dna profiling
DESCRIPTION
DNA Profiling. Dept of Biological Sciences California State University, Sacramento [email protected]; Forensic Science Graduate Program University of California, Davis [email protected]. Ruth E. Ballard, Ph.D . Applications and Methodology. Name: Ballard, Ruth Hair: Brown - PowerPoint PPT PresentationTRANSCRIPT
DNA ProfilingApplications and Methodology
Ruth E. Ballard, Ph.D.Dept of Biological SciencesCalifornia State University, [email protected]; Forensic Science Graduate ProgramUniversity of California, [email protected]
Name: Ballard, RuthHair: BrownEyes: GreenHt: 5’ 2”Wt: 105Occupation: Professor and DNA/Biology Program AdvisorLast Known Addresses:Dept of Biological SciencesCalifornia State University, [email protected]; Forensic Science Graduate ProgramUniversity of California, [email protected] for: Impersonating a criminalist
Why we need DNA markers
Why we need DNA markers
Short Tandem Repeat Markers
Outline
Cold Case Study: Solving the abduction, rape, and murder of Penny Parker
Generating a profile
Applications
Definition
CODIS
DNA profiling is a scientific technique that exploits genetic differences among people to distinguish them from one another
Definition
Humans share 99.9% of their DNA On average (for unrelated individuals) 1 in
1,000 base-pairs is different
Definition
Sister chromatids
Homologues
Example: Human chromosome 1 4,220 genes (2%) 98% non-coding “junk DNA” 2.47 x 108 base-pairs Average number of differences between
unrelated homologues: 247,000 Most differences are in non-coding fraction DNA profiling exploits these differences
across all chromosomes
Definition
Short Tandem Repeat Markers
Outline
Cold Case Study: Solving the abduction, rape, and murder of Penny Parker
Generating a profile
Applications
Definition
CODIS
Applications Solving Crimes (murder, sexual assaults,
burglaries)
Applications Missing persons and unidentified remains
Skull found in a field in the Los Gatos hills is identified as belonging to missing Vallejo child, Xiana Fairchild, 14 months after her disappearance in Dec,1999
Applications
13
Establishing Biological Relationships (child support, visitation, immigration, inheritance)
Applications Assigning twin status
◦ Identical or fraternal?
Applications Identifying victims of man-made disasters
◦ TWA Flight 800◦ Exploded and crashed July 1996 in Atlantic
Ocean off New York state
Applications Identifying victims of natural disasters
◦ “Baby 81” claimed by 9 couples after tsunami in Southeast Asia
◦ Identity confirmed as Abilass Jevarajah and reunited with biological parents
Short Tandem Repeat Markers
Outline
Cold Case Study: Solving the abduction, rape, and murder of Penny Parker
Generating a profile
Applications
Definition
CODIS
Short Tandem Repeat Markers DNA profiling relies on short, tandemly
repeated sequences of DNA (STRs)◦ Ubiquitous in the human genome◦ Short (for DNA profiling 4 bp)
e.g. gaca, ctat, ggca, etc.◦ Highly polymorphic (many alleles in the
population) “Alleles” defined by number of repeats present (e.g.
6,7,8,9,10,11,12,13,14,15, etc.)◦ No one allele present at much higher frequencies
than others
Example: D7S820◦ Located on chromosome 7◦ Repeated sequence: 5’-gata-3’◦ Alleles observed in human population:
6,7,8,9,10,11,12,13,14,15,16
aatttttgtattttttttagagacggggtttcaccatgttggtcaggctgactatggagttattttaaggttaatatatataaagggtatgatagaacacttgtcatagtttagaacgaactaacgatagatagatagatagatagatagatagatagatagatagatagatagatagatagtttttttttatctcactaaatagtctatagtaaacatttaattaccaatatttggtgcaattctgtcaatgaggataaatgtggaatcgttataattcttaagaatatatattccctctgagtttttgatacctcagattttaaggcc
Short Tandem Repeat Markers
Level of discrimination rises with number of possible alleles
Short Tandem Repeat Markers
# alleles in the
population (x)
# genotypes in the population
(x2 + x)/21 12 33 64 105 156 217 28
11 66
Short Tandem Repeat Markers Each person has only two alleles for each
STR locus◦ Can be either heterozygous or homozygous
(4,6) heterozygot
e
(5,5) homozygote
Short Tandem Repeat Markers Allele frequency tables can be used to estimate
genotype frequencies using Hardy Weinberg statistics
ALLELE FREQUENCY4 0.0015 0.0186 0.1627 0.1308 0.2629 0.250
10 0.12811 0.04512 0.00313 0.001
Frequency (4,6) = 2 pq= 2 (0.001)(0.162) = 0.000324(or 1 in 3,086 persons)
Frequency (5,5) = p2
= (0.018)2 = 0.0262(or 1 in 38 persons)
Short Tandem Repeat Markers The scientific community has chosen 13 core STR
loci for DNA profiling The amelogenin locus on the X and Y
chromosomes is also targeted for sex typing
Short Tandem Repeat Markers The loci are genetically unlinked Therefore, the inheritance of each STR is an
independent event This permits the product rule to be used
when calculating the probability of an entire profile
The genotype frequency for each locus is calculated and then they are multiplied together to provide a random match probability (RMP) for the profile
Short Tandem Repeat Markers
Random Match Probability (RMP)
The probability of randomly selecting an unrelated individual from the population who would have the same genetic profile as the person tested
For my profile:
Short Tandem Repeat Markers
Locus GenotypeD8S1179 (13,13) 0.093025D21S11 (29.3,33.2) 0.000416D7S820 (10,12) 0.080676CSF1PO (10,11) 0.130634D3S1358 (15,18) 0.079648THO1 (6,9.3) 0.170752D13S317 (11,12) 0.168144D16S539 (12,12) 0.106276D2S1338 (16,17) 0.012012D19S433 (13,14) 0.186714VWA (17,17) 0.078961TPOX (9,11) 0.057834D18S51 (12,15) 0.040386D5S818 (11,11) 0.130321FGA (20,10) 0.016129RMP 8.6177E-20
The probability of randomly selecting an unrelated individual from the population with the same genetic profile as myself is 1 in 11 quintillion!!
Short Tandem Repeat Markers
Outline
Cold Case Study: Solving the abduction, rape, and murder of Penny Parker
Generating a profile
Applications
Definition
CODIS
DNA Profiling always starts with a biological sample◦ Cigarette butt a suspect smoked during
questioning (cheek cells in suspect’s saliva)◦ A bloody knife found in a suspect’s car (blood
cells - possibly from the victim)◦ A hair found in a ski mask left at the site of an
armed robbery (hair root cells, possibly from the suspect)
◦ Human femur bone found in a dumpster (bone cell DNA, possibly from the victim of a homicide)
◦ A reference buccal swab from an alleged father for paternity testing
Generating a Profile
Generating a Profile Lyse open cells and extract DNA
◦ PCA (organic method)◦ Spin columns◦ Robots (e.g. EZ1)
Quantify the amount of human DNA present◦ quantitative PCR (qPCR)
Amplify 13-15 STR loci in one PCR reaction◦ Multiplex◦ PCR primers are fluorescently-labeled◦ Amplicons differ by length depending on the number
of repeats present Separate and resolve amplicons by gel
electrophoresis
Primer A (forward primer)
Primer B (reverse primer)
CHROMOSOME 7 received from mother carrying 9 repeats of GATA
CHROMOSOME 7 received from father carrying 12 repeats of GATA
Amplicon from chromosome carrying 9 repeats
Amplicon from chromosome carrying 12 repeats
12 base pairs
PCR sample loaded into
capillary
Samples run through capillary according to size
(+)
(-)
As PCR products pass capillary window, a laser
excites the fluorescent tag and the tag emits a signal
The signal is sent to a computer for
interpretation and analysis
detector
Allele 14 at D7S820
Allele 11 at TPOX
Allele 14 at D7S820
Allele 7 atD7S820
Allele 9 atTPOX
X axis = Time since injection = size of amplicon
Y ax
is =
Ampl
itude
of
fluo
resc
ent s
igna
l
Blue
Green
Yellow
Red
Short Tandem Repeat Markers
Outline
Cold Case Study: Solving the abduction, rape, and murder of Penny Parker
Generating a profile
Applications
Definition
CODIS
CODIS Established in 1994
◦ Director of FBI established a DNA Advisory Board◦ Defined and developed standards for DNA typing◦ Defined Indices for sample data banking
Fully operational in 1998◦ Stores DNA profiles from in:
Convicted Offenders Index Forensic Index Missing persons Index Missing persons reference Index Arrestee Index
◦ Allows law enforcement agencies to share information across all 50 states
BIOLOGICAL EVIDENCE AT CRIME SCENE
DNA Profile from evidence
Reference sample from victim
DNA profile of victim
Match?
Suspect(s)
DNA Profile from suspect(s)
Match?
If suspect(s) eliminated
(or no suspects)
Search Convicted Offender or Arrestee Indexes in CODIS
NO “HIT”
“HIT”
Repeat search every 7 days
Prosecute
CODIS• National (2008)• Convicted Offender profiles: 7,940,321 • Forensic profiles: 306,028 • “Hits”: 107,600
• California (2008)• Convicted Offender profiles: 1,251,307• Forensic profiles: 25,323• “Hits”: 12, 412
Short Tandem Repeat Markers
Outline
Cold Case Study: Solving the abduction, rape, and murder of Penny Parker
Generating a profile
Applications
Definition
CODIS
Cold Case Study May 1977: Penny Parker, 15,
disappeared while out collecting money for her Sacramento Bee paper route
Found dead three days later, stabbed and sexually assaulted
At the time, the analysis of biological evidence was in its infancy
Suspect identified but insufficient evidence to charge
Cold Case Study
42
Parker case reopened in 2001
Semen stain found on panties and DNA profile obtained
Profile entered into the FBI’s national CODIS database; no match
DNA typing methods introduced in 1986 and rapidly improved in 1990’s
December 2002, samples submitted from the ex-wife and biological daughter of suspect Don Jennings.
Relationship DNA profiling showed that it was 10,000 times more likely that Mr. Jennings was the source of the semen on Penny Parker’s panties than a random, unrelated man
Judge ordered Mr. Jennings to provide DNA reference sample for comparison to DNA from semen stain on panties
Cold Case Study
January 2003, Sacramento Police Department detectives traveled to Arkansas to obtain a reference sample from Mr. Jennings.
Sample profiled and found to match the profile of the semen donor.
Mr. Jennings committed suicide in February 2003, when officers returned to Arkansas and attempted to arrest him for the rape/homicide of Parker.
Demonstrates power of biological evidence to solve crimes, even “cold” ones
Cold Case Study
American Academy of Forensic Sciences http://www.aafs.org/
U.S. Bureau of Labor Statistics http://www.aafs.org/
California Association of Criminalists http://www.cacnews.org/
STRbase (http://www.cstl.nist.gov/strbase/) U.C. Davis Forensic Science Graduate
Program http://forensicscience.ucdavis.edu/
Additional Information