Moh, cular and Biochemical Parasitology. 50 (1992) 351 354 351 ~c', 1992 Elsevier Science Publishers B.V. All rights reserved. / 0166-6851/92/$05.00

MOLBIO 01678

Shor t C o m m u n i c a t i o n

DNA recombination associated with short direct repeats in Leishmania mexicana M379

J i a n h u a Liu, Grac ie la Salinas, N a d e s a n G a j e n d r a n , Dav id M u t h u i , Serge M u y l d e r m a n s and R a y m o n d H a m e r s

lnxtituut voor Moh'culaire Biologic, Vr(fl, Universiteit Brussel, St-Genesius Rode. Bel,~ium

(Received 10 July 1991; accepted 8 October 1991)

Key words: DNA recombination: Chi site; Direct repeats; CD1; Le&hmania

Mechanisms for the formation of extrachro- mosomal circular DNAs in Leishmania have been proposed in which large inverted or direct repeats were involved in the homologous recombination [1,2]. The occurrence of these circular DNA molecules is often associated with drug selection [3,4]. We have recently reported a DNA recombination event in Leishmania mexicana M379 [5]. Two clonal L. mexicana M379 lines, derived from the same isolate were found to contain the identical DNA fragment but in different forms. The 'Evans' line has this DNA fragment anchoring in a small linear chromosome, whereas the 'Garnham' line possesses this DNA in a circular form [5]. The aim of the present study was to examine the precise locus of the site of recombination, in order to understand the possible mechanism for the*generation of the extrachromosomal circular DNA element in L. mexicana M 379.

We previously reported that a 3.7-kb

Correspondence address: J. Liu, Eenheid Algemene Biologie, lnstituut voor Moleculaire Biologie, Vrije Universiteit Brussel, 65 Paardenstraat, B-1640 St-Genesius Rode, Belgium.

Note." Nucleotide sequence data reported in this paper have been reported to the GenBank TM data base with the accession number M77478.

fragment of CDI generated by a Clal restric- tion enzyme digest cross-hybridized with the 2.5-kb and 14-kb ClaI fragments of LDI, as well as with the 2.8-kb EcoRI fragment (previously estimated 2.9 kb) and a large (>20 kb) EcoRI fragment of LDI [5]. The 2.8-kb EcoRI fragment of LDI did not cross- hybridize with the 2.5-kb Clal fragment of LDI. This led us to conclude that the rearrangement occurred in these 3 fragments: the Y7-kb ClaI fragment of CD1, the 2.8-kb EcoRI and the 2.5-kb ClaI fragments of LDI (Fig. IA). We subsequently demonstrated that a SalI fragment of 1.5 kb located within the 2.5-kb Clal fragment encompassed the junc- tion (Fig. IA).

In the present study, we subcloned the 3.7- kb ClaI fragment of CDI from a 2EMBL4 clone in the Clal site of a pBR322 vector, and designated this recombinant plasmid as pBR/ C37. The 2.8-kb EcoRI and 1.5-kb Sal! fragments of LD1 were cloned in the pUC18 vector, designated pUC/E28 and pUC/S15 respectively. The pBR/C37 plasmid was se- quenced by the Sanger dideoxy-mediated chain-termination method [6] using the seque- nase enzyme. The full sequence of the pBR/ C37 insert was obtained using synthetic oligonucleotides (20-mers) as sequencing pri- mers (GenBank accession number M77478).

352

A

CD1 (26.6 kb)

1 kb I I

SC

C/=I\~ _ LD1 ( 250 kb )

B 5' 3'

pBR/C37 CTCGACACGCTCTGCCGTCG CCACCTCCACGTGATCCACCGCTCTCGC pUC/E28 CTCGACACGCTCTGCCGTCGc,,., ccACGTGATCCACCGCTCTCGC

Fig. l. (A) Relevant restriction enzyme map of a cross-over region of CDI and LDI molecules (sec rcf. 5 for the complete restriction enzyme map of CDI). Thin lines correspond to subclonc fragments of pBR/C37, pUC/E28, and pUC/SI5. The 5' 3' marks the orientation of the sequcnces as used for the alignment. The abbreviations used for restriction enzyme sites are: C, Clal; E, EcoR1; S, Sail. (B) Flanking sequences of a cross-over site. The bold letters 5 '-CCACCTCC-3' indicate the locus of a

cross-over which appears as direct repeats in the LD1 moleculc.

The double digested pUC/E28 plasmid (with BamHI and Pstl) and the pUC/S15 plasmid (with BamHI and KpnI) were digested with exonuclease llI to generate nested sets of deletions [7] which were subsequently cloned and sequenced. The sequences of 3 inserts were then aligned.

The pBR/C37 plasmid sequence from CD1 matched perfectly the pUC/E28 sequence from LDI starting from its 5'-end (the ClaI cloning site) until the sequence 5'-CCACCTCC-3' located 2 kb further to the 3'-end. After this particular sequence, the two sequences di- verged (Fig. 1). The pUC/S15 sequence from LD1 aligned perfectly to the pBR/C37 sequence (from CD1) from its 3'-end (the Sall cloning site) up to the same sequence, 5'- CCACCTCC-3 ' which occurred 1 kb further towards the Y-end. After that point, these 2 sequences again diverged. Therefore, the cross- ing-over site is clearly localized within the sequence of 5 ' -CCACCTCC-Y which appeared twice, as a short direct repeat in the LD1 molecule (Fig. 1 B), whereas this same sequence occurred in a single copy as a junction closing the CDI circle.

The LD1 molecule possesses sequences of 5'- CCACCTCC-Y as short direct repeats flank- ing the region of the sequences identical to the CDI. At this stage, we do not know whether the CD1 and LD1 molecules originate from an identical chromosomal reservoir as has been put forward by Beverley and Coburn [8] and Tr ippe t al. [9] and whether the CD1 and LD1 structures are directly interconvertible.

In contrast to the H circle in Leishmania major, which appears to be generated via a homologous recombination within large (198 bp or even larger) inverted or direct repeats [1], the CD1 molecule could be formed by a reciprocal cross-over in short (8 bp) direct repeats. The sequence 5'-CCACCTCC-Y of the direct repeat is strikingly similar to the complementary strand of the Chi site 5'- GCTGGTGG-3 ' in Escherichia coli [10]. The Chi-site enhances the recombination in its vicinity by the intermediate of the RecBCD enzyme complex [11]. Mutants such as 5'- GTTGGTGG-3 ' of this Chi site have been reported to function as well in the E. coli system [12]. It therefore remains possible that the recombination we observed was accom-

plished by a similar machinery. In Trypanoso- ma hrucei, another Chi-like sequence has been described as being the site involved in gene conversion of the phosphoglycerate kinase genes [13]. However, in another eucaryote, Neurospora crassa, an enzymic function similar to the E. coli RecBCD has been found which involves a different sequence (5'-AGCACT-3') in the recombination event [14].

Further experiments will be required to prove that the Leishmania contains a recombi- nation enzyme system similar to the E. coli RecBCD, acting on the sequence of 5'- GGAGGTGG-3' or related sequences and which is responsible for the generation of the CD1 molecule or LD1 molecule in L. mexicana M379.

Acknowledgements

The authors thank Dr. D. LeRay, J.C. Dujardin (ITMA) for providing Leishmania clonal lines, S. DeDonker, D. Jacquet (ITMA) for assistance in the preparation of medium, and D. DeVos for the synthesis of oligonucleo- tides. This work was supported by the Bio. 10 Belgian government programme, a grant from EEC-STD 2 No. 1508, and a scholarship from WHO (to G.S.).

References

I Ouellene, M., Hettema, E., Wust, D., Fase-Fowler, F. and Borst, P. (1991) Direct and inverted DNA repeats associated with P-glycoprotein gene amplification in drug resistant Leishmania. EMBO J. 10, 1009 1016.

353

2 White, T.C., Fase-Fowler, F., Van Luenen, H., Calafat, J. and Borst, P. (1988) The H circles of Leishmania larenlolae arc unique amplifiable system of oligomeric DNA associated with drug resistance. J. Biol. ( 'hem. 263, 16977 16983.

3 Beverley, S.M., Coderrc, J.A., Santi, D.V. and Schimkc, R.T. (1984) Unstable DNA amplifications in metho- trexate-resistant Leishmania consist of extrachromoso- real circles which relocalize during stabilization. ('ell 38, 431 439.

4 Katakura, K., Peng, Y., Pithawalla, R., Detke, S. and Chang, K.-P. (1991) Tunicamycin-resistant wmants from five species of Ix'ishmania contain amplified DNA in extrachromosomal circles of different sizes with a transcriptionally active homologous region. Mol. Biochem. Parasitol. 44. 233 244.

5 l,iu, J., G~\iendran, N., Muthui, D.. Muyldcrmans, S., Dujardin, J.C.. DcDonker, S., Jacquet, D., LeRay, D., Guerrini, F. and ttamers, R. ( 1991 )Chromosome rearrangement in Leishmania me.vicwm M379. Mol. Biochem. Parasitol. 46, 53 60.

6 Sanger, F., Nicklen, S. and Coulson, A.R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463 5467.

7 Hcnikoff, S. (1984) Unidirect ional digestion with exonuceasc Ill creates targctcd breakpoint for DNA sequencing. Gene 28, 351 359.

8 Beverley, S.M. and Coburn, C.M. (1990) Recurrent de novo appearance of small linear DNAs m Leishmania ma,/or and relationship to extra-chromosomal I)NAs in other species. Mol. Biochem. Parasitol. 42, 133 142.

9 Tripp, C.A., Myler, P.J. and Stuart, K. (1991) A DNA sequence (LDI) which occurs in several genomic organizations in Leishmania. Mol. Biochem. Parasitol. 47, 151 160.

10 Ponticelli, A.S., Schultz, D.W., Taylor, A.F. and Smith, G.R. (1985) Chi-dependent DNA strand cleawlge by RecBC enzyme. ()ell41, 145 151.

II Smith, G.R. (1988) Homologous recombination in procaryotes. Microbiol. Rev. 52, I 28.

12 Cheng, K.C. and Smith, G.R. (1987) Cutting of Chi-like sequences by the recBCl) enzyme o1" I~wherichia coli. J. Mol. Biol. 194, 747 750.

13 I,e Blancq, S.M., Swinkels, B.W., Gibson, W.C. and Borst, P. (1988) Evidence l\)r gene conversion between the phosphoglycerate kinase of Trypam~soma hrucei. ,I. Mol. Biol. 200, 439 447.

14 Fraser, M.J., Koa, H. and Chow. T.Y.-K. (1990) Neurospora endo-exonuclease is immunochemically related to the rccC gone product of Kwherichia coli. J. Bacteriol. 172, 507 510.