dna mrs. foles 2010-2011. jag mark 9/1/10 how long did you study for your test that you took...
TRANSCRIPT
DNA
Mrs. Foles
2010-2011
Jag Mark 9/1/10
How long did you study for your test that you took yesterday?
How do you feel about your performance on the test you took yesterday?
How will you change the way/length of time that you study for the next test?
Jag Mark 9/2/10
What do plants give off as a waste product during photosynthesis?
What do we give off as a waste product during cellular respiration?
Jag Mark 9/3/10
Summarize the difference between autotrophs and heterotrophs.
Jag Mark 9/7/10
What 3 things are in a plant cell that are missing in an animal cell?
What biological process produces new cells to replace older cells?
What is the correct organization of life beginning with cells?
Jag Mark 9/8/10
What is the structure of DNA? Draw and label a nucleotide. Practice
– Template Strand: ATCGGTACGTACGTAG– Complement Strand:
Jag Mark 9/9/10
Describe the 4 different types of organic compounds involved in metabolic activities.
What makes these compounds organic? Replicate the following DNA strand.
– AGTCGTAGCTCGATGCTTA
Jag Mark 9/10/10
Complete the steps of protein synthesis with the following strand of DNA. (Explain the location and process of each step)
TACGACGTAACT
Jag Mark 9/13/10
What materials make up a nucleotide? Draw and label a strand of DNA.
Jag Mark 9/14/10
Summarize the differences between DNA and RNA.
Jag Mark 9/15/10
Explain why virus are nonliving.What are the main components of all
viruses?
Jag Mark 9/16/10
What type of mutation would result in the following mutant strand of DNA?– Normal: ACTCCTGAAGAAAAA– Mutant: ACTCCTGTAGAAAAA
Would this mutation cause a change in the protein being synthesized?
Is this a point-shift or frame-shift mutation?
Jag Mark 9/17/10
Outline 3 ways to protect yourself from viruses.
Jag Mark 9/20/10
Summarize the differences between the lytic cycle and the lysogenic cycle.
Jag Mark 9/21/10
TEST DAY! Clear desk except for 1 sheet of notebook
paper and a pencil.
Organic Compounds: (Contain Carbon) Of Metabolism!
Carbohydrate: a compound composed of carbon, hydrogen, and oxygen in the proportion of 1:2:1.
Lipids: compound that contains a high proportion of carbon and hydrogen with a much smaller amount of oxygen. (Fats, oils, and waxes.
Organic Compounds: (Contain Carbon) Of Metabolism!
Proteins: a large molecule made from amino acids. (enzymes: proteins that speed up reactions)
Nucleic Acid: large molecule that stores and carries genetic information in the cell. (DNA,RNA)
What is DNA?
Deoxyribonucleic acid Codes for genes and
is used in the development and functioning of all living things.
Credit for structure is given to Watson and Crick.
What is it made of?
DNA is made up of 4 types of Nucleotides All nucleotides are identical except for the base Each nucleotide has 3 materials:
– A sugar: deoxyribose– A phosphate– A base
The bases of DNA
Pyrimadine: 1 ring– Thymine (T)– Cytosine (C)
Purine: 2 rings– Adenine (A)– Guanine (G)
Structure and Base Pairing of DNA
Base Pairing– Adenine pairs with Thymine (A=T)– Cytosine pairs with Guanine (C≡G)
Structure– Twisted Ladder/Double Helix– Sides of Ladder
Alternating Phosphate and Sugar
– Rungs of Ladder Pair of nucleotide bases
DNA Replication
DNA molecule sides are complementary to each other, therefore DNA can replicate itself if nucleotides are present.
When DNA replicates, the bases break apart and the DNA unwinds and unzips.
Semi-conservative
Where does replication take place?
In the nucleus! During what phase of the cell cycle?
Practice:– Template: ATTGCAGGCCTTAGTCAC– Replicate:
Practice Problem
AGTTCAGCGGTATTAGCTAGCAACCGT
RNA
DNA can’t leave the nucleus, so it must be “transcribed” into something that can: RNA
Three Types:– mRNA: (messenger) Takes code from DNA in
nucleus to ribosome– tRNA: (transfer) Brings in amino acids to build
proteins– rRNA: (ribosomal) Makes up ribosomes
RNA
RNA is similar to DNA because
– It is composed of nucleotides
– BASES: It has C, G, and A.
– It has a backbone composed on phosphates and sugars
RNA is different than DNA because
– BASE: Instead of Thymine bases there are Uracil bases
– SUGAR: Instead of dexoyribose there is ribose.
– RNA is single stranded
Transcription
An enzyme in the nucleus begins transcription to form mRNA from DNA.
mRNA leaves the nucleus and binds to a ribosome.
Transcription
DNA strand: ATACTGTCAGTATGGCCAT RNA strand:
Practice problem: TATTACGACCCGTACTAGAATGGCTCC
Reverse Transcription
DNA strand: RNA strand: UAGGCUACUGAUCCAAUG
Translation
After mRNA leaves the nucleus it binds to a ribosome in the cytoplasm.
mRNA is read as codons: (three base pairs in a row.)
tRNA brings amino acids to the mRNA that is specific for the codon and forms a peptide chain.
Transcription and Translation
Translation Practice
mRNA: AUG AGC UGG GGG UAU UAG Amino acid: Met Ser Leu Gly Tyr Stop
Practice mRNA: AUG UGU AGC CCU AUU UAA tRNA: Amino acid:
Central Dogma of Protein Synthesis
Translation
There are 4 base pairs 20 amino acids AUG = Start codon UAA, UAG, UGA = Stop codon When making proteins, extra amino acids
must be brought from cytoplasm.
Proteins
Made of amino acids (the building blocks of proteins)
Several amino acids make a peptide chain
Amino acids held together by peptide bonds
What is a gene?
Instructions for building proteins, traits, and is located on DNA.
Genes are found on chromosomes. Must have a start codon Must have a stop codon Must have a promoter region (TATATTA)
Mutation
Mutations are changes to the base pair sequence of either DNA or RNA.
Causes: copying errors in the DNA during mitosis and by exposure to ultraviolet radiation, xrays, radioactivity, or viruses.
Results: genetic disorders, death, or have no affect.
Most mutations are repaired by enzymes.
Types of Mutation
Insertion: the addition of one or more nucleotide base pairs into a genetic sequence– Ex: Normal: AAACCCGGG
Mutated: AAACACCGGG
Types of Mutation
Deletion: part of a chromosome or a sequence of DNA is missing. Any number of nucleotides can be deleted, from a single base to an entire piece of chromosome.
Example
Normal: AAACCCGGG
Mutated: AAACCGGG
Types of Mutation
Substitution: one or more nucleotides are substituted by the same number of different nucleotides. In most cases, only one nucleotide is changed.
Example:
Normal: AAACCCGGG
Mutated: AAACACGGG
Types of Mutations
Frame-shift mutation: causes a change all the way down a DNA sequence, making each codon a different sequence. (MORE SERIOUS!)
EX. CAG TTC CTG GAA -> (frameshift)-> CAG TTA CCT GGA
– Insertion– Deletion
Point-shift mutation: a single letter is the only thing changed in the DNA sequence
EX. GTA CTG CAA-----> (point mutation) -----> GTA GTG CAA
– Substitution
Cell Growth and RepairCell Growth and Repair
Cell CycleCell Cycle the entire life cycle of a cell. the entire life cycle of a cell. Cells divide through a process called Cells divide through a process called MitosisMitosis. .
Phases of MitosisPhases of Mitosis
ProphaseProphase: The chromatin condenses into : The chromatin condenses into chromosomes. Each chromosome has chromosomes. Each chromosome has duplicated and now consists of two sister duplicated and now consists of two sister chromatids. The nuclear envelope breaks down chromatids. The nuclear envelope breaks down into vesicles.into vesicles.– Chromatid: name of chromosome once it is Chromatid: name of chromosome once it is
duplicatedduplicated– Centromere: Holds chromatid togetherCentromere: Holds chromatid together
MetaphaseMetaphase: Chromosomes line up at the : Chromosomes line up at the equator of the cell.equator of the cell.
Phases of MitosisPhases of Mitosis
AnaphaseAnaphase: Sister chromatids separate and : Sister chromatids separate and move toward the opposite poles. move toward the opposite poles.
TelephaseTelephase: The condensed chromatin : The condensed chromatin expands and the nuclear envelope expands and the nuclear envelope reappears. The cytoplasm divides. reappears. The cytoplasm divides.
CytokinesisCytokinesis: The cell membrane pinches : The cell membrane pinches inward ultimately producing two daughter inward ultimately producing two daughter cells.cells.
During CytokinesisDuring Cytokinesis
In plant cells a cell plate forms in between In plant cells a cell plate forms in between the new cells and will become the cell the new cells and will become the cell membrane. A cell wall then forms around the membrane. A cell wall then forms around the cells.cells.
Cancer
Cancer is a disease in which cells grow and divide uncontrollably, damaging parts of the body around them.
Virus
Virus is a tiny non-living particle that enters and then reproduces inside a living host cell.
Have either DNA or RNA. May be single stranded or double stranded. Nonliving because cannot: make food, take
in food, use energy, respond to stimuli, make waste or multiply on their own.
Bacteriophage is a virus that infects bacteria.
Virus Shape and Size
Viruses are smaller than bacteria (measured in nanometers)
Structure: (2 main Parts)– Protein Coat– Inner Genetic Material (DNA or RNA)
How Viruses Multiply
Lytic Cycle: Virus enters cell and uses cell to reproduce. (Ex. Flu, Rhinovirus)– Viral DNA destroys Cell DNA, takes over cell
functions and destroys the cell. – The Virus replicates.– There are symptoms of viral infection. – Active viral infection takes place.
How Viruses Multiply
Lysogenic Cycle: Virus enters cell and becomes part of cells DNA. May enter lytic cycle is exposed to stress. (Herpes, cold sores.)– Viral DNA merges with Cell DNA and does not destroy
the cell. – There are no symptoms of viral infection. – Passive viral replication takes place.
Lysogenic/Lytic Cycle
Lytic VS Lysogenic Cycle
Ways to Protect
Vaccinations: weakened or dead viruses injected into the body to stimulate immune response. (Antibodies form against virus)
Proper hygiene/hand washing Minimize risk by avoiding risky behavior.
(ex. IV drug use, unprotected sex)
Cancer
Some viruses have been linked to the formation of tumors. – HPV linked to cervical cancer– Hepatitis B and C linked to liver cancer– Epstein-Barr linked to lymphoma