doctoral students session, turek iga, leukocyte sirtuin 1 mrna overexpression is associated with...
TRANSCRIPT
Leukocyte Sirtuin 1 mRNA overexpression is associated
with Gestational Diabetes Mellitus (GDM)
Iga A. TurekDepartment of Structural Biology
Medical University of LodzSupervisor: Prof. Lucyna A. Woźniak
Co-supervisor: Dr Marzena Wójcik
Presentation overview
1. Introduction
– Gestational Diabetes Mellitus (GDM)
– Sirtuin 1 (SIRT1)
2. Project aims
3. Methodology
4. Results
5. Conclusions
Slide 2 from 11
Introduction
Slide 3 from 11
GDM (Gestational Diabetes Mellitus) glucose intolerance with onset during
pregnancy. prevalence: up to 17%
SIRT1 (Sirtuin 1) NAD+-dependent histone deacetylase maintenance of glucose and lipid
homeostasis regulation of insulin secretion over 20 known substrates
Project aims:
to determine SIRT1 mRNA expression in leukocytes of GDM women at 24-33 weeks of pregnancy
to correlate changes in leukocyte SIRT1 expression with clinical characteristics of subjects
Slide 4 from 11
Methodology
Slide 5 from 11
RNA isolation
leukocytes separation
GDM (the HAPO criteria)n=135
control group (NGT)n=52
venous blood
leukocytes
RNA
RBC lysis buffer in hypotonic conditions
qRT-PCR
SIRT1
Primer sequence 5’→3’ cDNA amplicon size
Reverse: TGTGACAGAGAGATGGCTGG142
Forward: GCTCGCCTTGCTGTAGACTT
Results
SIRT1 expression leukocyte SIRT1 mRNA expression was 1.7-fold higher in GDM vs.
NGT pregnant women
Slide 7 from 11
Correlations of SIRT1 expressionPositive correlations of SIRT1 expression with:A.glucose concentration at 2 h of OGTT in the whole study group (NGT + GDM)B.HDL-cholesterol in NGT group
Slide 8 from 11
Results:
increased leukocyte SIRT1 mRNA expression in the GDM women
association of leukocyte SIRT1 overexpression with hyperglycemia in diabetic subjects
positive correlation between leukocyte SIRT1 expression and HDL-cholesterol in health pregnant women
Slide 9 from 11
Conclusions:
association of GDM with a change in leukocyte SIRT1 expression at its gene level
leukocyte SIRT1 expression is related to hyperglycemic conditions
potential protective role of leukocyte SIRT1 against CVD in healthy pregnancy
Slide 10 from 11
Thank you for your attention