Proc. Natl. Acad. Sci. USAVol. 92, pp. 11009-11013, November 1995Biochemistry

Differential activation of yeast adenylyl cyclase by Rasl and Ras2depends on the conserved N terminusNAAMA HURWITZ, MARISA SEGAL, IRIT MARBACH, AND ALEXANDER LEVITZKI*Department of Biological Chemistry, The Alexander Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel

Communicated by Edmond H. Fischer, University of Washington, Seattle, WA, July 5, 1995

ABSTRACT Although both Rasl and Ras2 activate ad-enylyl cyclase in yeast, a number of differences can be observedregarding their function in the cAMP pathway. To explore therelative contribution of conserved and variable domains indetermining these differences, chimeric RASJ-RAS2 orRAS2-RAS] genes were constructed by swapping the sequencesencoding the variable C-terminal domains. These constructswere expressed in a cdc25ts rasi ras2 strain. Biochemical datashow that the difference in efficacy of adenylyl cyclase acti-vation between the two Ras proteins resides in the highlyconserved N-terminal domain. This finding is supported bythe observation that Ras2A, in which the C-terminal domainofRas2 has been deleted, is a more potent activator ofthe yeastadenylyl cyclase than RaslA, in which the C-terminal domainof Rasl has been deleted. These observations suggest thatamino acid residues other than the highly conserved residuesof the effector domain within the N terminus may determinethe efficiency of functional interaction with adenylyl cyclase.Similar levels of intracellular cAMP were found in Rasl,Rasl-Ras2, RaslA, Ras2, and Ras2-Rasl strains throughoutthe growth curve. This was found to result from the higherexpression of Rasl and Rasl-Ras2, which compensate fortheir lower efficacy in activating adenylyl cyclase. Theseresults suggest that the difference between the Rasl and theRas2 phenotype is not due to their different efficacy inactivating the cAMP pathway and that the divergent C-terminal domains are responsible for these differences,through interaction with other regulatory elements.

Ras is a member of a highly conserved family of proteins actingas molecular switches in signal transduction pathways that controlnormal growth and differentiation (1). Ras cycles between anactive GTP-bound and an inactive GDP-bound form (2). Gua-nine nucleotide binding is regulated by GDP-GTP exchangefactors (GEFs), which promote the conversion to the activeGTP-bound form, and GTPase-activating proteins (GAPs),which stimulate the intrinsic GTPase, resulting in the conversionto the inactive GDP-bound form (3). Mutations activating Rasimpair the intrinsic GTPase, leading to constitutive binding toGTP irrespective of GEF or GAP activities.The cAMP pathway in the yeast Saccharomyces cerevisiae

has been extensively studied as a model for understanding Rasfunction. S. cerevisiae possesses two Ras homologs, Rasl andRas2 (4, 5), which mediate guanine nucleotide-dependentactivation of adenylyl cyclase (6). Yeast cells lacking active Rasproteins fail to produce cAMP and are not viable (6, 7).

Yeast Ras function is regulated by the CDC25 gene product,the yeast Ras GEF (8, 9), and by the Iral and Ira2 genes, whichare related to GAP (10, 11). Yeast cells possessing mutationsthat cause constitutive activation of the cAMP pathway, suchas RAS2VaIl9, iral, ira2, and bcyl, have characteristic pheno-types. These cells show an enhanced growth rate, do notaccumulate storage carbohydrates, are sensitive to heat shock

and to starvation, and are defective in sporulation in thediploid state (6, 12). On the other hand, mutations that reducethe activity of the pathway, such as ras2, cause increasedaccumulation of storage carbohydrates and enable sporulationof diploids even in rich medium (6, 12).Although either RASI or RAS2 is sufficient for cell viability,

quantitative differences in the function of the cAMP pathwayin cells expressing each yeast Ras protein separately can beobserved. ras2- but not rasl- mutants show phenotypes ofhypoactivation of the pathway; consistent with this, the cAMPlevel in ras2- cells is lower than that in rasl- cells (6); andpurified Ras2 activates adenylyl cyclase more efficiently thanpurified Rasl in reconstitution experiments (13). Recently thedifferential ability of each yeast Ras protein to mediate the UVresponse in yeast has been demonstrated (14).While the N-terminal 180 amino acids of yeast Rasl and

Ras2 are 91% homologous, no similarity is found between theC termini, except for the last 4 amino acids, which are crucialfor processing and anchorage of Ras to the plasma membrane(15) and are conserved among all Ras proteins. The Ras Cterminus has significantly diverged among all Ras proteins,including mammalian members, and is therefore referred to asthe hypervariable region (16).Here we determine whether the hypervariable region or the

highly conserved N-terminal portion of the protein is respon-sible for the differences between the two yeast Ras proteins intheir potency to activate adenylyl cyclase and mediate re-sponses involving the cAMP pathway. We have thereforeconstructed two chimeric genes: one encoding the Rasl con-served region followed by the Ras2 hypervariable region andthe reciprocal construct encoding the Ras2 conserved regionfollowed by the Rasl hypervariable region. The chimeric geneswere introduced into a yeast strain in which the endogenousRAS genes were deleted, and parameters correlating with thecAMP pathway function were examined. In addition, theability of the chimeric proteins to mediate guanine nucleotide-dependent activation of adenylyl cyclase was compared to thatof either wild-type yeast Ras protein.

MATERIALS AND METHODSYeast Strains. Isogenic cdc25ts rasl ras2 strains expressing

each of the Ras constructs (MN-rl, MN-r2, MN-rlr2, MN-r2rl, MN-rlA, and MN-r2A&; Table 1) were derived by trans-forming the strain MDS-1 (MA Ta cdc25-2 ura3 trpl leu2 ade2his3 rasl::URA3 ras2::LEU2 [H-ras]; ref. 17) with each RAS-containing plasmid. The resulting His' transformants werethen grown for 2 days in YPD and plated on SD lackinghistidine. His' Trp- segregants (lacking the resident pYGA-Ras) were identified by replica plating. The diploid strainMDSD was obtained by crossing strains MDS1-T (MATacdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3 ras2::LEU2; ref.

Abbreviations: GDP[f3S], guanosine 5'-[,B-thio]diphosphate; GMP-PNP,5'-guanylyl imidodiphosphate; GEF, GDP-GTP exchange factor(s);GAP, GTPase-activating protein.*To whom reprint requests should be addressed.

11009

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement" inaccordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

6, 2

020

11010 Biochemistry: Hurwitz et al.

Table 1. Yeast strains

Strain Genotype

MN-rl MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 [RASI]

MN-r2 MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 [RAS2]

MN-rlr2 MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 [RASJ-RAS2]

MN-r2rl MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 [RAS2-RASJ]

MN-rlv MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 [RASIA]

MN-r2A MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 [RAS2.A]

MN-rval MATa cdc25-2 ura3 trpl leu2 ade2 his3 rasl::URA3ras2::LEU2 his3::pHIS3-RAS2VaI 9

MS14-4TN MATa cdc25A ura3 leu2 ade2 his3 rasl::URA3ras2::LEU2 [TPKJ]

MN14-r2rl MATa cdc25A ura3 leu2 ade2 his3 rasl::URA3ras2::LEU2 [TPKI RAS2-RASI]

MN14-rile MATa cdc25A ura3 leu2 ade2 his3 rasl::URA3ras2::LEU2 [TPKJ RAS2Iel52]

18) and MDS-2 (MA Ta cdc25-2 ura3 trpl leu2 ade2 his3

rasl::URA3 ras2::LEU2 [H-ras]) followed by the loss ofpTPK1. Derivatives from MDSD expressing each Ras con-struct (MDSD-rl, MDSD-r2, MDSD-rlr2, MDSD-r2rl,MDSD-rlA, and MDSD-r2A; see Table 2) were obtained byexchanging plasmids as described above. Strain MS14-4TN(MA Ta cdc25A ura3 leu2 trpl his3 ade2 rasl::URA3 ras2::LEU2[TPKI]; Table 1) is an isogenic derivative of MS14-4T(18) carrying YEplac112-TPK1 instead of pTPK1. StrainsMN14-r2rl and MN14-4-rile were derived from MS14-4TNby transformation with p413r2rl or p4l3rile, respectively. Aschematic presentation of the Ras constructs used in thisstudy is presented in Fig. 1.

Yeast Techniques. Standard techniques were used (19). SDis a synthetic minimal medium [0.67% yeast nitrogen basewithout amino acids, with 2% (wt/vol) glucose] supplementedwith auxotrophic requirements. YPD [1% (wt/vol) yeast ex-

tract, 2% (wt/vol) peptone, and 2% glucose] is a rich mediumfor nonselective growth. YPA [1% yeast extract, 2% peptone,and 2% (wt/vol) potassium acetate] is a rich medium con-

taining acetate as a sole carbon source. SPO (1% potassiumacetate, 0.1% Bacto yeast extract, and 0.05% glucose) was usedfor sporulation. Incubation temperature was 23°C unless in-dicated.

RASI -RAS2

RAS2-RAS1

RAS1 A

RAS2A

RASI RAS2

o 164 322

RAS2 RAS1

o 152 309

RAS1

I Il\0 (175-290) 309

RAS2

I( \0 (1 75-300) 322

FIG. 1. RAS chimeras and truncated RAS genes. A schematicpresentation of the Ras constructs used in the study is shown. Codonnumbers are indicated below the constructs.

Glycogen and Sporulation Assays. Glycogen was measuredby iodine staining (20). Sporulation efficiency was measured 3days after plating diploids on sporulation plates (SPO) or richmedium plates (YPA).

Plasmids. p413-RAS1 was constructed by inserting a 3-kbBamHI-EcoRI fragment of RAS] blunt-ended with the Kle-now fragment of DNA polymerase I into the Sma I site ofpRS413 (21). p413-RAS2 was constructed by inserting a 5.9-kbBamHI fragment of the RAS2 gene (12) into the BamHI siteof pRS413. p413-RASlA was constructed by site-directedloop-out of RAS] using the oligomer GGTAAGGGAC-GACGGTACCAAAAATTCAAGCGCCAAC, which re-sulted in the in-frame deletion of codon positions 175-290 inp413-RAS1. p413-RAS2A was constructed by inserting aBamHI-EcoRI fragment from YCp-RAS2A (kindly providedby M. Marshall; ref. 20) into pRS413. p413-RAS2 Iel52 wasconstructed by inserting the 1.9-kb Cla I-HindIII fragmentfrom YCp-RAS2llel52 (kindly provided by M. Jacquet; ref. 22)into pBluescript KS(+) and then subcloning the 1.9-kb ClaI-BamHI fragment from this plasmid into pRS413. p413-rlr2,carrying the RASJ-RAS2 chimera, was constructed by replac-ing the Stu I-EcoRI fragment of p413-RAS1 (encoding theRasl C terminus) with a 570-bp Stu I-EcoRI fragment fromthe RAS2 gene obtained by PCR using the primer AACGT-GGAAGAGCCCTTTTACACT, which introduced a Stu I siteat a position homologous to that in RAS1 (codon 164) and theprimer ATGACCAGAATTCCGCCAAGCTT, complemen-tary to vector sequences, which introduced an EcoRI site 300bp from the 3' end of the coding region.The RAS2-RAS1 chimeric gene was first constructed in

pUC19 by sequentially subcloning three fragments: (i) the1.3-kb Xba I-EcoRI fragment including the 3' end from RAS1after deleting a Pst I fragment in the 3' noncoding region, (ii)a 300-bpXba I-Pst I fragment from the RAS2 coding sequence.(The Xba I site was created at codon position 149 by site-directed mutagenesis using the oligomer TGCTTAGCAGAT-GTCTCTAGAAAAGGAGCG, and (iii) a 2-kb Pst I fragmentfrom pRA530 including most of RAS2 upstream sequencesand the first 195 bp of the coding sequence (7). The resultingchimera was then transferred as an EcoRI fragment intopRS413. The integrative plasmid pHIS3-RAS2VaI19 was kindlyprovided by M. Wigler (12). YEplacl 12-TPK1 was constructedby introducing the 3-kb Sph I-BamHI fragment of TPKJ (23)into the Sph I-BamHI sites of YEplacl 12 (24). Standardcloning procedures were used for plasmid construction (25).Membrane Preparation and Adenylyl Cyclase Assay. Prep-

aration of membranes for adenylyl cyclase assays was carriedout as described (8). Adenylyl cyclase activity was measuredaccordingly to Segal et al. (17) using cells in early logarithmicphase. Protein concentration was determined according toLowry et al. (26).Western Blots. Membrane fractions for Western blot anal-

ysis were prepared as described (27). Membrane fractions wereboiled in Laemmli sample buffer (28) and subjected to SDS/12% PAGE. Immunoblotting was according to Gross et al.(27). The anti-Ras antibody Y13-259 was used as the firstantibody, and horseradish peroxidase-conjugated anti-rat an-tibody was used as the second antibody. The blots werevisualized by using the ECL detection system (Amersham).cAMP Assays. cAMP levels were measured exactly as de-

scribed by us earlier (29). Cells were grown in YPD medium,and samples for cAMP determination and Western blot anal-ysis were obtained at three stages of cell growth: at the earlylogarithmic phase, middle logarithmic phase, and stationaryphase.

RESULTS

The RAS Chimeras Complement a rasi ras2 Mutation inYeast. To assess the possible role of the hypervariable region

Proc. Natl. Acad. Sci. USA 92 (1995)

Dow

nloa

ded

by g

uest

on

Aug

ust 1

6, 2

020

Proc. Natl. Acad. Sci. USA 92 (1995) 11011

NIN-ri

TNN-r2

N1N-r 1r2

A.

^: V

NMN-rval

MN-r2A

MN-rlA

MN-r2rl

FIG. 2. Glycogen levels induced by the Ras constructs. StrainsMN-rl (RASI), MN-r2 (RAS2), MN-rlr2 (RASI-RAS2), MN-r2rl(RAS2-RAS1), MN-rlA (RASIA), MN-r2A (RAS2A), MNRval(RAS2VaII9) were patched onto SD plates, incubated for 2 days at 23°C,and then stained by iodine vapors as described in Materials andMethods.

on yeast Ras function, two reciprocal chimeric genes were

constructed (see Materials and Methods). The chimeras en-

coded the N-terminal 164 amino acids of Rasl followed by theC-terminal 165-322 residues of Ras2 under control of theRASI promoter (RASI-RAS2) and the Ras2 N-terminal 151residues followed by amino acids 152-309 of Rasl undercontrol of the RAS2 promoter (RAS2-RASJ). Each chimerawas cloned into the centromeric plasmid pRS413. Wild-typeRAS1 and RAS2 were also introduced into pRS413, as well as

RASlA and RAS2A, which lack the sequences encoding thehypervariable region of Rasl (amino acids 175-290) or Ras2(amino acids 175-300) (Fig. 1).A series of cdc25ts rasl ras2 strains expressing each of the

Ras variants was constructed as described in Materials andMethods (MN-rl, MN-r2, MN-rlr2, MN-r2rl, MN-rlA, MN-r2A, and MN-rval; Table 1). Cells harboring the chimeras(MN-rlr2 and MN-r2rl) readily lost the resident H-ras-containing plasmid, showing that they complement the raslras2 double mutation.

Glycogen Accumulation and Sporulation Ability of CellsExpressing the Chimeric Proteins. The cdc25ts rasi ras2 strainsexpressing the various Ras constructs were then tested foraccumulation of storage carbohydrates and sporulation ability.Strains expressing the chimera RAS1-RAS2 or wild-type RAS]exhibited comparable glycogen levels, which were higher thanthose observed in the strains expressing the chimera RAS2-RAS1 or RAS2 (Fig. 2). The finding is striking in view of thefact that RAS] is expressed at much higher levels than RAS2(see Fig. 4 and below). A strain expressing RAS2Vall9 (MN-rval) exhibited the lowest level of glycogen, whereas a straincarrying RAS2A (MN-r2A) accumulated glycogen to a levelthat was intermediate between that of MN-rval and MN-r2.The strain expressing RASIA exhibited the highest level ofaccumulation (Fig. 2).

In agreement with the glycogen assay, comparable sporu-

lation efficiencies in rich medium were observed for strainscarrying RAS1 or RASI-RAS2 and for strains carrying RAS2or RAS2-RAS1 (Table 2).

Table 3. Ability of Ras variants to suppress a cdc25ts mutation

Strain Ras construct Growth at 37°C

MN-rl RAS]MN-r2 RAS2MN-rlr2 RAS1-RAS2MN-r2rl RAS2-RASI +MN-rlA RASlA +MN-r2A RAS2A + + +

Strains were patched onto rich medium plates, incubated for 2 daysat 23°C, and then replica plated onto similar plates for incubation ateither 37°C or 23°C. Growth was scored after 2 days.

None of the tested strains except for the strain expressingRAS2VaIl9 showed sensitivity to nitrogen starvation or to heatshock, suggesting that neither the chimeras nor the C-terminus-deleted Ras proteins caused hyperactivation of thecAMP pathway to the extent of Ras2vall9 (data not shown).The Chimeric Gene RAS2-RASJ Partially Suppressed a

cdc25ts Mutation. The cdc25ts rasl ras2 strains expressing eachRAS construct were tested for their ability to grow at therestrictive temperature of 37°C (Table 3). As expected, RASI,RAS2, and the chimera RASI-RAS2 failed to rescue cdc25ts,but, surprisingly, the chimera RAS2-RAS1 partially rescuedcdc25ts (Table 3). RAS2A efficiently suppressed cdc25ts, inagreement with results previously reported by Marshall et al.(20). In contrast, the analogous RASJA only partially rescuedthe cdc25ts mutation.

Adenylyl Cyclase Activation by Ras Chimeric Proteins.Adenylyl cyclase activity was measured in membranes from thestrains expressing each Ras construct (Fig. 3). Guanine nu-cleotide response was observed in the strains expressing Rasl,Ras2, Rasl-Ras2, or Ras2-Rasl proteins as shown by theMg2' 5'-guanylyl imidodiphosphate (GMP-PNP) to Mg2+guanosine 5'-[3-thio]diphosphate (GDP[,BS]) stimulation ra-tio. In contrast, cells expressing Ras2A exhibited a ratio ofMg2+.GMP-PNP to Mg2+-GDP[,BS] of -1. This suggests thatRas2A protein is mostly bound to GTP and is not a substratefor Cdc25-dependent exchange (17). RaslA has similar profileof guanine nucleotide response, yet, taking into considerationthe level of expression of both C-terminal deleted proteins,RaslA is a much less potent activator of adenylyl cyclasecompared to Ras2A.Ras2 and the chimeric Ras2-Rasl activate adenylyl cyclase

much more effectively than Rasl or Rasl-Ras2, taking intoconsideration the fact that the level ofRASI, RAS1-RAS2, andRASlA expression is higher than that of RAS2, RAS2-RAS1,and RAS2A (see Fig. 5B). It is therefore apparent that thebehavior of each chimera correlated with that of the yeast Rasprotein contributing to the N-terminal domain. Since thechimeric gene RAS2-RAS1 was able to partially suppresscdc25ts (Table 3), we proceeded to compare adenylyl cyclaseactivation mediated by the chimera Ras2-Rasl to the activa-tion mediated by Ras2Ilel52 (22) in a CDC25-deleted strain.Adenylyl cyclase was measured in membranes from a cdc25Arasl ras2 strain carrying YEplacll2-TPK1 and, in addition,either p413-r2rl or p413-RAS2Ilel52 (Fig. 4). Both the chimeraand Ras2Ilel52 mediate guanine nucleotide activation of ad-

Table 2. Sporulation efficiency of diploids expressing the Ras variants

% sporulatedStrain Relevant genotype cells in YPA

MDSD-rl cdc25/cdc25 rasl/ras] ras2/ras2 [RAS1] 15MDSD-r2 cdc25/cdc25 rasl/rasl ras2/ras2 [RAS2] 2MDSD-rlr2 cdc25/cdc25 rasl/rasl ras2/ras2 [RASJ-RAS2] 24MDSD-r2rl cdc25/cdc25 rasl/ras] ras2/ras2 [RAS2-RASJ] 1MDSD-rlA cdc25/cdc25 rasl/rasl ras2/ras2 [RAS1A] 8MDSD-r2A cdc25/cdc25 rasl/rasl ras2/ras2 [RAS2A] 0

Sporulation efficiency of all strains in SPO medium was >75%. The incubation temperature was 23°C.

Biochemistry: Hurwitz et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

6, 2

020

11012 Biochemistry: Hurwitz et al.

A 5-._

0)E

.E1-

0E0.

1 2 3 4 5 6r1 r2 rlr2 r2rl rlA r2A

FIG. 3. Guanine nucleotide-dependent adenylyl cyclase activity ina cdc25-2 rasl ras2 strain expressing each Ras construct. Bars: 1,MN-rl; 2, MN-r2; 3, MN-rlr2; 4, MN-r2rl; 5, MN-rlA; 6, MN-r2A.Mn2+-dependent activity (pmol of cAMP per min per mg of protein)in membrane preparations was 33.1 for MN-rl, 33.0 for MN-r2, 39.2for MN-rlr2, 36.9 for MN-r2rl, 43.0 for MN-rlAA, and 32.1 forMN-r2A. Results are the mean + SEM of three independent mea-surements from two preparations. Hatched bars, Mg2+-GDP[I3S]; solidbars, Mg2+GMP-PNP.

enylyl cyclase in the absence of Cdc25 (Fig. 4), confirming thatthe chimera is also capable of undergoing GDP-GTP ex-change in the absence of Cdc25, which supports the geneticfinding (Table 3).The Intracellular Level of cAMP and the Level of Ras

Expression. Cells from the six different strains harboringRASJ (MN-rl), RAS2 (MN-r2), RASI-RAS2 (MN-rlr2),RAS2-RAS1 (MN-r2rl), RASlA (MN-r1A), andRAS2A (MN-r2A) exhibited almost identical growth curves in YPD medium(data not shown). Samples from early logarithmic phase,middle logarithmic phase, and stationary phase were analyzedfor intracellular cAMP levels and the level of Ras protein. Fig.5 shows that the intracellular levels of cAMP are similar in allsix strains with slightly higher levels in RAS2A. Ras proteinlevels vary in the different phases of the growth curve. Inearly logarithmic phase the expression of Rasl, Rasl-Ras2,and RaslA is much higher than that of Ras2, Ras2-Rasl, andRas2A. In middle logarithmic phase, expression of Ras2 andRas2A remains low but that of Ras2-Rasl increases but isstill far bellow the level of Rasl-Ras2. In stationary phase,Ras2 expression remains low, whereas the level of Ras2-Rasl is further increased. At stationary phase, the level ofRas2A is increased but is still far below that of RaslA. These

50c

0.

Z

0)

E

.E0-

0

E0x.

40

30

20

10

0

MN14-r2rl MN14-rasile MS14-4TN

FIG. 4. Adenylyl cyclase activity in strains MN14-r2rl (RAS2-RAS1),MN-rasile (RAS2IIels2) and MS14-4TN (rasl::4RA3, ras2::Leu2 TPK1).Mn2+-dependent activity (pmol of cAMP per min per mg of protein)in membrane preparations was 43.4 for MN14-r2rl, 41.0 for MN-rasile,and 30.6 for MS14-4TN. Results are the mean + SEM of threeindependent determinations. Hatched bars, Mg2+-GDP[f3S]; solidbars, Mg2+-GMP-PNP.

Q

0

to

0n-

Q0

E0.

4

3

2

1

1 23456EL

B 1 2 3 45 6

EL

EL

123456 123456ML S

1 2 3 4 5 6 1 2 3 4 5 6

i.t.oI e

ML S

FIG. 5. Intracellular cAMP levels in relation to the expression ofRas proteins. Cells from all the six RAS-harboring strain were grownon YPD medium in parallel. Cells were harvested in early logarithmicphase (EL), middle logarithmic phase (ML), and stationary phase (S).Samples were analyzed for cAMP as described previously and for Rasexpression by Western blot analysis. Bars and lanes: 1, MN-rl; 2,MN-r2; 3, MN-rlr2; 4, MN-r2rl; 5, MN-rlAA; 6, MN-r2A. (A) cAMPlevels. (B) Levels of Ras expression determined by Western blot withanti-Ras antibody (Y13-259). Ten micrograms of membrane proteinwas loaded on each lane at the early logarithmic phase, and 20 jig ofmembrane protein was loaded at the middle logarithmic and stationaryphases. The upper bands at lanes 1-4 represent the different Rasconstructs (Mr = 36,000-42,000). The lower band in lane 3 is a productof Rasl-Ras2 degradation, and the bands in lanes 5 and 6 representRaslA and Ras2A.

results further support the findings that the efficacy instimulating cAMP formation resides in the N-terminal por-tion of the Ras protein.

DISCUSSIONPrevious reports have shown Ras2 seems to be a much betteractivator than Rasl (6, 13) of adenylyl cyclase. This might beaccounted for, at least partly, by structural differences betweenthe two proteins. To date, the function of the hypervariableregion of the yeast Ras proteins has not been defined. Marshallet al. (20) suggested that the hypervariable region may have anegative regulatory role, since removal of the C terminus fromRas generates a Ras2A protein that constitutively binds GTPin the absence of an exchanger, thus suppressing cdc25ts.We examined the relative contributions of the conserved

N-terminal and of the variable C-terminal domains of Rasland Ras2 to the differential activity in the cAMP pathway. Forthis purpose, we generated the chimeras RAS1-RAS2 andRAS2-RAS1 in which the hypervariable domains wereswapped and introduced them into a strain lacking endogenousRAS genes and compared their behavior to cells into whicheither RASI or RAS2 was introduced.Both chimeric genes complemented a rasl ras2 mutation,

and therefore their products activate adenylyl cyclase. There-fore, strains expressing the chimeras were tested for pheno-types known to correlate with the cAMP pathway function.

Proc. Natl. Acad. Sci. USA 92 (1995)

Dow

nloa

ded

by g

uest

on

Aug

ust 1

6, 2

020

Proc. Natl. Acad. Sci. USA 92 (1995) 11013

According to glycogen levels in strains expressing each Rasvariant and their ability to sporulate, it seems that the hyper-variable region is not responsible for the differences betweenthe two Ras proteins. Rasl-Ras2 behaved similarly to Rasl,whereas Ras2-Rasl behaved like Ras2. Neither chimera re-sulted in phenotypes usually associated with hyperactivation ofthe cAMP pathway.The same strains were subjected to biochemical analysis.

The potency of adenylyl cyclase activation seemed to reside inthe N-terminal domain of the Ras protein. While Ras2 acti-vated cyclase better than Rasl (Fig. 4), in agreement withearlier results from reconstitution experiments (6, 13), Ras2-Rasl activated cyclase better than Rasl-Ras2, and Ras21 wasalso a better activator than RaslA (Fig. 4), again taking intoaccount the different levels of expression for both proteins(Fig. 5). The specific adenylyl cyclase activity as measured permilligram of protein (Fig. 3) is similar for all Ras constructs.The lower efficacy of Rasl, Rasl-Ras2, and of RaslA iscompensated by higher levels of expression. The chimeric geneRAS2-RAS1 partially rescued a cdc25ts mutation (Table 3).This could be either due to the chimeric protein being lesssensitive to Iral and Ira2 or due to a high intrinsic rate ofGTP-GDP exchange. The profile of adenylyl cyclase activityof the cdc25ts rasl ras2 strain containing the chimera RAS2-RAS1 was indeed distinct from that of the same strain carryingRAS2. and, similarly to Ras2Ilel52, was able to carry out nucle-otide exchange in the absence of Cdc25 altogether (Fig. 4).Our results suggest that the hypervariable region of the yeast

Ras is not responsible for the differences between the twoproteins regarding their activity in the cAMP pathway. Sur-prisingly, the difference in the efficacy to activate adenylylcyclase resides in the highly conserved N-terminal domainalthough the effector domain residues are identical in the twoproteins and with the human versions of Ras proteins. Thisconclusion is supported by the finding that Ras2A is a muchbetter activator of adenylyl cyclase than Ras1lA.A second region that might be involved in Ras and adenylyl

cyclase interaction is the switch II region. The relevance of thisregion to v-ras transformation and to cyclase activation in yeasthas been reported (30, 31). Rasl and Ras2 differ within thisregion solely at position 81 (threonine in Rasl and asparaginein Ras2). Interestingly, Rasl and human H-Ras activate cy-clase with similar efficiencies, which are lower than that ofRas2 (13). Indeed, position 74 in H-Ras, which corresponds toposition 81 in yeast Ras, is also a threonine residue. Moreover,Broek et al. (13) showed that a chimeric H-RasvaIl2/Ras2protein that consists of the first 73 amino acids of H-Ras followedby the remaining 242 amino acids of Ras2 stimulates adenylylcyclase to the same extent as Ras2.A more detailed study to identify the amino acid residues

responsible for this difference is necessary. The observationthat cAMP levels in RAS1, RAS2, RAS1-RAS2, RAS2-RAS1,and RASIA are similar, yet the biological phenotypes ofRAS1,RASI-RAS2, and of RASJA are those typical of RAS1 (Table2, Table 3, and Fig. 2) is surprising. It suggests that thedifference in phenotypes is not solely dependent on the cAMPpathway and that Rasl and Ras2 may differ in their interactionwith additional effector(s) or regulators. The findings on thedifferences between RAS1IA and RAS2X in S. cerevisiae may berelevant to the mammalian Ras system. Recent findings sug-gest that mammalian Ras protein interacts with a number ofeffectors other than Rafl (32, 33), suggesting that Ras signal-ing can bifurcate to use alternative, or a combination of,effectors. The ability of Ras proteins to interact with a numberof effectors may result from the involvement of amino acidresidues outside the classical effector domain involving shortvariable domains in the various versions of Ras.

Although the variable C-terminal domains in S. cerevisiaeRas proteins are not crucial for the interaction with adenylyl

cyclase, they may play a role in other signal transductionpathways (34).

We thank Debbie Yablonski for fruitful discussions and criticallyreading the manuscript. We thank Kobi Shwartz and Ami Navon forhelpful technical advice. This study was supported by the Levi Eshkolscholarship (to M.S.). This study was partially supported by theU.S.-Israel Binational Research Foundation, Jerusalem (to A.L.).

1. Barbacid, M. (1987) Annu. Rev. Biochem. 56, 779-827.2. Bourne, H. R., Sanders, D. A. & McCormick, F. (1990) Nature

(London) 348, 125-132.3. Boguski, M. S. & McCormick, F. (1993) Nature (London) 366,

643-654.4. DeFeo-Jones, D., Scolnick, E. M., Koller, R. & Dhar, R. (1983)

Nature (London) 306, 707-709.5. Powers, S., Kataoka, T., Fasano, O., Goldfarb, M., Starthern, J.,

Broach, J. & Wigler, M. (1984) Cell 36, 607-612.6. Toda, T., Uno, I., Ishikawa, I., Powers, S., Kataoka, T., Broek, S.,

Cameron, S., Broach, J., Matsumoto, K. & Wigler, M. (1985) Cell40, 27-36.

7. Tatchell, K., Chaleff, D. T., DeFeo-Jones, D. & Scolnick, E. M.(1984) Nature (London) 309, 523-527.

8. Engelberg, D., Simchen, G. & Levitzki, A. (1990) EMBO J. 9,641-651.

9. Jones, S., Vignais, M. L. & Broach, J. R. (1991) Mol. Cell. Biol.11, 2641-2646.

10. Tanaka, K., Matsumoto, K. & Toh-e, A. (1989) Mol. Cell. Biol.9, 757-768.

11. Tanaka, K., Nakafuku, M., Tamanoi, F., Kaziro, Y., Matsumoto,K. & Toh-e, A. (1990) Mol. Cell. Biol. 10, 4303-4313.

12. Kataoka, T., Powers, S., McGill, C., Fasano, O., Golfarb, M.,Broach, J. & Wigler, M. (1984) Cell 37, 437-445.

13. Broek, D., Samly, N., Fasano, O., Fujiyama, A., Tamanoi, F.,Northup, J. & Wigler, M. (1985) Cell 41, 763-769.

14. Engelberg, D., Klein, C., Martinetto, H., Struhl, K. & Karin, M.(1994) Cell 77, 381-390.

15. Clarke, S. (1992) Annu. Rev. Biochem. 61, 355-386.16. Lowy, D. R. & Willumsen, B. M. (1993) Annu. Rev. Biochem. 62,

851-891.17. Segal, M., Marbach, I., Engelberg, D., Simchen, G. & Levitzki,

A. (1992) J. Biol. Chem. 267, 22747-22751.18. Segal, M., Willumsen, B. M. & Levitzki, A. (1993) Proc. Natl.

Acad. Sci. USA 90, 5564-5568.19. Sherman, F., Fink, G. R. & Hicks, J. B. (1982) Methods in Yeast

Genetics (Cold Spring Harbor Lab. Press, Plainview, NY).20. Marshall, M. S., Gibbs, J. B., Scolnick, E. M. & Sigal, I. S. (1987)

Mol. Cell. Biol. 7, 2309-2315.21. Sikorski, R. S. & Hieter, P. (1989) Genetics 122, 19-27.22. Camonis, J. H. & Jacquet, M. (1988) Mol. Cell. Biol. 8, 2980-

2983.23. Toda, T., Cameron, S., Sass, P., Zoller, M. & Wigler, M. (1987)

Cell 50, 277-287.24. Gietz, R. D. & Sugino, A. (1988) Gene 74, 527-534.25. Maniatis, M., Fritsch, E. F. & Sambrook, J. (1989) Molecular

Cloning: A Laboratory Manual (Cold Spring Harbor Lab. Press,Plainview, NY).

26. Lowry, 0. H., Rosebrough, N. J., Farr, A. L. & Randall, R. J.(1951) J. Biol. Chem. 193, 265-275.

27. Gross, E., Marbach, I., Engelberg, D., Segal, M., Simchen, G. &Levitzki, A. (1992) Mol. Cell. Biol. 12, 2653-2661.

28. Laemmli, U. K. (1970) Nature (London) 227, 680-685.29. Goldberg, D., Segal, M. & Levitzki, A. (1994) FEBS Lett. 356,

249-254.30. Sigal, I. S., Gibbs, J. B., D'Alonzo, J. S. & Scolnick, E. M. (1986)

Proc. Natl. Acad. Sci. USA 83, 4725-4729.31. Willumsen, B. M., Papageorge, A. G., Kung, H., Bekesi, E.,

Robins, T., Johnsen, M., Vass, W. C. & Lowry, D. R. (1986) Mol.Cell. Biol. 6, 2646-2654.

32. Kikuchi, A., Demo, S. D., Ye, Z.-H., Chen, Y.-W. & Williams,L. T. (1994) Mol. Cell. Biol. 14, 7483-7491.

33. Rodrigues-Viciana, P., Warne, P. H., Dhand, R., Vanhaese-broeck, B., Gout, I., Fry, M. J., Waterfield, M. D. & Downward,J. (1994) Nature (London) 370, 527-532.

34. Sun, J., Kale, S. P., Childress, A. M., Pinswasdi, C. & Jazwinski,S. M. (1994) J. Biol. Chem. 269, 18638-18645.

Biochemistry: Hurwitz et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 1

6, 2

020