doctoral students session, turek iga, leukocyte sirtuin 1 mrna overexpression is associated with...

11
Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM) Iga A. Turek Department of Structural Biology Medical University of Lodz Supervisor: Prof. Lucyna A. Woźniak Co-supervisor: Dr Marzena Wójcik

Upload: iga-turek

Post on 12-Apr-2017

249 views

Category:

Documents


2 download

TRANSCRIPT

Page 1: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Leukocyte Sirtuin 1 mRNA overexpression is associated

with Gestational Diabetes Mellitus (GDM)

Iga A. TurekDepartment of Structural Biology

Medical University of LodzSupervisor: Prof. Lucyna A. Woźniak

Co-supervisor: Dr Marzena Wójcik

Page 2: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Presentation overview

1. Introduction

– Gestational Diabetes Mellitus (GDM)

– Sirtuin 1 (SIRT1)

2. Project aims

3. Methodology

4. Results

5. Conclusions

Slide 2 from 11

Page 3: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Introduction

Slide 3 from 11

GDM (Gestational Diabetes Mellitus) glucose intolerance with onset during

pregnancy. prevalence: up to 17%

SIRT1 (Sirtuin 1) NAD+-dependent histone deacetylase maintenance of glucose and lipid

homeostasis regulation of insulin secretion over 20 known substrates

Page 4: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Project aims:

to determine SIRT1 mRNA expression in leukocytes of GDM women at 24-33 weeks of pregnancy

to correlate changes in leukocyte SIRT1 expression with clinical characteristics of subjects

Slide 4 from 11

Page 5: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Methodology

Slide 5 from 11

RNA isolation

leukocytes separation

GDM (the HAPO criteria)n=135

control group (NGT)n=52

venous blood

leukocytes

RNA

RBC lysis buffer in hypotonic conditions

qRT-PCR

SIRT1

Primer sequence 5’→3’ cDNA amplicon size

Reverse: TGTGACAGAGAGATGGCTGG142

Forward: GCTCGCCTTGCTGTAGACTT

Page 6: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Results

Page 7: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

SIRT1 expression leukocyte SIRT1 mRNA expression was 1.7-fold higher in GDM vs.

NGT pregnant women

Slide 7 from 11

Page 8: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Correlations of SIRT1 expressionPositive correlations of SIRT1 expression with:A.glucose concentration at 2 h of OGTT in the whole study group (NGT + GDM)B.HDL-cholesterol in NGT group

Slide 8 from 11

Page 9: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Results:

increased leukocyte SIRT1 mRNA expression in the GDM women

association of leukocyte SIRT1 overexpression with hyperglycemia in diabetic subjects

positive correlation between leukocyte SIRT1 expression and HDL-cholesterol in health pregnant women

Slide 9 from 11

Page 10: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Conclusions:

association of GDM with a change in leukocyte SIRT1 expression at its gene level

leukocyte SIRT1 expression is related to hyperglycemic conditions

potential protective role of leukocyte SIRT1 against CVD in healthy pregnancy

Slide 10 from 11

Page 11: Doctoral Students Session, Turek Iga, Leukocyte Sirtuin 1 mRNA overexpression is associated with Gestational Diabetes Mellitus (GDM)

Thank you for your attention