2002). During the development of the seedlings, other factors additionally play a role in the activity of the CLV3 promoter (Brand et al, 2002). The strong regulation of the CLV3 promoter

might be disadvantageous for the use in genome editing when a high level of editing is required. In addition, even in the SAM where the expression is highest, the expression level of CLV3 is very low compared to the other promoters (Klepikova et al, 2016).

For almost all promoters, a higher ICE score in T1 resulted in a higher mutation frequency in T2. This was not the case for the HMG promoter. Using the HMG promoter with GL1-1, a low, intermediate, and high score were about equally efficient (close to 100%) in producing mutants. This would be a very useful feature when heritable mutations are desired since T1 plants with few indels (thus with a low score) would also produce many seedlings with mutations. This trend seen with GL1-1 disappeared with the GL1-2 guide, however. More T2 seedlings from HMG lines should

be analyzed to draw further conclusions.

It must be noted that the expression pattern of Cas9 driven by the different promoters was not analyzed. It is possible that the activity of the promoters differs slightly from previously described reports.

FAST-negative seeds

The transformation vectors were equipped with a FAST module, allowing transformed seeds to be selected based on their fluorescence. Only fluorescent T1 seeds were chosen for further propagation, ensuring the presence of the CRISPR/Cas9 construct. If the construct is present only

once in the genome of the T1 plant, a 1:4 (non-fluorescent:fluorescent) ratio of offspring is expected. Many plants that lacked any fluorescent seeds were observed, half of which were plants carrying the EC1 promoter. Some hypotheses for this observation include: plants lacking fluorescent seeds were escapes, the plants only contained a partial T-DNA insertion, the FAST module was silenced in these plants, or a combination of several factors. The fact that this was seen more frequently in plants carrying the EC1 promoter might be by random chance. If there is, in fact, a causal relationship between the EC1 promoter and the silencing of the FAST module, the usefulness of the promoter would be diminished as the FAST technology would not be a reliable tool in this case. The plants lacking FAST-positive seeds all had an ICE score lower than 25. Why

Discussion

41

this seems to affect only plants with lower ICE scores remains to be tested. From PCR analysis on the genomic DNA of T1 plants lacking fluorescent seeds, we observed that in many cases the FAST module was present. Half of those plants appeared to lack the Cas9 gene. However, amplification of the endogenous PDS gene revealed that not all PCRs were successful. Based on the PCR analysis, we can conclude that not all T1 FAST-negative plants were escapes. A qPCR analysis is required to confirm the silencing hypothesis. The data from all untransformed T1 plants should be discarded from the analysis. At this moment, there is not enough information to make conclusions on the state of the FAST-negative seeds.


In this part of the project, an assay was developed that allows us to measure the frequency of HR in plant systems. The assay is based on the conversion of BFP to GFP via a single nucleotide

substitution. A reporter line carrying an expressed BFP gene is transformed with the CRISPR/Cas9 construct targeting a specific site in the BFP gene, and a template containing the substitution required for conversion to GFP. The number of conversions to GFP is an estimate of the efficiency of HR.

The necessity of the assay

Double-strand break repair by HR offers great potential for gene therapy as a way of substituting harmful mutations. HR can make specific mutations and allow for targeted integration of large

sequences, as opposed to NHEJ of which mutations are largely random and thus not suited for gene therapy. Base editing also has shortcomings compared to HR as it does not allow transversions. As a consequence, the optimization of HR has been the focus of many researchers. In plants, DSB repair by HR can be used to create specific mutations, alter the expression of endogenous genes, or introduce exogenous genes. These genetically modified plants can save a lot of time and money when used in combination or as a replacement for breeding programs. Just as in animal systems, the HR frequency in plants is too low to be used efficiently and a reporter is

needed that can measure the HR efficiency in a high-throughput manner. Finding conditions which bias HR over NHEJ requires a reporter system that can measure DBS repair outcome. Several reporters have been suggested for the use in animal systems. Similar reporters for plants systems are generally lacking. In this study, the reporter developed by Glaser et al (2016) for human cell

lines was adapted for plant systems.

The assay

We successfully developed the BFP-to-GFP conversion assay in BY-2 and PSB-D cells. Clusters of BY-2 cells expressing eGFP were counted using a fluorescence microscope. The number of clusters, as opposed to the total number of eGFP+ cells, was an estimate on the HR frequency (we assume a cluster of eGFP+ cells is derived from a single HR event). The number of cells in the cluster depends on the time between the HR event and the observation of the cluster. A longer time

Discussion

42

between HR and the observation means more time for the cells to divide and thus form bigger clusters. Clusters containing more cells are more easily visible, decreasing the chance of missing an HR event. However, as the cell density increases, the likelihood of eGFP+ clusters being covered by non-fluorescent cells increases as well. From the data gathered in this study, 15 to 20 days appeared to strike a good balance between waiting long enough and waiting too long to analyze the cells. The timing is less sensitive when the cell sorter is used to analyze the assay. Here, every eGFP+ cell is seen as an HR event.

After transformation of PSB-D culture, the cells are not transferred to solid medium as with BY-2. Instead, they are kept in liquid culture. This makes it very impractical to count the number of transformed cells using the fluorescence microscope. This is why only BY-2 cells were manually analyzed.

Homology arms and HR frequency

The assay was used to measure the HR efficiency of repair templates (with an insert size of 13 bp) with different homology arm lengths (50 bp, 100 bp, 150 bp, 200 bp). The data from the assay suggest that templates with longer homology arms have a higher chance of being involved in the DSB repair: a four-fold increase in homology length resulted in a 5.5-fold increase in HR efficiency. A similar result was obtained in a study with embryonic mouse cells where a four-fold increase in homology length resulted in an eight-fold increase in HR (Li et al, 2014). Previous studies on the length of homology arms in DSB repair showed that there is a critical point to which HR no longer increases and can even decrease with longer homology arms (Boel et al, 2018; Hendel et al, 2014;

Zhang et al, 2017). Here, the critical point was not yet reached at 200 bp homology. Further increases are required to determine the limit for an insert of this size. Longer templates require longer T-DNAs, however, decreasing the transformation efficiency (Park et al, 2000). In addition, amplicon sequencing of the target site for genotyping analysis might be more challenging with longer templates.

In this study, only symmetrical homology arms were used. It has been suggested that the use of

asymmetrical arms can boost HR. The reasoning behind this is that Cas9 remains attached for a long period (around 6 hours) after introducing the DSB, then asymmetrically dissociates from the cleaved DNA. The 3’ end of the strand not targeted by the guide is released first (Richardson et al, 2016). Richardson et al (2016) observed the highest HR frequency (57%) with a (single-stranded)

template (complementary to the non-target strand) showing 36 bp homology on the PAM-distal side, and 91 bp on the PAM-proximal side of the DSB. In that study, HR was measured using the BFP-to-GFP conversion assay in HEK293 and K562 cells. Using this information, a similar investigation could be done in plant systems with the assay developed in this project.

In addition to a difference in HR efficiency with different repair templates, the guide also appeared to have a significant impact on the outcome of DSB repair. The BFP3 guide was almost three times more efficient than either BFP1 or BFP2. There are three big differences between BFP3, and BFP1 and BFP2: the PAM sequence (CGG for BFP3, GGG for BFP1 and BFP2), the location of the guide targeting the eBFP gene, and the strand targeted by the guide (BFP3 targets the antisense strand,

Discussion

43

BFP1 and BFP2 target the sense strand). There are no reports suggesting the PAM or whether the sense or antisense strand is targeted have an impact on the efficiency of gene editing. The location of the guide is likely the most important factor influencing the efficiency. By analyzing the indel frequency for each guide, we could determine if there is a correlation between the indel frequency and the HR efficiency.

FACS for automatization

The cell sorter was used to count the number of fluorescent cells in the assay (eBFP, eGFP, mCherry) to automatize the analysis process. We showed that it is possible, to some degree, to separate the different fluorescent cells (BY-2 and PSB-D) using FACS. While the eGFP+ and mCherry+

cells could clearly be distinguished from the WT cells, eBFP+ cells were difficult to sort due to their low intensity; only small fractions of eBFP+ cells were captured (10% for BY-2 and 26% for PSB-D). Using more fit lasers to excite the fluorophore could increase the intensity and allow better sorting. The number of eBFP-expressing cells is needed to get an estimate on the NHEJ frequency. While this would be desirable data to collect, it is not necessary for the comparison of HR efficiencies between CRISPR/Cas designs.

Although eGFP was intense enough to easily separate eGFP+ cells from non-fluorescent cells, very few were observed with the cell sorter: from a plate containing 15 clusters (as observed with the fluorescence microscope), only 17 eGFP+ cells were detected. This might, in part, be due to the protoplasting and filtering steps, where many cells are lost. Also, only 10% of each protoplasted sample was analyzed on the FACS. Because liquid eGFP-expressing BY-2 and PSB-D cells could be

separated from WT cells with high efficiency (99.9% and 96.3% respectively), it is unlikely that the lack of eGFP detection in the assay was due to imprecise gating.

The gating for mCherry, on the other hand, was not yet optimal. Since mCherry is linked to Cas9, it serves as an indicator for transformed cells. Several eGFP+ cells were observed that lacked the mCherry signal. A very precise substitution is needed to convert BFP to GFP, making it very unlikely that the substitution occurred without the DSB and repair by HR. Instead, the mCherry intensity

was probably too low to be sorted with mCherry+ cells or the mCherry signal was silenced in these cells.

Using FACS for the analysis of the BFP-to-GFP conversion assay is not yet ideal. Manually screening BY-2 plates is more reliable at this moment to compare different CRISPR/Cas9 designs in their HR

efficiency.

A high-throughput system?

The assay can be used to test many conditions that may potentially enhance the HR frequency. An advantage over other methods such as herbicide tolerance (De Pater et al, 2018; Townsend et al, 2009) and the CRUCIFERIN-GFP fusion (Shaked et al, 2005) is that there is no need to grow and process plants, which requires more work and time than cell cultures. The SMRT technique also requires sample processing and can be more expensive than other methods. The BFP-to-GFP

Discussion

44

conversion assay is cheap and can be used in a relatively high-throughput manner. The assay can be completed in two to three weeks. When the assay is analyzed via the fluorescence microscope, the time needed is dependent on the number of samples being tested. When the analysis is done via the cell sorter, the number of samples have less of an impact on the time consumption. Still, the cell sorter is not as efficient in plant systems at it is in animal systems, because protoplasting is required (which includes transferring the cells to liquid three days prior). In addition, long FACS run times are necessary to detect any eGFP+ cells (at this moment).

A similar reporter to the BFP-to-GFP conversion assay is the Traffic Light Reporter. While the conversion assay is designed for small insertions, the TLR can be used for the optimization of larger insertion fragments. A benefit of the BFP-to-GFP conversion assay is its relatively simple design. The TLR requires more complex constructs. The TLR also deals with underestimations of NHEJ and

overestimations of HR in certain circumstances, while this is, in theory, not the case for the conversion assay. The TLR has not yet been reported in plant systems.

3. Conclusions

In this project, we showed that Cas9 driven by constitutive promoters (especially PcUBI and RPS5A) was most efficient in the creation of Arabidopsis plants with somatic and germline mutations. Of the tissue-specific promoters, the egg cell-specific promoter, EC1, was the most efficient in the production of inheritable mutations (reaching efficiencies comparable to the constitutive promoters). Our data suggest that there is no need to change the PcUBI promoter, which is the standard in many labs. In addition, we confirmed that plants with high ICE scores produce (in most

cases) more gene-edited seeds than plants with lower ICE scores. This information can be useful for the selection of T1 lines for propagation.

Furthermore, we were also able to develop a working, relatively high-throughput assay that can be used to compare different CRISPR/Cas designs on their HR efficiency in plant systems. The assay is based on a BFP-to-GFP conversion and was established in BY-2 and PSB-D cell cultures. As of right now, the assay can be reliably used with BY-2 cultures by manually counting the HR events. As such, a relative HR frequency can be estimated between different designs. Using the cell sorter for automated analysis of the assay is not yet sufficiently established. Once it is, absolute HR frequencies can be calculated and will allow the assay to be used in a more high-throughput manner. Using the assay, we found that increasing the homology arms of the template from 50 bp

to 200 bp resulted in higher HR efficiencies.

Materials and methods

45

V. Materials and methods

All vectors used for transformation in Arabidopsis thaliana, Tobacco Bright Yellow-2 (BY-2) culture, and PSB-D culture were made using Golden Gate and Gibson assembly cloning. Cloning PCR reactions were done using Q5® High-Fidelity DNA Polymerase (New England Biolabs). Gibson assembly reactions were done using 2x NEBuilder Hifi DNA Assembly Mix (New England Biolabs). The Golden Gate reactions were done with the BsaI-HFv2 restriction enzyme (New England Biolabs) using the following program: 30 x (37 °C for 3 minutes, 16 °C for 3 minutes), followed by 50 °C for 5 minutes and 80 °C for 5 minutes. Vectors were transformed in ccdB-sensitive DH5α Escherichia coli (E. coli) or One Shot™ ccdB Survival™ 2 T1R Competent Cells (Thermo Fisher Scientific) via a heat-shock treatment (42 seconds at 42 °C). E. coli were grown on Lysogeny broth medium with 100 µg/mL spectinomycin or 100 µg/mL carbenicillin and,

depending on the vector, 5% sucrose. Colony-touch PCR, restriction digest and/or Sanger sequencing by Eurofins Scientific (Mix2Seq) were used to validate the vectors. All primers can

be found in the addendum (Tables A1-2).

Geneious Prime® 2019.1.3 (https://www.geneious.com) was used for cloning in silico and data analysis. A Leica M165FC fluorescence stereomicroscope was used for both the promoter comparison and the BFP-to-GFP conversion assay part with the following filters: GFP (excitation 450 – 490 nm; emission 500 – 550 nm), RFP (ex. 541 – 551 nm; em. 570 – 640 nm), BFP (ex. 395 – 415 nm; em. 435 – 485 nm).


Vector cloning. All Golden Gate entry vectors were requested or present in the lab, except pGG-A-EC1.2en-pEC1.1-B. Vectors containing the promoters to be tested were used as a variable component in the Golden Gate reactions: pGG-A-PcUBIP-B (Houbaert et al, 2018), pGG-A-RPS5A-B (PSB Golden Gateway collection), pGG-A-YAOP-B (PSB Golden Gateway collection), pGG-A-EC1.2en-pEC1.1-B, pGG-A-CLV3-B (gift from Jan Lohmann), pGG-A-P16-B (gift from Jan Lohmann), pGG-A-CHMG-B (gift from Jan Lohmann). PCR on pHEE401E (Wang et al, 2015) was done to pick up EC1.2en-pEC1.1 (oligos 1381 + 1383 and 1382 + 1384) and a mutation was introduced to remove an AarI restriction site. Gibson assembly was performed using a BsaI-digested Greengate vector pGGA000 (Lampropoulos et al, 2013; Addgene plasmid # 48856) and the PCR products to construct the pGG-A-EC1.2en-pEC1.1-B entry vector.

Golden Gate was done with the variable entry vectors containing the promoter, entry modules pGG-C-Cas9_no_stop-D, pGG-D-P2A-mCherry-NLS-E, pGG-E-G7T-F, pGG-F-AarI-sacB-linker-AarI-G, and destination vector pFASTRK-AG. For each reaction 100 ng of each vector, 1.5 µL CutSmart® buffer (10x), 1.5 µL ATP (10 mM), 0.5 µL T4 DNA Ligase (400 u/µL), 0.5 µL BsaI-HFv2 was used. Resulting vectors were digested with AarI to generate overhang ends. A vector containing the AtU6-BsaI-ccdB-CmR-BsaI-scaffold construct was used in a PCR reaction (oligos 1601 + 1602) to pick up the ccdB-CmR module. Additional AarI compatible ends were incorporated. Through a Gibson assembly reaction with the AarI-digested vector and the PCR product, SacB was replaced by the ccdB-CmR construct.


46

The gRNAs GL1-1 and GL1-2 were made by annealing oligos 373 + 381 and 374 + 382 respectively with the following program: 95 °C for 5 minutes, followed by a temperature descent from 95 °C to 85 °C at a rate of 2 °C per second and a descent from 85 °C to 21 °C at a rate of 0.1 °C per second. The ccdB-CmR construct was replaced by the gRNA through a Golden Gate reaction.

Plasmid purification. Vectors were extracted from E. coli using the GeneJET Plasmid Miniprep Kit (Thermo Fischer Scientific) according to the manual.

Plant transformation and growth. All Golden Gate vectors were transformed in Agrobacterium

tumefaciens C58C1 by electroporation. Arabidopsis thaliana (Col-0) plants were transformed via the floral dip method (Clough & Bent, 1998). Eight weeks after floral dip, T1 seeds were

harvested and FAST-positive seeds were selected with the stereomicroscope. The seeds were sterilized in 70% ethanol and 3% NaOCl, sown on 2.15 g/L Murashige and Skoog (MS) salts, 0.5 g/L 2-(N-morpholino) ethanesulfonic acid (MES), 0.1 g/L myo-inositol, 10 g/L saccharose, 200 µg/mL Timentin and kept in a cold room (5 °C) for two days. Following the vernalization, the seeds were transferred to a growth chamber (21 °C, 16-hour day regime). After two and a half weeks, seedlings were transferred to Jiffy-7 pellets® and grown in a greenhouse at 21 °C under a 16-hour day regime. T2 seeds were harvested after two months. Non-fluorescent T2 seeds were selected, sterilized, sown on ½ MS medium + 200 µg/ml Timentin, and kept in a cold room (5 °C) for four days for vernalization. After vernalization seeds were transferred to a growth

chamber (21 °C, 16-hour day regime).

DNA extraction and molecular analysis. The first true leaves of each plant were harvested and stored in a -70 °C freezer overnight. Using a TissueLyser (Retsch MM300) the plant material was ground to powder. DNA extraction was done according to the protocol of Edwards et al. (1991 Nucleic Acids Research 19:1349) with slight modifications: an adapted extraction buffer was used (100 mM Tris HCl pH 8.0, 500 mM NaCl, 50 mM EDTA, 0.7% SDS), and a washing step with 70% ethanol was done prior to dissolving the pellet. Using PCR (oligos 690 + 691), a region of 693 bp spanning the CRISPR/Cas9 target site was amplified. The ALLin™ Red Taq Mastermix, 2X (highQu GmbH) was used with the following program: 95 °C for 3 minutes, followed by 33

cycles (30 seconds at 95 °C, 30 seconds at 63 °C, 1 minute at 72 °C), and 72°C for 5 minutes. Agarose gel electrophoresis confirmed the presence or absence of the PCR product. PCR clean-up was done by bead purification with HighPrepTM PCR (MAGBIO) according to the manual. DNA samples were Sanger sequenced (Eurofins Scientific) and analyzed by ICE V1.1 (https://ice.synthego.com/) (Hsiau et al, 2018).


47


Vector cloning. A vector containing the eBFP gene (pH_AtUBI10P-GFP_Y67H-NLS-AtUBI10T-A-AarI-G) was made by changing one nucleotide (T196TC) in an eGFP-carrying vector (pH_AtUBI10P-GFP-NLS-AtUBI10T-A-AarI-G). The eGFP-carrying vector was digested with NcoI and EcoRI and was used to amplify part of the eGFP gene with mismatch primers (oligos 1279 + 1282) to incorporate the required base substitution for GFP-to-BFP conversion. An additional PCR on the vector was done with complete homologous primers (oligos 1033 + 1281) to amplify the rest of the eGFP gene. The digested vector and PCR products were purified from gel with Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manual and assembled via a Gibson reaction.

The HR efficiency of eGFP templates with different lengths was determined using the BFP-to-GFP conversion assay. Sixteen combinations of four guides targeting different sites in the eBFP gene or

OLE1 gene and four templates were constructed. PCR was performed on pH_AtUBI10P-GFP-NLS-AtUBI10T-A-AarI-G with oligos 1609 + 1282. Oligo 1609 contains three mismatch nucleotides to

avoid recognition of the gRNAs. PCR was performed on pH_AtUBI10P-GFP_T66S-NLS-AtUBI10T-A-AarI-G with oligos 1033 + 1610. Vector AtUBI10P-GFP_T66S-NLS-AtUBI10T-A-AarI-G was digested with EcoRI and NcoI. A Gibson assembly was done with the digested vector and the 1609 + 1282 and 1033 + 1610 PCR products. The resulting vector contained the eGFP template with three mutations required to avoid being targeted by Cas9. To create Golden Gate entry vectors containing templates of different lengths, several PCRs were done on the template vector: 1611 + 1615 (50 bp homology arms), 1612 + 1616 (100 bp homology arms), 1613 + 1617 (150 bp homology arms), 1614 + 1618 (200 bp homology arms). Through Gibson assembly PCR products with compatible ends were inserted in a BsaI-digested pGGB000 entry vector. Three different guides

targeting eBFP and a guide targeting OLE1 inserted in a pGGA000 entry vector were present in the lab.

Golden Gate was performed with the four different guide entry vectors, four different template entry vectors, a linker (pGG-C-LinkerII-G), and an AarI-digested destination vector (pFASTRK-PcUBIP-AtCas9-NLS-P2A-mCherry-G7T-AarI-SacB-AarI).

Agroinfiltration of Nicotiana benthamiana. Assessment of the fluorescence of eGFP and eBFP was done through Agroinfiltration of Nicotiana benthamiana leaves. The vectors were transformed in Agrobacterium tumefaciens C58C1 by electroporation and grown overnight in YEB medium with

40 mg/L gentamycin, 100 mg/L spectinomycin, 200 mM MES, and 100 mM acetosyringone (AS). The culture was centrifuged, the supernatant discarded and resuspended in an infiltration buffer (100 mM AS, 1 M MgCl2, 200 mM MES) to an OD 600 of one. Agrobacterium was infiltrated in four-week-old N. benthamiana leaves with a 1 mL syringe without a needle. After three days, fluorescence was measured with the stereomicroscope.

Tobacco Bright Yellow-2 (BY-2) culture. BY-2 culture was grown in suspension medium containing 4.302 g/L MS salt mixture (Duchefa), 0.2 g/L KH2PO4, 30 g/L saccharose added with a BY-2 vitamin mix consisting of 3.98 g/L 2,4-Dichlorophenoxyacetic acid, 0.80 g/L thiamin, and 0.11 g/L


48

myoinositol. Depending on the cell line 30 µg/mL hygromycin was added. Cells were kept in the dark on an orbital shaker at 150 rpm at room temperature. Suspension medium was refreshed every week.

BY-2 transformation. All Golden Gate vectors were transformed in Agrobacterium tumefaciens C58C1 by electroporation. Agrobacterium was grown in ten ml YEB medium with 40 mg/L gentamycin and 100 mg/L spectinomycin and diluted to an OD 600 of one. BY-2 culture was inoculated with Agrobacterium in a petri dish. After two days, cells were plated on selective BY-2 medium containing BY-2 vitamin mix, 50 mg/L vancomycin, 100 mg/mL carbenicillin, and either 50 mg/L kanamycin or 30 mg/L hygromycin.

BY-2 cultures were transformed with pH_AtUBI10P-GFP_Y67H-NLS-AtUBI10T-A-AarI-G to create a stable eBFP-expressing cell culture required for the BFP-to-GFP assay. After three weeks individual

calli were picked and checked for fluorescent expression. Fluorescent-positive calli were transferred to BY-2 suspension medium with 50 mg/L vancomycin, 100 mg/mL carbenicillin and 30 mg/L hygromycin. After two weeks the selection was removed.

The eBFP-expressing cells were supertransformed with the vectors containing a combination of one of the templates and one of the guides. After two weeks callus was analyzed with the stereomicroscope.

BY-2 DNA extraction and molecular analysis. A fragment of BY-2 callus was used for DNA extraction.

The extraction was done as described in section 1. Three regions were amplified via PCR: the Cas9 gene (oligos 84 + 90), the PDS gene (oligos 101 + 102), and the eBFP/eGFP gene with its promoter (oligos 1026 + 1282). The ALLin™ Red Taq Mastermix, 2X (highQu GmbH) was used with the following program: 95 °C for 3 minutes, followed by 33 cycles (30 seconds at 95 °C, 30 seconds at 55 °C, 50 seconds at 72 °C), and 72°C for 5 minutes. Agarose gel electrophoresis confirmed the presence or absence of the PCR product. PCR clean-up was done by bead purification with HighPrepTM PCR (MAGBIO). DNA samples were Sanger sequenced by Eurofins Scientific (Mix2Seq) and analyzed by TIDER (Brinkman et al, 2018).

Protoplasting of BY-2 cells. Protoplasting of BY-2 cells in suspension culture was performed as

previously described (Bossche et al, 2013). Briefly, the suspension culture was centrifuged, and supernatant was discarded. The pellet was resuspended and incubated for three to four hours in a cell wall-degrading enzyme mixture consisting of 1 % (v/v) cellulase Y-C (Kyowa Chemicals Products Co, Osaka, Japan), 0.1 % (v/v) pectolyase Y-23 (Kyowa Chemicals Products Co), 0.4 M mannitol and 5 mM MES. Protoplasts were washed two times in a wash buffer consisting of 0.4 M mannitol, 2.5 mM CaCl2 .2H2O, and 1 mM MES.

Protoplasting of BY-2 callus from a plate was done by scraping the callus from the plate into suspension medium. The culture was kept in the dark on an orbital shaker at 150 rpm for three days. Protoplasting of the culture was done as before.


49

PSB-D culture. PSB-D culture was grown in ½ MS medium with minimal organics (MSMO) in the dark on an orbital shaker at 130 rpm at room temperature. Suspension medium was refreshed every week.

PSB-D transformation. Golden Gate vectors were transformed in Agrobacterium tumefaciens C58C1 by electroporation. Agrobacterium was grown overnight in two mL YEB medium with 40 mg/L gentamycin, 100 µg/L rifampicin, and 100 mg/L spectinomycin. The culture was washed in MSMO medium. Two days prior to transformation, a one in five dilution of a seven-day-old PSB-D cell suspension culture was made in MSMO. The two-day-old suspension culture was inoculated

with the Agrobacterium culture (at an O.D. 600 of one) and 100 mM AS in a 6-well multiplate for three days at 130 rpm at 25 °C. Transformed PSB-D culture was transferred to MSMO medium

containing 50 mg/L vancomycin, 100 mg/mL carbenicillin, and either 50 mg/L kanamycin or 30 mg/L hygromycin and put on an orbital shaker. After nine days, a one in three dilution was made in fresh MSMO with selection. The FACS analysis was done two weeks after transformation.

Protoplasting of PSB-D cells. Two days prior to protoplasting of the PSB-D cells, a one in five dilution of the culture was made in MSMO medium. The two-day-old suspension culture was centrifuged, and the supernatant was discarded. The pellet was resuspended in a digestion buffer consisting of 1,5 % (v/v) cellulase Y-C (Kyowa Chemicals Products Co, Osaka, Japan), 0.4 % (v/v) macerozyme

(Kyowa Chemicals Products Co), 0.4 M mannitol, 20 mM MES, and 20 mM KCl. The suspension was incubated in a petri dish on a shaker in the dark for three to four hours. Protoplasts were washed two times in a wash buffer consisting of 0.4 M mannitol, 2.5 mM CaCl2 .2H2O, and 1 mM MES. Washed protoplasts were transferred to a resuspension buffer consisting of 0.4 M mannitol, 15 mM MgCl2 .2H2O, and 5 mM MES.

FACS analysis. Analysis of the protoplasts (BY-2 and PSB-D) was done using a BD LSRFortessa (4 laser) analyzer. Graphs were made using FlowJo (https://www.flowjo.com).

3. Acknowledgments

The pHEE401E vector was a gift from Qi-Jun Chen (Addgene plasmid # 71287). The entry vectors containing the promoters for P16, CLV3, HMG were kindly provided by Jan Lohmann. We would like to thank Carina Braeckman (VIB-UGent Center for Plant Systems Biology) for the A. thaliana floral dip transformations, and Gert Van Isterdael and Julie Van Duyse for their assistance with the cell sorter and data analysis.

References

50

VI. References

Aird EJ, Lovendahl KN, St. Martin A, Harris RS & Gordon WR (2018) Increasing Cas9-mediated homology-directed repair efficiency through covalent tethering of DNA repair template. Commun. Biol.

Baltes NJ, Gil-Humanes J, Cermak T, Atkins PA & Voytas DF (2014) DNA Replicons for Plant Genome Engineering. Plant Cell

Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA & Horvath P (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science (80-. ).

Barrangou R & Marraffini LA (2014) CRISPR-cas systems: Prokaryotes upgrade to adaptive immunity. Mol. Cell

Belhaj K, Chaparro-Garcia A, Kamoun S & Nekrasov V (2013) Plant genome editing made easy: Targeted mutagenesis in model and crop plants using the CRISPR/Cas system. Plant Methods

Boel A, De Saffel H, Steyaert W, Callewaert B, De Paepe A, Coucke PJ & Willaert A (2018) CRISPR/Cas9-mediated homology-directed repair by ssODNs in zebrafish induces complex mutational patterns resulting from genomic integration of repair-template fragments. Dis. Model. Mech.

Bolotin A, Quinquis B, Sorokin A & Dusko Ehrlich S (2005) Clustered regularly interspaced short palindrome repeats (CRISPRs) have spacers of extrachromosomal origin. Microbiology

Bortesi L, Zhu C, Zischewski J, Perez L, Bassié L, Nadi R, Forni G, Lade SB, Soto E, Jin X, Medina V, Villorbina G, Muñoz P, Farré G, Fischer R, Twyman RM, Capell T, Christou P & Schillberg S (2016) Patterns of CRISPR/Cas9 activity in plants, animals and microbes. Plant Biotechnol. J.

Bossche R Vanden, Demedts B, Vanderhaeghen R & Goossens A (2013) Transient expression assays in tobacco protoplasts. Methods Mol. Biol.

Brand U, Grünewald M, Hobe M & Simon R (2002) Regulation of CLV3 Expression by Two Homeobox Genes in Arabidopsis . Plant Physiol.

Brinkman EK, Chen T, Amendola M & van Steensel B (2014) Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res.

Brinkman EK, Kousholt AN, Harmsen T, Leemans C, Chen T, Jonkers J & van Steensel B (2018) Easy quantification of template-directed CRISPR/Cas9 editing. Nucleic Acids Res.

Brouns SJJ, Jore MM, Lundgren M, Westra ER, Slijkhuis RJH, Snijders APL, Dickman MJ, Makarova KS, Koonin E V. & Van Der Oost J (2008) Small Crispr Rnas Guide Antiviral Defense in Prokaryotes. Cancer Epidemiol. Biomarkers Prev.

Butt H, Eid A, Ali Z, Atia MAM, Mokhtar MM, Hassan N, Lee CM, Bao G & Mahfouz MM (2017) Efficient CRISPR/Cas9-Mediated Genome Editing Using a Chimeric Single-Guide RNA Molecule. Front. Plant Sci. 8: 1–8

Carlson-Stevermer J, Abdeen AA, Kohlenberg L, Goedland M, Molugu K, Lou M & Saha K (2017) Assembly of CRISPR ribonucleoproteins with biotinylated oligonucleotides via an RNA aptamer for precise gene editing. Nat. Commun.

Certo MT, Ryu BY, Annis JE, Garibov M, Jarjour J, Rawlings DJ & Scharenberg AM (2011) Tracking genome engineering outcome at individual DNA breakpoints. Nat. Methods

Chang HHY, Pannunzio NR, Adachi N & Lieber MR (2017) Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat. Rev. Mol. Cell Biol.

Charpentier M, Khedher AHY, Menoret S, Brion A, Lamribet K, Dardillac E, Boix C, Perrouault L, Tesson L, Geny S, De Cian A, Itier JM, Anegon I, Lopez B, Giovannangeli C & Concordet JP (2018) CtIP fusion to Cas9 enhances transgene integration by homology-dependent repair. Nat. Commun.

Clough SJ & Bent AF (1998) Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J.

References

51

Coelho MA, Li S, Pane LS, Firth M, Ciotta G, Wrigley JD, Cuomo ME, Maresca M & Taylor BJM (2018) BE-FLARE: A fluorescent reporter of base editing activity reveals editing characteristics of APOBEC3A and APOBEC3B. BMC Biol.

Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA & Zhang F (2013) Multiplex genome engineering using CRISPR/Cas systems. Science (80-. ).

Couëdel C, Mills KD, Barchi M, Shen L, Olshen A, Johnson RD, Nussenzweig A, Essers J, Kanaar R, Li GC, Alt FW & Jasin M (2004) Collaboration of homologous recombination and nonhomologous end-joining factors for the survival and integrity of mice and cells. Genes Dev.

Dahan-Meir T, Filler-Hayut S, Melamed-Bessudo C, Bocobza S, Czosnek H, Aharoni A & Levy AA (2018) Efficient in planta gene targeting in tomato using geminiviral replicons and the CRISPR/Cas9 system. Plant J.

Donnelly MLL, Luke G, Mehrotra A, Li X, Hughes LE, Gani D & Ryan MD (2001) Analysis of the aphthovirus 2A/2B polyprotein ‘cleavage’ mechanism indicates not a proteolytic reaction, but a novel translational effect: A putative ribosomal ‘skip’. J. Gen. Virol.

Eid J, Fehr A, Gray J, Luong K, Lyle J, Otto G, Peluso P, Rank D, Baybayan P, Bettman B, Bibillo A, Bjornson K, Chaudhuri B, Christians F, Cicero R, Clark S, Dalal R, DeWinter A, Dixon J, Foquet M, et al (2009) Real-time DNA sequencing from single polymerase molecules. Science (80-. ).

Endo M, Mikami M & Toki S (2015) Multigene knockout utilizing off-target mutations of the CRISPR/cas9 system in rice. Plant Cell Physiol.

Even-Faitelson L, Samach A, Melamed-Bessudo C, Avivi-Ragolsky N & Levy AA (2011) Localized egg-cell expression of effector proteins for targeted modification of the Arabidopsis genome. Plant J.

Fauser F, Roth N, Pacher M, Ilg G, Sanchez-Fernandez R, Biesgen C & Puchta H (2012) In planta gene targeting. Proc. Natl. Acad. Sci.

Fauser F, Schiml S & Puchta H (2014) Both CRISPR/Cas-based nucleases and nickases can be used efficiently for genome engineering in Arabidopsis thaliana. Plant J.

Feng Z, Mao Y, Xu N, Zhang B, Wei P, Yang D-L, Wang Z, Zhang Z, Zheng R, Yang L, Zeng L, Liu X & Zhu J-K (2014) Multigeneration analysis reveals the inheritance, specificity, and patterns of CRISPR/Cas-induced gene modifications in Arabidopsis. Proc. Natl. Acad. Sci.

Feng Z, Zhang B, Ding W, Liu X, Yang D-L, Wei P, Cao F, Zhu S, Zhang F, Mao Y & Zhu J-K (2013a) Efficient genome editing in plants using a CRISPR/Cas system. Cell Res.

Feng Z, Zhang B, Ding W, Liu X, Yang DL, Wei P, Cao F, Zhu S, Zhang F, Mao Y & Zhu JK (2013b) Efficient genome editing in plants using a CRISPR/Cas system. Cell Res.

Forner J, Pfeiffer A, Langenecker T, Manavella P & Lohmann JU (2015) Germline-transmitted genome editing in Arabidopsis thaliana using TAL-effector-nucleases. PLoS One

Francis DB, Kozlov M, Chavez J, Chu J, Malu S, Hanna M & Cortes P (2014) DNA Ligase IV regulates XRCC4 nuclear localization. DNA Repair (Amst).

Fu Y, Foden JA, Khayter C, Maeder ML, Reyon D, Joung JK & Sander JD (2013) High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nat. Biotechnol.

Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI & Liu DR (2017) Programmable base editing of T to G C in genomic DNA without DNA cleavage. Nature

Ge X, Wang H & Cao K (2008) Transformation by T-DNA integration causes highly sterile phenotype independent of transgenes in Arabidopsis thaliana. Plant Cell Rep.

Glaser A, McColl B & Vadolas J (2016) Corrigendum to GFP to BFP Conversion: A Versatile Assay for the Quantification of CRISPR/Cas9-mediated Genome Editing (Molecular Therapy - Nucleic Acids (2016) 5 (e334) (S2162253117300616) (10.1038/mtna.2016.48)). Mol. Ther. - Nucleic Acids 5: 1–2

References

52

Gu B, Posfai E & Rossant J (2018) Efficient generation of targeted large insertions by microinjection into two-cell-stage mouse embryos. Nat. Biotechnol.

Gutschner T, Haemmerle M, Genovese G, Draetta GF & Chin L (2016) Post-translational Regulation of Cas9 during G1 Enhances Homology-Directed Repair. Cell Rep.

Hahn F, Eisenhut M, Mantegazza O & Weber APM (2018) Homology-Directed Repair of a Defective Glabrous Gene in Arabidopsis With Cas9-Based Gene Targeting. Front. Plant Sci.

Hahn F, Mantegazza O, Greiner A, Hegemann P, Eisenhut M & Weber APM (2017) An Efficient Visual Screen for CRISPR/Cas9 Activity in Arabidopsis thaliana. Front. Plant Sci.

Hale CR, Zhao P, Olson S, Duff MO, Graveley BR, Wells L, Terns RM & Terns MP (2009) RNA-Guided RNA Cleavage by a CRISPR RNA-Cas Protein Complex. Cell

Hendel A, Kildebeck EJ, Fine EJ, Clark JT, Punjya N, Sebastiano V, Bao G & Porteus MH (2014) Quantifying genome-editing outcomes at endogenous loci with SMRT sequencing. Cell Rep.

Horvath P & Barrangou R (2010) CRISPR/Cas, the immune system of Bacteria and Archaea. Science (80-. ).

Houbaert A, Zhang C, Tiwari M, Wang K, de Marcos Serrano A, Savatin D V., Urs MJ, Zhiponova MK, Gudesblat GE, Vanhoutte I, Eeckhout D, Boeren S, Karimi M, Betti C, Jacobs T, Fenoll C, Mena M, de Vries S, De Jaeger G & Russinova E (2018) POLAR-guided signalling complex assembly and localization drive asymmetric cell division. Nature

Hsiau T, Maures T, Waite K, Yang J, Kelso R, Holden K & Stoner R (2018) Inference of CRISPR Edits from Sanger Trace Data. bioRxiv

Hsu PD, Scott DA, Weinstein JA, Ran FA, Konermann S, Agarwala V, Li Y, Fine EJ, Wu X, Shalem O, Cradick TJ, Marraffini LA, Bao G & Zhang F (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat. Biotechnol.

Hua K, Tao X, Yuan F, Wang D & Zhu J-K (2018) Precise A·T to G·C Base Editing in the Rice Genome. Mol. Plant

Huang TK & Puchta H (2019) CRISPR/Cas-mediated gene targeting in plants: finally a turn for the better for homologous recombination. Plant Cell Rep.

Jansen R, Van Embden JDA, Gaastra W & Schouls LM (2002) Identification of genes that are associated with DNA repeats in prokaryotes. Mol. Microbiol.

Jayathilaka K, Sheridan SD, Bold TD, Bochenska K, Logan HL, Weichselbaum RR, Bishop DK & Connell PP (2008) A chemical compound that stimulates the human homologous recombination protein RAD51. Proc. Natl. Acad. Sci.

Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA & Charpentier E (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science (80-. ).

Kirik V (2005) Functional diversification of MYB23 and GL1 genes in trichome morphogenesis and initiation. Development

Klepikova A V., Kasianov AS, Gerasimov ES, Logacheva MD & Penin AA (2016) A high resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA-seq profiling. Plant J.

Komor AC, Kim YB, Packer MS, Zuris JA & Liu DR (2016) Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature

Komor AC, Zhao KT, Packer MS, Gaudelli NM, Waterbury AL, Koblan LW, Kim YB, Badran AH & Liu DR (2017) Improved base excision repair inhibition and bacteriophage Mu Gam protein yields C:G-to-T:A base editors with higher efficiency and product purity. Sci. Adv.

Koonin E V. & Makarova KS (2017) Mobile genetic elements and evolution of crispr-cas systems: All theway there and back. Genome Biol. Evol.

Lampropoulos A, Sutikovic Z, Wenzl C, Maegele I, Lohmann JU & Forner J (2013) GreenGate - A novel, versatile, and efficient cloning system for plant transgenesis. PLoS One

References

53

Lee K, Mackley VA, Rao A, Chong AT, Dewitt MA, Corn JE & Murthy N (2017) Synthetically modified guide RNA and donor DNA are a versatile platform for CRISPR-Cas9 engineering. Elife

Lee KY, Townsend J, Tepperman J, Black M, Chui CF, Mazur B, Dunsmuir P & Bedbrook J (1988) The molecular basis of sulfonylurea herbicide resistance in tobacco. EMBO J.

Li G, Zhang X, Zhong C, Mo J, Quan R, Yang J, Liu D, Li Z, Yang H & Wu Z (2017) Small molecules enhance CRISPR/Cas9-mediated homology-directed genome editing in primary cells. Sci. Rep.

Li H-J, Liu N-Y, Shi D-Q, Liu J & Yang W-C (2010) YAO is a nucleolar WD40-repeat protein critical for embryogenesis and gametogenesis in Arabidopsis. BMC Plant Biol.

Li K, Wang G, Andersen T, Zhou P & Pu WT (2014) Optimization of genome engineering approaches with the CRISPR/Cas9 system. PLoS One

Liang G, Zhang H, Lou D & Yu D (2016) Selection of highly efficient sgRNAs for CRISPR/Cas9-based plant genome editing. Sci. Rep.

Llorente B & Symington LS (2004) The Mre11 Nuclease Is Not Required for 5’ to 3’ Resection at Multiple HO-Induced Double-Strand Breaks. Mol. Cell. Biol.

Ma M, Zhuang F, Hu X, Wang B, Wen XZ, Ji JF & Xi JJ (2017) Efficient generation of mice carrying homozygous double-floxp alleles using the Cas9-Avidin/Biotin-donor DNA system. Cell Res.

Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z & Liu YG (2015) A Robust CRISPR/Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol. Plant

Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Barrangou R, Brouns SJJ, Charpentier E, Haft DH, Horvath P, Moineau S, Mojica FJM, Terns RM, Terns MP, White MF, Yakunin AF, Garrett RA, Van Der Oost J, Backofen R, et al (2015) An updated evolutionary classification of CRISPR-Cas systems. Nat. Rev. Microbiol.

Mao Y, Zhang Z, Feng Z, Wei P, Zhang H, Botella JR & Zhu JK (2016) Development of germ-line-specific CRISPR-Cas9 systems to improve the production of heritable gene modifications in Arabidopsis. Plant Biotechnol. J.

Mao Z, Bozzella M, Seluanov A & Gorbunova V (2008) Comparison of nonhomologous end joining and homologous recombination in human cells. DNA Repair (Amst).

Mari P-O, Florea BI, Persengiev SP, Verkaik NS, Bruggenwirth HT, Modesti M, Giglia-Mari G, Bezstarosti K, Demmers JAA, Luider TM, Houtsmuller AB & van Gent DC (2006) Dynamic assembly of end-joining complexes requires interaction between Ku70/80 and XRCC4. Proc. Natl. Acad. Sci.

Marraffini LA & Sontheimer EJ (2008) CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science (80-. ).

McVey M & Lee SE (2008) MMEJ repair of double-strand breaks (director’s cut): deleted sequences and alternative endings. Trends Genet.

Mekler V, Minakhin L, Semenova E, Kuznedelov K & Severinov K (2016) Kinetics of the CRISPR-Cas9 effector complex assembly and the role of 3′-terminal segment of guide RNA. Nucleic Acids Res.

Miki D, Zhang W, Zeng W, Feng Z & Zhu JK (2018) CRISPR/Cas9-mediated gene targeting in Arabidopsis using sequential transformation. Nat. Commun.

Mimitou EP & Symington LS (2008) Sae2, Exo1 and Sgs1 collaborate in DNA double-strand break processing. Nature

Miura T, Yamana Y, Usui T, Ogawa HI, Yamamoto MT & Kusano K (2012) Homologous recombination via synthesis-dependent strand annealing in yeast requires the IRC20 and SRS2 DNA helicases. Genetics

Mojica FJM, Díez-Villaseñor C, García-Martínez J & Soria E (2005) Intervening sequences of regularly spaced prokaryotic repeats derive from foreign genetic elements. J. Mol. Evol.

Morisato D & Kleckner N (1984) Transposase promotes double strand breaks and single strand joints at Tn10 termini in vivo. Cell

References

54

Nishimasu H & Nureki O (2017) Structures and mechanisms of CRISPR RNA-guided effector nucleases. Curr. Opin. Struct. Biol.

Nishimasu H, Ran FA, Hsu PD, Konermann S, Shehata SI, Dohmae N, Ishitani R, Zhang F & Nureki O (2014) Crystal structure of Cas9 in complex with guide RNA and target DNA. Cell

Ordon J, Bressan M, Kretschmer C, Dall’Osto L, Marillonnet S, Bassi R & Stuttmann J (2019) Optimized Cas9 expression systems for highly efficient Arabidopsis genome editing facilitate isolation of complex alleles in a single generation. Funct. Integr. Genomics

Park SH, Lee BM, Salas MG, Srivatanakul M & Smith RH (2000) Shorter T-DNA or additional virulence genes improve Agrobactrium-mediated transformation. Theor. Appl. Genet.

De Pater S, Klemann BJPM & Hooykaas PJJ (2018) True gene-targeting events by CRISPR/Cas-induced DSB repair of the PPO locus with an ectopically integrated repair template. Sci. Rep.

Pattanayak V, Lin S, Guilinger JP, Ma E, Doudna JA & Liu DR (2013) High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nat. Biotechnol.

Petukhova G, Stratton S & Sung P (1998) Catalysis of homologous DNA pairing by yeast Rad51 and Rad54 proteins. Nature

Plessis A, Perrin A, Haber JE & Dujon B (1992) Site-specific recombination determined by I-SceI, a mitochondrial group I intron-encoded endonuclease expressed in the yeast nucleus. Genetics

Porteus MH & Baltimore D (2003) Chimeric nucleases stimulate gene targeting in human cells. Science (80-. ).

Puchta H (1998) Repair of genomic double-strand breaks in somatic plant cells by one-sided invasion of homologous sequences. Plant J.

Qi Y, Zhang Y, Zhang F, Baller JA, Cleland SC, Ryu Y, Starker CG & Voytas DF (2013) Increasing frequencies of site-specific mutagenesis and gene targeting in Arabidopsis by manipulating DNA repair pathways. Genome Res.

Richardson CD, Ray GJ, DeWitt MA, Curie GL & Corn JE (2016) Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat. Biotechnol.

Rouet P, Smih F & Jasin M (1994) Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Mol. Cell. Biol.

Rudin N, Sugarman E & Haber JE (1989) Genetic and physical analysis of double-strand break repair and recombination in Saccharomyces cerevisiae. Genetics

Savic N, Ringnalda FCAS, Lindsay H, Berk C, Bargsten K, Li Y, Neri D, Robinson MD, Ciaudo C, Hall J, Jinek M & Schwank G (2018) Covalent linkage of the DNA repair template to the CRISPR-Cas9 nuclease enhances homology-directed repair. Elife

Scherer S (1979) Replacement of Chromosome Segments with Altered DNA Sequences Constructed in vitro. Proc. Natl. Acad. Sci.

Schiml S, Fauser F & Puchta H (2014) The CRISPR/Cas system can be used as nuclease for in planta gene targeting and as paired nickases for directed mutagenesis in Arabidopsis resulting in heritable progeny. Plant J.

Shaked H, Melamed-Bessudo C & Levy AA (2005) High-frequency gene targeting in Arabidopsis plants expressing the yeast RAD54 gene. Proc. Natl. Acad. Sci.

Shimada TL, Shimada T & Hara-Nishimura I (2010) A rapid and non-destructive screenable marker, FAST, for identifying transformed seeds of Arabidopsis thaliana: TECHNICAL ADVANCE. Plant J.

Smithies O, Gregg RG, Boggs SS, Koralewski MA & Kucherlapati RS (1985) Insertion of DNA sequences into the human chromosomal β-globin locus by homologous recombination. Nature

Storici F, Bebenek K, Kunkel TA, Gordenin DA & Resnick MA (2007) RNA-templated DNA repair. Nature

Sugiyama T & Kowalczykowski SC (2002) Rad52 protein associates with replication protein A (RPA)-single-stranded

References

55

DNA to accelerate Rad51-mediated displacement of RPA and presynaptic complex formation. J. Biol. Chem.

Sung P & Klein H (2006) Mechanism of homologous recombination: Mediators and helicases take on regulatory functions. Nat. Rev. Mol. Cell Biol.

Sung P & Stratton SA (1996) Yeast RAD51 recombinase mediates polar DNA strand exchange in the absence of ATP hydrolysis. J. Biol. Chem.

Tang X, Zheng X, Qi Y, Zhang D, Cheng Y, Tang A, Voytas DF & Zhang Y (2016) A Single Transcript CRISPR-Cas9 System for Efficient Genome Editing in Plants. Mol. Plant

Thomas KR, Folger KR & Capecchi MR (1986) High frequency targeting of genes to specific sites in the mammalian genome. Cell

Townsend JA, Wright DA, Winfrey RJ, Fu F, Maeder ML, Joung JK & Voytas DF (2009) High-frequency modification of plant genes using engineered zinc-finger nucleases. Nature

Tran N-T, Bashir S, Li X, Rossius J, Chu VT, Rajewsky K & Kühn R (2019) Enhancement of Precise Gene Editing by the Association of Cas9 With Homologous Recombination Factors. Front. Genet. 10: 365 Available at: https://www.frontiersin.org/article/10.3389/fgene.2019.00365

Tsutsui H & Higashiyama T (2017) PKAMA-ITACHI vectors for highly efficient CRISPR/Cas9-mediated gene knockout in Arabidopsis thaliana. Plant Cell Physiol.

Uematsu N, Weterings E, Yano KI, Morotomi-Yano K, Jakob B, Taucher-Scholz G, Mari PO, Van Gent DC, Chen BPC & Chen DJ (2007) Autophosphorylation of DNA-PKCS regulates its dynamics at DNA double-strand breaks. J. Cell Biol.

Vicente MM, Mendes A, Cruz M, Vicente JR & Barreto VM (2019) A CyclinB2-Cas9 fusion promotes the homology-directed repair of double-strand breaks. Biorxiv Available at: http://dx.doi.org/10.1101/555144

Wang M, Lu Y, Botella JR, Mao Y, Hua K & Zhu J (2017) Gene Targeting by Homology-Directed Repair in Rice Using a Geminivirus-Based CRISPR/Cas9 System. Mol. Plant

Wang ZP, Xing HL, Dong L, Zhang HY, Han CY, Wang XC & Chen QJ (2015) Egg cell-specific promoter-controlled CRISPR/Cas9 efficiently generates homozygous mutants for multiple target genes in Arabidopsis in a single generation. Genome Biol.

Westra ER, Buckling A & Fineran PC (2014) CRISPR-Cas systems: Beyond adaptive immunity. Nat. Rev. Microbiol.

Wolter F, Klemm J & Puchta H (2018) Efficient in planta gene targeting in Arabidopsis using egg cell-specific expression of the Cas9 nuclease of Staphylococcus aureus. Plant J.

Wu L & Hickson IO (2003) The Bloom’s syndrome helicase suppresses crossing over during homologous recombination. Nature

Yan F, Kuang Y, Ren B, Wang J, Zhang D, Lin H, Yang B, Zhou X & Zhou H (2018) Highly Efficient A·T to G·C Base Editing by Cas9n-Guided tRNA Adenosine Deaminase in Rice. Mol. Plant

Yan L, Wei S, Wu Y, Hu R, Li H, Yang W & Xie Q (2015) High-Efficiency Genome Editing in Arabidopsis Using YAO Promoter-Driven CRISPR/Cas9 System. Mol. Plant

Yourik P, Fuchs RT, Mabuchi M, Curcuru JL & Robb GB (2019) Staphylococcus aureus Cas9 is a multiple-turnover enzyme. RNA

Zhang JP, Li XL, Li GH, Chen W, Arakaki C, Botimer GD, Baylink D, Zhang L, Wen W, Fu YW, Xu J, Chun N, Yuan W, Cheng T & Zhang XB (2017) Efficient precise knockin with a double cut HDR donor after CRISPR/Cas9-mediated double-stranded DNA cleavage. Genome Biol.

Zhang Q, Doak TG & Ye Y (2014) Expanding the catalog of cas genes with metagenomes. Nucleic Acids Res.

Zhao W, Vaithiyalingam S, San Filippo J, Maranon DG, Jimenez-Sainz J, Fontenay G V., Kwon Y, Leung SG, Lu L, Jensen RB, Chazin WJ, Wiese C & Sung P (2015) Promotion of BRCA2-Dependent Homologous Recombination by DSS1 via RPA Targeting and DNA Mimicry. Mol. Cell

References

56

Zong Y, Wang Y, Li C, Zhang R, Chen K, Ran Y, Qiu JL, Wang D & Gao C (2017) Precise base editing in rice, wheat and maize with a Cas9-cytidine deaminase fusion. Nat. Biotechnol.

Addendum

VII. Addendum

1. Primers

Table A1: Primers used for cloning vectors in the promoter comparison part.

Oligo Forward/Reverse Sequence

373 Forward 5’-ATTGGGAAAAGTTGTAGACTGAGA-3’

374 Forward 5’-ATTGTTGAGCCCTAATGTGAACAA-3’

381 Reverse 5’-GGAAAAGTTGTAGACTGAGAGTTT-3’

382 Reverse 5’-TTGAGCCCTAATGTGAACAAGTTT-3’

690 Forward 5’-TGTGCAACTCTTTTCTTCTTCAGA-3’

691 Reverse 5’-ACAAGAAAGGTTTATGGACAGTTGA-3’

1381 Forward 5’-AGAAGTGAAGCTTGGTCTCAACCTGAATAAAAGCATTTGCGTTTGGTTTATC-3’

1382 Forward 5’-CAACCTTTCAAATTTGCAGTATTGCAGGGTGTCTCTGTGTCTTTAAAAT-3’

1383 Reverse 5’-TGCAATACTGCAAATTTGAAAGGTTG-3’

1384 Reverse 5’-AGGGCGAGAATTCGGTCTCATGTTTTCTCAACAGATTGATAAGGTCGAAA-3’

1601 Forward 5’-TAAGCTAGGTAGTAACTAGTCTTTTTTTCTTCTTCTTCGTTC-3’

1602 Reverse 5’-ACTCGCATACGCGATTCTAGATACAAAAAAAGCACCGACTCGGTG-3’

Table A2: Primers used for cloning vectors in the BFP-to-GFP conversion array part.

Oligo Forward/Reverse Sequence

101 Forward 5’-GACGTCAGGAAGAACATGGTC-3’

102 Reverse 5’-AACACCTCGTCGGTCACGC-3’

1026 Forward 5’-AGTTTCTAGTTTGTGCGATCGA-3’

1033 Forward 5’-AACAGTATTCAGTCGACTGGTACCAACA-3’

1279 Forward 5’-CACCCTCGTGACCACCCTGAGCCACGGCGTGCAGTGCTTCAG-3’

1281 Reverse 5’-TCAGGGTGGTCACGAGGGTG-3’

1282 Reverse 5’-TTCCTTGCTTGCTCTTCACGC-3’

1282 Reverse 5’-TTCCTTGCTTGCTCTTCACGC-3’

1609 Forward 5’- TGGCCCACCCTCGTGACCACGCTGACATACGGTGTGCAGTGCTTCAGCC-3’

1611 Forward 5’-AGAAGTGAAGCTTGGTCTCAAACAATCTGCACCACCGGC-3’

Addendum

1612 Forward 5’-AGAAGTGAAGCTTGGTCTCAAACACCGGCGAGGGCGAG-3’

1613 Forward 5’-AGAAGTGAAGCTTGGTCTCAAACACATCCTGGTCGAGCTG-3’

1614 Forward 5’-AGAAGTGAAGCTTGGTCTCAAACACAGGCTCCATGGTGAG-3’

1615 Reverse 5’-AGGGCGAGAATTCGGTCTCAAGCCAAGAAGTCGTGCTGCTTC-3’

1616 Reverse 5’-AGGGCGAGAATTCGGTCTCAAGCCTGAAGAAGATGGTGCGCTC-3’

1617 Reverse 5’-AGGGCGAGAATTCGGTCTCAAGCCGTCGCCCTCGAACTTCA-3’

1618 Reverse 5’-AGGGCGAGAATTCGGTCTCAAGCCCCGTCCTCCTTGAAGTC-3’

2. Protocols

Protocols from commercials products are referred to in the materials and methods sections as ‘according to the manual’ and are not presented here.

E. coli transformation by heat-shock

• Thaw heat-shock competent E. coli cells on ice and transfer 50 µL to a 1.5 mL Eppendorf tube

• Add 1 µL of plasmid DNA (100 ng/µL) to the tube

• Leave 20 minutes on ice

• Heat-shock for 42 seconds at 42 °C

• Leave 5 minutes on ice

• Add 200 µL super optimal broth medium

• Incubate for 1 hour at 37 °C (250 rpm)

• Plate 200 µL on LB medium with antibiotic selection

• Incubate overnight at 37 °C

Agrobacterium transformation by electroporation

• Thaw electrocompetent Agrobacterium culture on ice and transfer 50 µL to a pre-

cooled electroporation cuvette

• Add 1 µL of plasmid DNA (100 ng/µL) to the cuvette

• Electroporation using the BioRad Gene Pulser (program: EC2)

• Add 950 µL of YEB medium to the cuvette

• With a glass pipette transfer the Agrobacterium culture to a Greiner tube

• Incubate for 2 hours at 28 °C (250 rpm)

• Plate 200 µL on YEB medium with antibiotic selection (40 mg/L gentamycin, 100 µg/L

rifampicin, and 100 mg/L spectinomycin (RGS))

• Incubate for 2 days at 28 °C

Addendum

Agroinfiltration of Nicotiana benthamiana

Infiltration buffer (50 mL):

➢ 50 µL 100 mM acetosyringone (AS)

➢ 500 µL 1 M MgCl2

➢ 2.5 mL 200 mM MES

➢ 46.95 mL MQ

• Start Agrobacterium strains on a fresh YEB plate (+ RGS)

• Incubate for 2 days at 28 °C

• Incubate a preculture in 5 mL YEB (+ RGS) overnight

• Grow a new culture in 25 mL Erlenmeyer overnight containing: 9 mL YEB (+ GS, no rifampicin),

500 µL 200 mM MES, 2 µL 100 mM AS, 500 µL of the preculture

• The following day, water the N. Benthamiana plants in the morning.

• Continue with the preparation of the culture in the afternoon

• Centrifuge 10 mL culture for 10 minutes at 4000 rpm

• Resuspend in 5 mL infiltration buffer

• Adjust with the infiltration buffer the O.D. 600 to one

• Leave 2 to 3 hours at room temperature

• Infiltrate the Agrobacterium culture with a 1 mL syringe without a needle (not too close to

nerves)

DNA extraction

Extraction buffer (5 mL):

➢ 0.5 mL 0.1 M Tris HCl pH 8.0

➢ 0.5 mL 0.5 M NaCl

➢ 0.5 mL 0.5 M EDTA

➢ 350 µL 0.7% SDS

➢ 3.25 mL MQ

T10 (5 mL):

➢ 50 µL 1 M Tris HCl pH 8.0

➢ 5 mL MQ

• Transfer sample (leaves or callus) to a 2 mL Eppendorf tube containing two 3 mm metal

grinding beads.

• Put in liquid nitrogen after sampling

Addendum

• Grind the harvested sample during 1 minute at 20 Hz with the Retch (if no powder is seen,

repeat the grinding step)

• Add 400 µL extraction buffer and mix well (no vortex)

• Put the tubes in a thermo block at 65 °C for 30 minutes

• Centrifuge the tubes for 5 minutes at 12 000 rpm

• Transfer 300 µL supernatant to a new 1.5 mL tube

• Add 300 µL isopropanol and mix by inverting the tubes (no vortex)


• Discard the supernatant (the pellet can sometimes be seen as a smear along the side of the

tube)

• Add 300 µL 70% ethanol to wash the pellet


• Discard the supernatant and leave the pellet to dry at room temperature

• Dissolve the pellet in 200 µL T10

• Put the tubes in a thermo block at 60 °C for 15 minutes and mix at 650 rpm

• Centrifuge the tubes for 2 min at 12 000 rpm

• Transfer 150 µL to a new 1.5 mL tube

BY-2 transformation

• Dilute the BY-2 culture: 3 and 4 mL in 40 mL BY-2 medium (in a 250 mL Erlenmeyer)

• Incubate 3 days at 28 °C (150 rpm)

• Incubate Agrobacterium 3 days in 5 - 10 mL YEB (+ RG, without rifampicin) in a 50 mL falcon

tube (on the same day as BY-2 dilution)

• After 3 days, dilute the growing Agrobacterium culture five times

• Grow Agrobacterium until the O.D. 600 of one is reached

• Take 4 mL BY-2 culture and decant in a (round and deep) petri dish

• Mix gently with 200 µL Agrobacterium

• Incubate at room temperature for 2 days

• Plate all cells on solid selective BY-2 medium (BY-2 vitamin mix, 50 mg/L vancomycin, 100

mg/mL carbenicillin, and either 50 mg/L kanamycin or 30 mg/L hygromycin)

PSB-D transformation

• Incubate 2 mL of Agrobacterium culture in YEB (+ RGS) in a Greiner tube overnight

• Dilute 20 mL of a 7-day-old Arabidopsis cell suspension culture (PSB-D) in 80 mL fresh MSMO

and grow overnight at room temperature (130 rpm)

• Transfer the Agrobacterium culture to 20 mL YEB medium (+RGS) and incubate overnight at 28

°C (250 rpm)

Addendum

• Wash Agrobacterium

o Centrifuge the bacterial culture for 15 minutes at 4000 rpm

o Discard the supernatant

o Add 20 mL of MSMO, vortex until pellet dissolves

o Centrifuge for 15 minutes at 4000 rpm


o Add 20 mL of MSMO, vortex until pellet dissolves

o Centrifuge for 15 minutes at 4000 rpm


o Dilute with MSMO until an O.D. 600 of one is reached

• Take a 6-well multiplate and add to each well: 6 µL of AS (100 mM stock), 3 mL of the 2-day-

old PSB-D culture, 200 µL of Agrobacterium culture (O.D. 600 of one)

• Close the multiwell plate, tape it with MicroporeTM surgical tape, and incubate it at 25 °C for

3 days (130 rpm on an orbital shaker)

• Bring 3 mL of transformed PSB-D cells (content of one well) into 7 mL MSMO with 50 mg/L

vancomycin, 100 mg/mL carbenicillin, and either 50 mg/L kanamycin or 30 mg/L hygromycin in

a 25 mL shake flask

• Tape the flask with MicroporeTM surgical tape

• Put the flask on an orbital shaker at 130 rpm at 25 °C for 9 days

• Transfer the 10 mL into a 100 mL shake flask containing 30 mL of fresh MSMO with 50 mg/L

vancomycin, 100 mg/mL carbenicillin, and either 50 mg/L kanamycin or 30 mg/L hygromycin

BY-2 protoplasting

Cell wall-degrading enzyme mixture (100 mL):

➢ 1 g 1% (v/v) cellulase

➢ 1 g 0.1% (v/v) pectolyase

➢ 1 mL 500 mM MES

➢ 99 mL 0.4 M mannitol

Dissolve the solution by mixing on a vortex and heat at 60 °C in an oven for 10 minutes to

inactivate proteases. When the solution is dissolved and cooled down, filter sterilize

Wash buffer (500 mL):

➢ 36.44 g 0.4 M mannitol

➢ 0.184 g 2.5 mM CaCl2.2H2O

➢ 0.10 g 1 mM MES

➢ 500 mL MQ

Mix and adjust to pH 5.7 with 1 M KOH

Addendum

• Starting from a 6- to 10-day-old BY-2 culture, prepare a subculture by diluting 5 mL in 95 mL of

fresh BY-2 medium supplemented with the BY-2 vitamin mix

• Leave the culture to grow for 3 days at 25 °C at 150 rpm in the dark

• Divide the 3-day-old cell suspension culture over two 50 mL Falcon tubes

• Centrifuge for 5 minutes at 800 rpm at room temperature

• Discard the supernatant by gently pouring it off

• Resuspend both the soft cell pellets in the freshly prepared cell wall-degrading enzyme mixture

• Leave to incubate in a large petri dish at 25 °C under gentle shaking in the dark for 3 to 4 hours

depending on the batch of enzymes used

• Before continuing, check the cells by microscopy to make sure that the cell suspension culture

is fully protoplasted

• Transfer the protoplasts into two sterile 50 mL Falcon tubes by carefully and slowly pipetting

using a wide-bored pipette

• Centrifuge for 4 minutes at 800 rpm

• Carefully discard the supernatant by pipetting

• Resuspend the protoplasts in 40 mL wash. Try to avoid pouring on the protoplast pellet, but

rather on the sides of the Falcon tube


• Gently remove the supernatant by pipetting

• Repeat the wash step

PSB-D protoplasting

Digestion buffer (50 mL):


➢ 0.05 g 20 mM KCl

➢ 0.23 g 20 mM MES

➢ 0.75 g 1.5% (v/v) cellulase

➢ 0.20 g 0.4% (v/v) macerozyme

Dissolve the solution by mixing on a vortex and heat at 60 °C in an oven for 10 minutes to

inactivate proteases. When the solution is dissolved and cooled down, filter sterilize.

Wash buffer (1 L):


➢ 0.36 g 2.5 mM CaCl2.2H2O

➢ 0.20 g 1 mM MES

Mix and adjust to pH 5.7 with 1 M KOH.

Addendum

Resuspension buffer (1 L);


➢ 3.04 g 15 mM MgCl2.6H2O

➢ 0.20 g 1 mM MES

Mix and adjust to pH 5.6 with 1 M KOH.

• Take 25 mL of a 2-day-old subcultured PSB-D culture


• Remove supernatant with a wide-bored pipette

• Add 25 mL of digestion buffer

• Pour the solution in a petri dish (12 cm)

• Put on a shaker and cover the plates with aluminum foil

• Check every 30 minutes to see the protoplasting process (the cells should become spherical

and separated from one another). This takes about one to two hours

• If protoplasts look OK, transfer the solution to a Falcon tube with a wide-bored pipette (pipette

slowly)


• Remove the supernatant with a wide-bored pipette

• Wash two times with 20 mL wash buffer

• Resuspend the solution in 10 mL resuspension buffer

• Keep the cells on ices

3. Additional results

Table A3: The number of T1 plants for which an ICE score was obtained. Per promoter/guide combination plants were

phenotyped and the first true leaves of the T1 generation were genotyped and analyzed with ICE. Per phenotype, the number

of plants with an ICE score on the total of phenotyped plants is given. Guide 1 and 2 refer to GL1-1 and GL1-2 respectively. N,

no trichomes; I, intermediate phenotype. PcUBI RPS5A YAO EC1 CLV3 P16 HMG

Guide 1 2 1 2 1 2 1 2 1 2 1 2 1 2

N 13/23 19/22 21/30 10/16 1/5 0/0 2/2 4/11 0/2 0/0 17/20 3/3 12/16 5/5

I 1/2 3/4 0/0 0/2 5/12 0/3 0/0 1/1 1/1 0/0 4/5 14/15 6/11 5/5

WT 0/3 1/1 1/1 5/8 9/12 12/26 20/26 13/16 20/25 20/26 1/2 9/9 1/2 21/21

Addendum

A

B

Figure A1: FACS gating settings for the analysis of several samples from the BFP-to-GFP conversion assay. In the first

column, the number represents the percentage of living cells from all counted events. In the second, third, and fourth

column, the number represents the percentage of eBFP-, eGFP-, and mCherry-positive cells from the living cells

respectively. (A) Assay performed with BY-2 cell cultures. (B) Assay performed with PSB-D cell cultures.

development of a screening assay for homologous ...€¦ · of the crispr/cas9 system through...

Documents