dna genes chromosomes 2011[1]

Upload: suliman-garalleh

Post on 05-Apr-2018

228 views

Category:

Documents


0 download

TRANSCRIPT

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    1/65

    INTRODUCTION

    Genetic diseases occur because of mutations in DNA. Many of

    these mutations affect the repair of other mutations that occur

    during DNA replication or at other times, which in turn affect

    the flow of genetic information from DNA to RNA(transcription and processing) and from RNA to protein

    synthesis (translation). Many of these mutations also affect the

    structures of the resulting proteins, affecting their functions.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    2/65

    THE FLOW OF GENETIC INFORMATION

    DNA RNA PROTEIN

    DNA

    1

    2 3

    1. REPLICATION (DNA SYNTHESIS)2. TRANSCRIPTION (RNA SYNTHESIS)3. TRANSLATION (PROTEIN SYNTHESIS)

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    3/65

    DNA Structure and Chemistry

    a). Evidence that DNA is the genetic informationi). DNA transformation know this termii). Transgenic experiments know this processiii). Mutation alters phenotype be able to define

    genotype and phenotype

    b). Structure of DNAi). Structure of the bases, nucleosides, and nucleotidesii). Structure of the DNA double helixiii). Complementarity of the DNA strands

    c). Chemistry of DNAi). Forces contributing to the stability of the double helixii). Denaturation of DNA

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    4/65

    DNA transformation experiments show that DNA is the carrier of the genetic

    information. These experiments have been carried out both in vivo (in animals) and

    in vitro (in cell culture). The in vivo experiments were carried out by injecting mice

    with both a heat-killed virulent strain of Streptococcus and a non-heated, non-

    virulent strain of Streptococcus. The experiments showed that something (DNA)from the heat-killed virulent strain of Streptococcus was able to alter the (still

    viable) non-virulent strain, converting some of the cells to virulent bacteria and

    killing the host. We now know that purified DNA confers this virulence. In vitro

    experiments have shown that purified DNA from Type S (smooth colony) Strep

    cells is able to be taken up by Type R (rough colonies) Strep cells. The process of

    getting functionally active DNA into cells is called DNA transformation.Transformation by Type S DNA alters the "genotype" of host cells, since new

    genes are introduced into these cells thus altering their genetic constitution. The

    expression of this Type S DNA changes the "phenotype of the transformed cells,

    making their colonies look "smooth" instead of "rough. Genotype is an organisms

    genetic constitution. Phenotype is the observed characteristics of an organism as

    determined by the genetic makeup and the environment.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    5/65

    Transgenic experiments, which are usually

    carried out in mice, involve the transfer of a

    specific gene into the nucleus of a fertilized

    egg. The gene integrates randomly into

    chromosomal DNA and can be engineered to

    be expressed in every cell, or only in certain

    cells at certain times. For example,

    introduction of the growth hormone gene into

    transgenic mice alters their genotype and

    confers a phenotype characterized by increase

    growth and therefore size. Transgenic

    experiments show that specific phenotypic

    traits can be conferred by specific genes, and

    thus that DNA is the carrier of genetic

    information. Other types of transgenic

    experiments involve mutation of specific

    genes in the mouse to determine the functionsof those genes and to create mouse models of

    human genetic disease. The mutation of a gene

    in a transgenic mouse that eliminates the

    gene's function, is called a knockout mutation

    and the mouse carrying that mutation is called

    a knockout mouse.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    6/65

    Phenotypic differences between individuals are due in large

    measure to differences between genes. Evidence suggests that at

    least one-third of our genes are polymorphic, in other words that

    there are differences in the nucleotide sequences in one-third of

    our genes when these genes are compared from one individual to

    another individual. It is most likely that these differences

    occurred by mutation of DNA over many hundreds of thousands

    of years of human evolution. It is also clear that new DNA

    mutations give rise to phenotypic differences between individuals,the most dramatic being those that give rise to genetic diseases.

    All of this evidence indicates that DNA is the carrier of the

    genetic information. Genetic differences between individuals can

    have a myriad of clinical implications. Some inherited differences,

    which may be less severe, can confer a predisposition to certain

    medical problems. Other examples are individual rates of aging orindividual rates of drug metabolism, both of which probably have

    an underlying genetic basis. More severe genetic differences can

    be the causes of debilitating inherited diseases.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    7/65

    Thymine (T)

    Guanine (G) Cytosine (C)

    Adenine (A)

    Structures of the bases

    Purines Pyrimidines

    5-Methylcytosine (5mC)

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    8/65

    Be familiar with the structures of the purine bases, adenine (A)

    and guanine (G); and the pyrimidine bases, thymine (T) and

    cytosine (C). A common base modification in DNA results from

    the methylation of cytosine, giving rise to 5-methylcytosine

    (5mC). As we shall see subsequently, 5mC is highly mutagenic.

    It is believed that this methylation functions to regulate geneexpression because 5-methylcytosine (5mC) residues are often

    clustered near the promoters of genes in so-called "CpG islands.

    (Along one strand of DNA the nucleotides are sometimes

    indicated by the base followed by a phosphate or p such as

    ApTpCpCpGpApCpTpGpGp - this sequence contains one CpG

    site.) The problem that arises from these methylations is that

    subsequent deamination of a 5mC results in the production of

    thymine, which is not foreign to DNA. As such, 5'-mCG-3' sites

    (or mCpG sites) are "hot-spots" for mutation, and when mutated

    are a common cause of cancer.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    9/65

    [structure of deoxyadenosine]

    Nucleoside

    Nucleotide

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    10/65

    This table lists the common bases and theircorresponding names when in the nucleoside or

    nucleotide form. Hypoxanthine (inosine) is seen in

    DNA following deamination of adenine

    (adenosine). It is also seen in transfer RNA as a

    common, functionally important posttranscriptionalmodification. Uracil (uridine) is found in RNA,

    instead of thymine (thymidine), which is specific

    for DNA.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    11/65

    Nomenclature

    Purines

    adenine adenosineguanine guanosine

    hypoxanthine inosine

    Pyrimidinesthymine thymidinecytosine cytidine

    +ribose

    uracil uridine

    Nucleoside NucleotideBase +deoxyribose +phosphate

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    12/65

    When a base, such as adenine, is linked to a deoxyribose sugar

    through a glycosidic bond, the structure is a nucleoside, in this

    case deoxyadenosine. The deoxyribose sugar lacks a hydroxyl

    group on the 2' carbon, hence deoxy. This is in contrast to the

    presence of a hydroxyl at that position in the ribose sugar found

    in RNA. When the deoxyribose sugar is phosphorylated, on

    either the 3' or the 5' position (or both), the structure is a

    nucleotide, in this case deoxyadenosine-5'-phosphate. The

    precursors of DNA synthesis are deoxynucleoside-5'-

    triphosphates or dNTPs.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    13/65

    polynucleotide chain

    3,5-phosphodiester bond

    ii). Structure of the

    DNA double helixStructure of the DNApolynucleotide chain

    5

    3

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    14/65

    A-T base pair

    G-C base pair

    Chargaffs rule: The content of A equals the content of T,and the content of G equals the content of Cin double-stranded DNA from any species

    Hydrogen bonding of the bases

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    15/65

    The DNA double helix requires that the two

    polynucleotide chains be base-paired to each other. This

    slide shows an adenine-thymine (A-T) base pair (which

    is the A and which is the T?); and a guanine-cytosine(G-C) base pair (which is the G and which is the C?).

    Because of base pairing, the polynucleotide chains in

    double-stranded DNA are complementary to each other.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    16/65

    Double-stranded DNA

    Major groove

    Minor groove

    5 3

    5 33 5B DNA

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    17/65

    This slide shows double-stranded DNA,

    which is composed of two base-paired,

    complementary polynucleotide chains. Base-

    pairing between the complementary strands

    is required for two important functions of

    DNA: 1) DNA replication involves an

    unwinding of the double helix (right)

    followed by synthesis of a complementary

    strand from each of the unpaired template

    strands, and 2) DNA serves as a template for

    RNA synthesis by utilizing the information inone strand to code for a complementary RNA

    strand.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    18/65

    DNA in the "B" form has a major groove and a minor groove, and has 10 basepairs per one turn of the double helix. DNA that is overwound or underwound,

    with fewer than or more than 10 base pairs per turn, is said to be "supercoiled".

    It should also be noted that the complementary strands in double helical DNA

    are antiparallel with respect to each other. Each polynucleotide chain has a 5' end

    and a 3' end. Deoxyribonucleases (or DNases) are enzymes that cleave

    phosphodiester bonds. Some are used for constructive purposes, such asproofreading during DNA replication, whereas others are used to degrade DNA.

    There are two basic classes of DNases: exonucleases and endonucleases.

    Exonucleases remove only the terminal nucleotide, whereas endonucleases

    cleave anywhere within the DNA double helix.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    19/65

    Chemistry of DNA

    Forces affecting the stability of the DNA double helix

    hydrophobic interactions - stabilize- hydrophobic inside and hydrophilic outside

    stacking interactions - stabilize- relatively weak but additive van der Waals forces

    hydrogen bonding - stabilize- relatively weak but additive and facilitates stacking

    electrostatic interactions - destabilize- contributed primarily by the (negative) phosphates

    - affect intrastrand and interstrand interactions- repulsion can be neutralized with positive charges

    (e.g., positively charged Na+ ions or proteins)

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    20/65

    Three types of forces contribute to maintaining the

    stability of the DNA double helix: 1) hydrophobic

    interactions, 2) stacking interactions, and 3)

    hydrogen bonding. The base pairs in the interior

    of the DNA molecule create a hydrophobic

    environment, with the negatively charged

    phosphates along the backbone being exposed to

    the solvent. Thus, in an aqueous environment, the

    double-stranded structure is stabilized by the

    hydrophobic interior. Reagents that solubilize the

    DNA bases (e.g., methanol) destabilize the double

    helix. Stacking interactions and hydrogen

    bonding interactions are relatively weak butadditive. Reagents that disrupt hydrogen bonding

    [e.g., formamide, urea, and solutions with very

    low pH (pH 10)]

    destabilize the double helix.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    21/65

    Electrostatic replusion by negatively charged

    phosphates along the DNA backbone destabilize

    the double helix. For example, if the phosphates

    are left unshielded, as when DNA is dissolved in

    distilled water, the DNA strands will separate at

    room temperature. Neutralizing these negativecharges by the addition of NaCl (which

    contributes positively charged sodium ions) to the

    DNA solution will prevent strand separation. In

    the cell, the phosphates also interact with

    positively charged (magnesium, potassium, or

    sodium) ions and with positively charged (basic)

    proteins.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    22/65

    Stacking interactions

    Charge repulsion

    Charger

    epulsion

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    23/65

    Model of double-stranded DNA showing three base pairs

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    24/65

    This slide shows a side view of three

    base pairs in the DNA double helix.

    Note the base-pair stacking

    interactions, the hydrophobic interior,

    and the phosphates on the exterior

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    25/65

    Denaturation of DNA

    Double-stranded DNA

    A-T rich regions

    denature first

    Cooperative unwindingof the DNA strands

    Extremes in pH or

    high temperature

    Strand separationand formation of

    single-strandedrandom coils

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    26/65

    The forces stabilizing the DNA double helix can be overcome by heating the DNA in solution

    or by treating it with very high or very low pH (low pH will also damage the DNA, whereas

    high pH will simply separate the polynucleotide chains). When the strands of DNA separate,

    the DNA is said to be denatured (when high temperature is used to denature DNA, the DNA issaid to be melted). Because some of the forces stabilizing the DNA double helix are

    contributed by base pairing interactions, and because A-T base pairs have only two hydrogen

    bonds in contrast to G-C base pairs which have three hydrogen bonds, regions of the DNA

    duplex that are A-T rich will denature first. Once denaturation has begun, there is a

    cooperative unwinding of the double helix that ultimately results in complete strand

    separation.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    27/65

    Electron micrograph of partially melted DNA

    A-T rich regions melt first, followed by G-C rich regions

    Double-stranded, G-C richDNA has not yet melted

    A-T rich region of DNAhas melted into asingle-stranded bubble

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    28/65

    This slide shows an electron micrographtracing of a DNA molecule that is only

    partially melted. The thicker regions are

    double-stranded and probably more G-C rich.

    The A-T rich regions are more prone to

    denaturation, and as seen here, form single-

    stranded "bubbles."

    H h i it

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    29/65

    Hyperchromicity

    The absorbance at 260 nm of a DNA solution increaseswhen the double helix is melted into single strands.

    260

    Absorbance

    Absorbance maximum

    for single-stranded DNA

    Absorbancemaximum fordouble-stranded DNA

    220 300

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    30/65

    Hyperchromicity can be used to follow the denaturation of DNA as a function of

    increasing temperature. As the temperature of a DNA solution gradually rises above

    50 degrees C, the A-T regions will melt first giving rise to an increase in the UVabsorbance. As the temperature increases further, more of the DNA will become

    single-stranded, further increasing the UV absorbance, until the DNA is fully

    denatured above 90 degrees C. The temperature at the mid-point of the melting

    curve is termed "melting temperature" and is abbreviated Tm. The Tm for a DNA

    depends on its average G+C content: the higher the G+C content, the higher the Tm.

    Note: G+C content, G-C content, and GC content are equivalent terms.

    DNA melting curve

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    31/65

    100

    50

    0

    7050 90

    Temperature oC

    Percenth

    yperchromicit

    y

    DNA melting curve

    Tm is the temperature at the midpoint of the transition

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    32/65

    When a solution of double-stranded DNA is

    placed in a spectrophotometer cuvette and theabsorbance of the DNA is determined across the

    electromagnetic spectrum, it characteristically

    shows an absorbance maximum at 260 nm (in the

    UV region of the spectrum). If the same DNA

    solution is melted, the absorbance at 260 nm

    increases approximately 40%. This property is

    termed "hyperchromicity." The hyperchromic

    shift is due to the fact that unstacked bases absorb

    more light than stacked bases.

    T i d d t th G C t t f th DNA

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    33/65

    Average base composition (G-C content) can bedetermined from the melting temperature of DNA

    50

    7060 80

    Temperatureo

    C

    Tm is dependent on the G-C content of the DNA

    Percenthyperchromicity

    E. coli DNA is50% G-C

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    34/65

    This slide shows the dependence of Tm on average G+C content of three

    different DNAs. Under the conditions used in this experiment, E. coli DNAwhich has an average G+C content of about 50%, melted with a Tm of 69

    degrees C. The curve on the left represents a DNA with a lower G+C content

    and the curve on the right represents a DNA with a higher G+C content. Tm

    is dependent on the ionic strength of the solution. At a fixed ionic strength

    there is a linear relation between Tm and G+C content.

    Genomic DNA, Genes, Chromatin

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    35/65

    , ,

    a). Complexity of chromosomal DNAi). DNA reassociationii).Repetitive DNA and Alu sequencesiii). Genome size and complexity of genomic DNA

    b). Gene structure

    i). Introns and exonsii). Properties of the human genomeiii). Mutations caused by Alu sequences

    c). Chromosome structure - packaging of genomic DNAi). Nucleosomes

    ii). Histonesiii). Nucleofilament structureiv). Telomeres, aging, and cancer

    DNA reassociation (renaturation)

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    36/65

    DNA reassociation (renaturation)

    Double-stranded DNA

    Denatured,single-stranded

    DNA

    Slower, rate-limiting,second-order process offinding complementarysequences to nucleate

    base-pairing

    k2

    Faster,zipperingreaction toform long

    moleculesof double-strandedDNA

    DNA reassociation kinetics for human genomic DNA

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    37/65

    Cot1/2

    DNA reassociation kinetics for human genomic DNA

    Cot1/2 = 1 /k2 k2 = second-order rate constant

    Co = DNA concentration (initial)t1/2 = time for half reaction of each

    component or fraction

    50

    100

    0

    %D

    N

    Areassociated

    I I I I I I I I I

    log Cot

    fast (repeated)intermediate(repeated)

    slow (single-copy)

    Kinetic fractions:

    fastintermediateslow

    Cot1/2

    Cot1/2

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    38/65

    This illustrates the concept of how sequence complexity affects the rate of DNA

    reassociation. Imagine two different DNA sequences in a genome, one present

    one time per haploid genome (right) and the other present 1,000,000 times per

    haploid genome (left). They would be present at a 1:1,000,000 ratio with respect

    to each other. If these sequences were mixed together (which is what would

    happen if total genomic DNA was isolated for analysis), then fragmented,

    denatured and allowed to reassociate, the repeated sequences would reassociate

    much more rapidly because it would be much easier for them to find

    complementary strands to base pair with. The repeated sequences would

    reassociate with a very low Cot1/2 and therefore with a very high k2, consistentwith a rapid rate of reassociation.

    106 copies per genome of 1 copy per genome of

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    39/65

    high k2

    p p ga low complexity sequence

    of e.g. 300 base pairs

    py p ga high complexity sequence

    of e.g. 300 x 106 base pairs

    low k2

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    40/65

    The human genome consists of three populations of DNA: the fast and intermediate fractions

    make up about 10% and 15% of the genome, respectively, and the slow fraction makes up

    about 75% of the genome. Most of the genes in the human genome are in the single-copy

    fraction. As shown in the next slide, repeated sequences can be of two types: those that are

    interspersed throughout the genome or those that are tandemly repeated satellite DNAs.

    Among the interspersed repetitive sequences are so-called "Alu" sequences, which are about300 base pairs in length and are repeated about 300,000 times in the genome. They can be

    found adjacent to or within genes, and as illustrated later, their presence can sometimes lead to

    the occasional disruption of genes. The interspersed repetitive sequences also include VNTRs

    (variable numbers of tandem repeats), which are comprised of short repeated sequences of

    only a few base-pairs, but of variable lengths. They, too, are interspersed throughout the

    genome, and are quite useful as landmarks for mapping genes because they are highlypolymorphic (they differ in length or number of repeats from individual to individual).

    Type of DNA % of Genome Features

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    41/65

    Single-copy (unique) ~75% Includes most genes 1

    Repetitive

    Interspersed ~15% Interspersed throughout genome between

    and within genes; includes Alu sequences 2and VNTRs or mini (micro) satellites

    Satellite (tandem) ~10% Highly repeated, low complexity sequences

    usually located in centromeres

    and telomeres

    2Alu sequences areabout 300 bp in lengthand are repeated about300,000 times in thegenome. They can be

    found adjacent to orwithin genes in intronsor nontranslated regions.

    1 Some genes are repeated a few times to thousands-fold and thus would be in

    the repetitive DNA fraction

    50

    100

    0

    I I I I I I I I I

    fast ~10%intermediate

    ~15%

    slow (single-copy)~75%

    Classes of repetitive DNA

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    42/65

    Interspersed (dispersed) repeats (e.g., Alu sequences)

    TTAGGGTTAGGGTTAGGGTTAGGG

    Tandem repeats (e.g., microsatellites)

    GCTGAGG GCTGAGGGCTGAGG

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    43/65

    . Knowing the complete sequence of the human genome will allow medical researchers to more easily

    find disease-causing genes. In addition, it should become possible to understand how differences in

    our DNA sequences from individual to individual may affect our predisposition to diseases and our

    ability to metabolize drugs. Because the human genome has ~3 billion bp of DNA and there are 23

    pairs of chromosomes in diploid human cells, the average metaphase chromosome has ~130 million bp

    DNA.

    Genome sizes in nucleotide pairs (base-pairs)

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    44/65

    viruses

    plasmids

    bacteriafungi

    plants

    algae

    insects

    mollusks

    reptilesbirds

    mammals

    104 108105 106 107 10111010109

    The size of the humangenome is ~ 3 X 109 bp;almost all of its complexity

    is in single-copy DNA.

    The human genome is thoughtto contain ~30,000 to 40,000 genes.

    bony fish

    amphibians

    Gene structure

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    45/65

    5 3

    promoterregion

    exons (filled and unfilled boxed regions)

    introns (between exons)

    transcribed region

    translated region

    mRNA structure

    +1

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    46/65

    This slide shows the structure of a typical human gene and its corresponding messenger

    RNA (mRNA). Most genes in the human genome are called "split genes" because they are

    composed of "exons" separated by "introns." The exons are the regions of genes that

    encode information that ends up in mRNA. The transcribed region of a gene (double-

    ended arrow) starts at the +1 nucleotide at the 5' end of the first exon and includes all ofthe exons and introns (initiation of transcription is regulated by the promoter region of a

    gene, which is upstream of the +1 site). RNA processing (the subject of a another lecture)

    then removes the intron sequences, "splicing" together the exon sequences to produce the

    mature mRNA. The translated region of the mRNA (the region that encodes the protein) is

    indicated in blue. Note that there are untranslated regions at the 5' and 3 ends of mRNAs

    that are encoded by exon sequence but are not directly translated.

    The (exon-intron-exon)n structure of various genes

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    47/65

    -globin

    HGPRT(HPRT)

    total = 1,660 bp; exons = 990 bp

    histone

    factor VIII

    total = 400 bp; exon = 400 bp

    total = 42,830 bp; exons = 1263 bp

    total = ~186,000 bp; exons = ~9,000 bp

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    48/65

    This figure shows examples of the wide variety of gene structures seen in the human genome.

    Some (very few) genes do not have introns. One example is the histone genes, which encode the

    small DNA-binding proteins, histones H1, H2A, H2B, H3, and H4. Shown here is a histone

    gene that is only 400 base pairs (bp) in length and is composed of only one exon. The beta-

    globin gene has three exons and two introns. The hypoxanthine-guanine phosphoribosyl

    transferase (HGPRT or HPRT) gene has nine exons and is over 100-times larger than the histone

    gene, yet has an mRNA that is only about 3-times larger than the histone mRNA (total exon

    length is 1,263 bp). This is due to the fact that introns can be very long, while exons are usually

    relatively short. An extreme example of this is the factor VIII gene which has numerous exons

    (the blue boxes and blue vertical lines).

    Properties of the human genome

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    49/65

    Properties of the human genome

    Nuclear genome

    the haploid human genome has ~3 X 109 bp of DNA single-copy DNA comprises ~75% of the human genome the human genome contains ~30,000 to 40,000 genes

    most genes are single-copy in the haploid genome genes are composed of from 1 to >75 exons genes vary in length from 2,300,000 bp Alu sequences are present throughout the genome

    Mitochondrial genome

    circular genome of ~17,000 bp contains

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    50/65

    Familial hypercholesterolemia autosomal dominant

    LDL receptor deficiency

    From Nussbaum, R.L. et al. "Thompson & Thompson Genetics in Medicine," 6th edition (Revised Reprint), Saunders, 2004.

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    51/65

    The rather common (~1 in 500) autosomal dominant disease, familial hypercholesterolemia

    (FH), is caused by mutations in the LDL (low density lipoprotein) receptor gene (for more

    information about FH, look at pages 218-222 of Thompson & Thompson and at Case 9).

    Plasma LDL, which carries circulating cholesterol, is cleared from the serum by binding to the

    LDL receptor on liver cells and is internalized. Normal plasma cholesterol levels average

    below 200 mg/dl. Individuals who have one defective LDL receptor gene (heterozygous) have

    approximately double this amount, and those with two defective genes (homozygous) have

    approximately four times this amount. Heterozygous individuals are predisposed to

    cardiovascular disease, with males having a 50% risk of myocardial infarction by age 50. There

    are many ways that the LDL receptor gene has been mutated rendering it inactive or abnormal.

    As shown in the next figure, one mechanism has involved Alu sequences.

    LDL receptor gene

    Al t t ithi i t

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    52/65

    Alu repeats present within introns

    Alu repeats in exons

    4

    4

    4

    5

    5

    5 6

    6

    6

    Alu Alu

    AluAlu

    X

    46

    Alu

    unequalcrossing over

    one product has adeleted exon 5

    (the other product is not shown)

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    53/65

    Here you see the structure of the LDL receptor gene (which has 18 exons). Six Alu

    sequences are present within three of the introns and two of the exons. Because of the

    close proximity of the two Alu repeats located within introns 4 and 5, unequal crossing

    over can occur during meiosis. Crossing over (the topic of a future lecture) requires

    homologous sequences, which base pair with each other during the process of meiosis.The homologous sequences can be provided by the Alu repeats, which can cause an out-

    of-register misalignment and subsequent crossing over deleting exon 5 from one of the

    two products of crossing over. This exon 5 in-frame deletion can be inherited and is

    currently a cause of FH. This deletion affects the LDL binding region of the receptor.

    Thus, while Alu sequences have no known function in our genomes, there are a lot of

    them scattered throughout our genomes, within and around genes, and they can be quitedisruptive.

    Chromatin structure

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    54/65

    Chromatin structure

    EM of chromatin shows presence of

    nucleosomes as beads on a string

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    55/65

    Each nucleosome is composed of a core (left) consisting of two each of the histones, H2A,

    H2B, H3, and H4, around which the DNA winds 1 3/4 times. The DNA undergoes negative

    supercoiling as a consequence of being wound around the core histones. Histones are

    positively charged proteins and thus interact with the negatively charged phosphates along the

    backbone of the DNA double helix. While the core has 146 bp of DNA, the nucleosome

    proper (right) has approximately 200 bp of DNA and also includes one histone H1 monomer

    lying on the outside of the structure. Nucleosomes are regularly spaced along eukaryotic

    chromosomal DNA every ~200 bp, giving rise to the "beads on a string" structure.

    Nucleosome structure

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    56/65

    Nucleosome structure

    Nucleosome core (left)

    146 bp DNA; 1 3/4 turns of DNA

    DNA is negatively supercoiled

    two each: H2A, H2B, H3, H4 (histone octomer)Nucleosome (right)

    ~200 bp DNA; 2 turns of DNA plus spacer

    also includes H1 histone

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    57/65

    Histones are small, positively charged proteins that can be extensively modified

    posttranslationally, in general to make them less positively charged. Histone

    deacetylases (HDACs) are associated with transcriptional repression because they

    make histones better able to bind DNA, thus making DNA less accessible to the

    transcription machinery. Histone deacetylases are recruited to the chromosome by

    transcriptional repressors such as the retinoblastoma (Rb) protein (the subject of

    another lecture). Histone acetylases are recruited to chromosomes by transcription

    factors (TFs). Histone acetylases reduce the positive charges on histones, causing

    them to loosen their grip on the DNA to allow transcription factors to bind.

    Histones (H1, H2A, H2B, H3, H4)small proteins

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    58/65

    small proteins arginine or lysine rich: positively charged

    interact with negatively charged DNA can be extensively modified - modifications in

    general make them less positively chargedPhosphorylationPoly(ADP) ribosylation

    MethylationAcetylation

    Hypoacetylation

    by histone deacetylase (facilitated by Rb)tight nucleosomesassoc with transcriptional repression

    Hyperacetylationby histone acetylase (facilitated by TFs)loose nucleosomesassoc with transcriptional activation

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    59/65

    The orderly packaging of DNA in the cell is essential for the process of DNA

    replication, as well as for the process of transcription. Packaging of DNA into

    nucleosomes is only the first step, foreshortening chromosomal DNA somewhat

    by virtue of its being wrapped around the core histones 1 3/4 times. However, if

    the average human genomic DNA molecule is ~130 million bp in length, its

    length would be an astounding 44 mm. All this DNA X 23 chromosomes has to

    packaged in the nucleus of a cell that is too small to be seen with the unaided eye.

    Thus, the DNA needs to be packaged in higher-order structures such as shown

    above, first into closely packed arrays of nucleosomes called nucleofilaments,which are then coiled into thicker and thicker filaments.

    Nucleofilament structure

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    60/65

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    61/65

    The interphase nucleus contains loosely

    packed, filamentous chromosomes, whoseDNA is available for gene transcription.

    During each round of cell division, the

    chromosomal DNA is replicated and then

    condensed into metaphase chromosomes for

    segregation into the daughter cells, followed

    by decondensation as the interphase nucleus

    is formed.

    Condensation and decondensationof a chromosome in the cell cycle

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    62/65

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    63/65

    The chromosome contains a single, long molecule of double stranded DNA, and thus has two

    ends. These ends create two problems: they are difficult to replicate and they have a tendency

    to fuse with other chromosome ends causing karyotypic rearrangements. To prevent these

    problems, chromosomes have protective ends called "telomeres" that are composed of tandemly

    repeated, 5-8 bp sequences up to 12 kb in length. In germline cells and in the cells of youngindividuals, telomeres are of maximal length, but with every round of somatic cell division

    telomeres get a little shorter. After many rounds of replication and cell division, telomeres

    become too short to protect the chromosome ends from fusing with other chromosomes. At this

    stage, cells are said to be "senescent." Telomere length is maintained in germline cells by an

    enzyme called "telomerase," which can restore any shortening that has occurred. Tumor cells

    also have telomerase and thus are immortal and can grow indefinitely.

    Telomeres and agingTelomeres are protectivecaps on chromosomeends consisting of short5-8 bp tandemly repeated

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    64/65

    Metaphase chromosome

    centromere telomeretelomere

    telomere structure

    young

    senescent

    5 8 bp tandemly repeatedGC-rich DNA sequences,that prevent chromosomes

    from fusing and causingkaryotypic rearrangements.

    (TTAGGG)many

    (TTAGGG)few

    telomerase (an enzyme) is required to maintain telomere length ingermline cells

    most differentiated somatic cells have decreased levels of telomeraseand therefore their chromosomes shorten with each cell division

    12 kb

  • 7/31/2019 Dna Genes Chromosomes 2011[1]

    65/65

    Class Assignment (for discussion on Sept 9th)

    Botchkina GI, et al.

    Noninvasive detection of prostate cancer byquantitative analysis of telomerase activity.Clin Cancer Res. May 1;11(9):3243-3249, 2005

    PDF of article is accessible on the website