dornrÖschen is a direct target of the auxin...

1643RESEARCH ARTICLE

INTRODUCTIONEmbryogenesis in plants establishes the basic body plan and stemcell populations for the generation of all post-embryonic organs. InArabidopsis, embryo development is rapid and initiallycharacterized by stereotypic cell divisions, which establish apical-basal polarity and radial symmetry (Jürgens, 1992; Weijers andJürgens, 2005). Based on seedling-lethal mutant analyses, the apicaltier of four cells within the octant-stage embryo generates most ofthe cotyledon tissue and the shoot apical meristem (SAM) (Jürgens,1995).

The remaining cotyledon tissue, hypocotyl and root apical initials,the so-called central domain, derive from the lower tier of four cells,whereas the basal hypophysis region forms the quiescent centre androot cap initials (Scheres et al., 1994). Periclinal cell divisionssuperimpose a second axis of radial (inner-outer) symmetry towardsthe 16-cell stage. This radial symmetry is broken in the apicalembryo domain by cotyledon specification, which marks thetransition to bilateral symmetry, with a central-peripheral axisextending from the SAM outwards to the expanding cotyledons and,typical for dicots, a second, perpendicular plane of symmetrymedially between both cotyledons (reviewed by Jenik et al., 2007;Chandler et al., 2008). Cotyledon defects in the seedling represent adeficiency in the acquisition of bilateral symmetry and areassociated with mutations in genes encoding transcription factors,such as the CUP-SHAPED COTYLEDON (Aida et al., 1997;Aida et al., 1999), CLASS III HD-ZIP (Prigge et al., 2005)or DORNRÖSCHEN/DORNRÖSCHEN-LIKE (DRN/DRNL)(Chandler et al., 2007) genes or genes relating to auxin signallingsuch as PINOID (PID) (Bennett et al., 1995) or auxin transport(Friml et al., 2003). Auxin is also essential for specification of the

basal embryo domain, where the MONOPTEROS (MP) orBODENLOS (BDL) gene products have a function in auxinperception and mutant mp or bdl embryos exhibit pronounced basaldomain defects (Berleth and Jürgens, 1993; Hamann et al., 1999).

Auxin response factors (ARFs) are transcription factors thatregulate the expression of auxin response genes (Guilfoyle andHagen, 2007; Guilfoyle et al., 1998). One of the best-studied ARFfamily members is MP (Hardtke and Berleth, 1998), mutant allelesof which show defects in vascular tissue and basal embryodevelopment (Mayer et al., 1991; Berleth and Jürgens, 1993;Przemeck et al., 1996). ARFs bind to TGTCTC auxin responseelements (AuxRE) in promoters of auxin-responsive genes(Ulmasov et al., 1997a) and function in combination with Aux/IAA(auxin/indole acetic acid) inhibitors, which dimerize with ARFactivators in an auxin-regulated manner and hence modulate ARFactivity (Ulmasov et al., 1997b). The Arabidopsis genome encodes23 ARFs (Okushima et al., 2005), representing either transcriptionalactivators or repressors of auxin response genes, and 29 Aux/IAAproteins, which allows tremendous theoretical combinatorialpossibilities affecting auxin response on the cellular level (Guilfoyleand Hagen, 2007). The Arabidopsis embryonic root meristem isinitiated by the specification of a single cell, the hypophysis(Hamann et al., 1999), which crucially depends on the interaction ofMP with its Aux/IAA inhibitor BDL (Hamann et al., 2002). BothMP and BDL genes function transiently in a small subdomain of thepro-embryo adjacent to the future hypophysis, where they promotetransport of auxin and elicit a second non-cell-autonomous signal,which acts synergistically with auxin to specify hypophysis cellidentity (Weijers et al., 2006). In the last few years, much researchhas addressed the regulation of ARF gene/protein expression, theirfunction in plant growth or development, potential target genes, andthe mechanisms by which they regulate target gene promoters.However, direct in vivo target genes served by individual ARFsremain unknown (Lau et al., 2008).

Loss-of-function drn mutants have a bipartite phenotype affectingboth the apical and the basal embryo domain. DRN was initiallyidentified via a dominant drn-D allele isolated from an activation-tagging screen in Arabidopsis, as having a shoot apical meristemfunction (Kirch et al., 2003). DRN encodes an AP2/ERF-type

DORNRÖSCHEN is a direct target of the auxin responsefactor MONOPTEROS in the Arabidopsis embryoMelanie Cole1,*, John Chandler1,*, Dolf Weijers2, Bianca Jacobs1, Petra Comelli1 and Wolfgang Werr1,†

DORNRÖSCHEN (DRN), which encodes a member of the AP2-type transcription factor family, contributes to auxin transport andperception in the Arabidopsis embryo. Live imaging performed with transcriptional or translational GFP fusions shows DRN to beactivated in the apical cell after the first zygotic division, to act cell-autonomously and to be expressed in single cells extendinglaterally from the apical shoot stem-cell zone at the position of incipient leaf primordia. Here, we show that the Auxin responsefactor (ARF) MONOPTEROS (MP) directly controls DRN transcription in the tips of the embryonic cotyledons, which depends on thepresence of canonical Auxin response elements (AuxREs), potential ARF-binding sites flanking the DRN transcription unit.Chromatin immunoprecipitation experiments show that MP binds in vivo to two AuxRE-spanning fragments in the DRN promoter,and that MP is required for expression of DRN in cotyledon tips. Hence, DRN represents a direct target of MP and functionsdownstream of MP in cotyledon development.

KEY WORDS: Arabidopsis, Dornroeschen, Auxin response factor, Embryonic patterning, Target gene

Development 136, 1643-1651 (2009) doi:10.1242/dev.032177

1Institute of Developmental Biology, University of Cologne, Gyrhofstrasse 17, 50931Cologne, Germany. 2Laboratory of Biochemistry, Wageningen University, Dreijenlaan3, 6703 HA Wageningen, The Netherlands.

*These authors contributed equally to this work†Author for correspondence (e-mail: [email protected])

Accepted 6 March 2009 DEVELO

PMENT

1644

transcription factor and maps to chromosome 1 within a largerchromosomal duplication also containing a paralogue DRN-LIKE(DRNL) at about 20 cM distance from DRN (Kirch et al., 2003). Astrong drnl allele, drnl-2 or bcm1 (B-Class Modifier 1), also affectsstamen development (Nag et al., 2007). Analysis of drn singlemutants or double mutants between drn and a weak drnl-1 allelerevealed a functional contribution to hypophysis specification in theglobular/early heart-stage embryo; abnormal longitudinal celldivisions in the suspensor cells subtending the hypophysis led to asuspensor comprised of multiple parallel cell files. A proportion ofdrn drnl-1 double mutants phenocopies mp, a phenotype notfrequently observed in drn or drnl single mutants, with an absenceof the primary root and hypocotyl in the seedling. However,patterning defects in the apical embryo domain are reflected in acotyledon phenotype, which is observed in up to 10% of drn singlemutant seedlings and in 30% of drn drnl double mutant seedlings,with an additional 20% of drn drnl seedlings showing post-germination basal domain defects. Genetically, DRN and DRNL arehighly redundant during embryonic patterning (Chandler et al.,2007). This conclusion is validated by protein-interaction studiesshowing that both DRN and DRNL interact with Class III HD-ZIPproteins such as PHAVOLUTA (PHV), PHABULOSA,REVOLUTA or CORONA and a basic helix-loop-helix-typetranscription factor BIM1 (BES1-interacting myc-like) protein(Chandler et al., 2007; Chandler et al., 2009). Consistent with theassumption that these three classes of transcription factors form ahigher-order protein complex, the phenotype of the drn phv bim1triple mutant implicates all three genes in a single genetic pathway.DRN acts upstream of auxin signalling/perception or transport, asdrn mutant embryos lack the DR5::GFP maximum in thehypophysis and upper suspensor cell and the subcellular polardistribution of PIN1-GFP is randomized and not oriented towardsthe hypophyseal cell in the basal domain of the globular embryo asin wild type (Chandler et al., 2007). A similar deficiency in directedauxin transport is observed in triple and quadruple mutantcombinations of class III HD-ZIP genes (Prigge et al., 2005),encoding known interaction partners of DRN. Different lines ofevidence thus support a connection between DRN and auxintransport or perception although overexpression experimentsfunctionally link DRN (ESR1) or its paralogue DRNL (ESR2) also tocytokinins (Banno et al., 2001; Ikeda et al., 2006).

DRN expression, as shown by RNA in situ hybridization, isdynamic throughout embryogenesis, beginning in the apical cell ofthe 2-cell embryo and gradually becoming restricted to the apicalcell lineage (Kirch et al., 2003). Here, we describe a detailed spatialand temporal analysis of DRN expression in the Arabidopsis embryousing reporter constructs and show cell-autonomy of the DRNprotein. Point mutations in canonical AuxREs show that upstreamAuxREs are essential for DRN promoter activity in the emergingcotyledons. DRN expression in mp loss-of-function alleles andchromatin immunoprecipitation (ChIP) experiments both identifyDRN as a direct target of MONOPTEROS in the embryo.

MATERIALS AND METHODSConstruction of transcriptional/translational GFP fusions,mutagenesis of AuxREs and plant transformationDRN promoter activity depends on elements upstream and downstream ofthe protein-coding region (S. Niczyporuk, Diploma thesis, University ofCologne, 2003). The expression cassette combines 4864 bp upstream and1378 bp downstream sequences flanking a unique SmaI/XmaI site. The GFPor chimeric DRN-GFP coding regions were inserted before transfer into thebinary pGVTV-Asc-BAR vector (Überlacker and Werr, 1996). Mutagenesisof AuxREs was performed with the GeneEditor in vitro Site-Directed

Mutagenesis System (Promega, Madison). The primers are shown in Table1. Mutated fragments were assembled in three possible combinations torestore a functional expression cassette before insertion of the GFP markergene. All chimeric gene constructs were inserted into the AscI site ofpGVTV-Asc-BAR for Agrobacterium tumefaciens GV3101-mediatedtransformation (Bechtold and Pelletier, 1998). Plants were cultivated on soilin the greenhouse under long-day (16 hours light/8 hours dark) conditionsat 22°C, and transgenic progeny were selected using resistance against theherbicide Basta.

Genetic materials and genotypingEMS mutant mp alleles arf5-1 (N24605) and mp-U55 (N8147) (Mayer etal., 1991) and the T-DNA insertion allele mp-S319 (N21319) from the SALKcollection (Alonso et al., 2003) were obtained from the NASC EuropeanArabidopsis Stock Centre. mp mutant alleles were propagated asheterozygotes and DRN::GFP expression was analysed in the fraction (25%)of homozygous mp embryos obtained after selfing. Heterozygosity of thearf5-1 allele was confirmed by PCR on seedlings, whereas transmission ofthe mp-U55 allele solely relied on embryonic phenotypes after germinationof F2 seeds.

To obtain mp-U55 drn double mutants, heterozygous mp-S319/+ plantswere crossed with homozygous drn/drn plants, both in Columbia ecotype,and transmission of the mp-S319 allele was confirmed by genotyping F1progeny. Independent F2 lines were selected that contained a recombinationevent between the linked mp and drn loci, and progeny of the resulting mp-S319/+, drn/drn lines were subjected to detailed phenotypic and geneticanalyses in the F3 generation. The primers used for genotyping are includedin Table 1. Paired Student’s t-tests were performed on select phenotypic datato assess statistical significance.

Details of the construction of the MP-GFP fusion will be describedelsewhere (Alexandra Schlereth and Dolf Weijers, unpublished). In brief,eGFP was amplified by PCR and inserted into the MlsI restriction site in thecentral region of the MP gene within an 8.5 kb genomic fragment that hasbeen shown to complement the mp mutant (Weijers et al., 2006). Theresulting MP-GFP construct (in pGreenII BASTA) was transformed intoCol-0 Arabidopsis plants, and transgenic plants were selected based on GFPfluorescence in roots and embryos. Subsequently, one line was selected fora cross with the mp mutant and analysis of F2 seedlings demonstrated fullcomplementation of the mutant.

Confocal imaging and histologyGFP expression was monitored using a Leica TCS SP2 confocal laser-scanning microscope (CLSM). Earliest embryo stages were analysed stillwithin the ovule, whereas later stages were isolated. Whole-mount seedlingswere stained with the lipophilic styryl dye FM4-64 (4 μM) in 1% Tween,130 mM NaCl, 10 mM phosphate buffer (pH 7.5). GFP was excited at 488nm and emission analysed between 502 and 525 nm. All images wereprocessed using Adobe Photoshop CS2 software.

Chromatin immunoprecipitation and real-time PCRFor crosslinking, nuclei were prepared from immature siliques (5g),essentially as described in (Conley et al., 1994), isolated nuclei wereresuspended in nuclear isolation buffer (NIB: 50 mM Hepes pH 7.4, 5 mMMgCl2, 25 mM NaCl, 5% sucrose, 30% glycerol, 0.1% β-mercaptoethanol)supplemented with 20 μg/ml plant protease inhibitor cocktail (PPIC; SigmaP9599), 1 mM Na-orthovanadate and 1 mM NaF (NIBA). Crosslinking wasperformed with 1% formaldehyde for 5 minutes at room temperature inNIBA and stopped by pelleting and resuspending nuclei in NIBA containing0.1 M glycine. Chromatin was fragmented by micrococcal nuclease(MNase) digestion (Wagschal et al., 2007) and nuclei were lysed in 10 mMTRIS pH 7.5, 1 mM EDTA, 0.5% SDS, 20 μg/ml PPIC. An aliquot offragmented chromatin served as an input control for the PCR analysis andthe remainder was subjected to immunoprecipitation (Mulholland et al.,2002). Magnetic bead-coupled anti-GFP antibodies (Miltenyi Biotec) wereused to enrich for MP-GFP-containing chromatin fragments and de-crosslinking of ChIP eluate and input control was preceded by a proteinaseK treatment (1 μl/50 μl; Sigma P4580). DNA was purified withphenol/chloroform, precipitated with ethanol, washed with 70% ethanol andresuspended in 50 μl 10 mM Tris pH 7.5, 1 mM EDTA. The input control

RESEARCH ARTICLE Development 136 (10)

DEVELO

PMENT

was diluted 50-fold relative to the ChIP eluate and quantitative PCR analysiswas performed using an Applied Biosystems 7300 Real-Time PCR Systemand Power SYBR Green PCR Master Mix (Applied Biosystems) and therelative amounts of different amplicons were determined by the ΔΔCT

method and normalisation to the open reading frame (ORF) amplicon. AllChIP primers are included in Table 1 and the relative positions of theamplicons depicted in Fig. 3.

RESULTSDRN::GFP expression patternThe DRN promoter construct comprises 4865 bp upstream from theDRN translation start and 1378 bp downstream of the stop codon(Kirch et al., 2003) and its activity depends on the combination ofupstream and downstream elements (S. Niczyporuk, Diploma thesis,University of Cologne, 2003). In the chimeric DRN::GFPtranscriptional reporter, the GFP-coding region exactly replaces theDRN ORF from the ATG to the stop codon whereas the GFP ORFwas inserted in front of the DRN translation stop codon to obtain theDRN::DRN-GFP translational fusion (Fig. 1A); both constructs thusdiffer only by the presence or absence of the DRN coding region.Characteristic DRN::GFP expression patterns from successiveembryonic stages are combined in Fig. 1B-N, and comparison ofthese patterns with those from the translational DRN-GFP fusionshowed no substantial differences in expression on the cellular level,

except that the GFP protein was cytosolic whereas the DRN-GFPfusion protein accumulated more locally and was mostly associatedwith the nuclear compartment. Importantly, no evidence wasobtained for trafficking of the DRN-GFP protein into basalsuspensor cells during embryogenesis. However, introduction of theDRN::DRN-GFP translational fusion transgene into the drn1 drnldouble mutant background resulted in partial complementation ofthe basal domain embryo phenotype. Homozygous drn-1 drnl-1mutant embryos have virtually complete (94%) penetrance ofabnormal cell divisions in the basal embryo and subtendingsuspensor domain, which is reduced to 43% (38/89 embryos) in thepresence of the DRN::DRN-GFP transgene; similarly, thepenetrance of the cotyledon phenotype in the seedling is reducedfrom 50 to 7% in this complementation experiment. The DRN-GFPfusion protein therefore is at least partially functional, and the cell-autonomous activity in the apical embryo domain is sufficient forsignificant rescue of basal domain defects. In consequence, aberrantcell divisions in the basal cell lineage of drn mutant embryosprobably relate to a secondary non-cell-autonomous signaldownstream of DRN.

The DRN::GFP transcriptional reporter and the DRN::DRN-GFPtranslational fusion were expressed throughout the 2-, 4-, 8- or 16-cell embryo proper (Fig. 1B-G). From the 32-cell stage onwards,DRN::GFP expression was no longer detected in the basal domain,which gives rise to hypocotyl and primary root (Fig. 1H,I), and twodiscrete expression maxima became evident in the apical domain ofthe late globular embryo, which mark the positions of theprospective cotyledons (Fig. 1J). During the late heart stage, bothDRN::GFP and DRN::DRN-GFP expression was restricted to thetips of the cotyledons, with no expression observed in the sinusbetween the cotyledons or in the prospective SAM (Fig. 1K; data notshown). DRN expression was activated in the SAM during thetorpedo stage (Fig. 1L,M). Subsequently, expression ceased in thecotyledon tips, whereas expression in the SAM continued duringlater embryonic stages. At the cellular level, DRN::GFP showed adynamic expression pattern at the SAM periphery, where expressionwas occasionally observed to extend laterally into a single celloutside the central expression domain of the SAM. This expressionwas observed in single cells at either flank of the SAM, at positionswhere the first leaf primordium will be initiated (Fig. 1N), or markedpositions of incipient leaf primordia in the germinating seedling(Fig. 1O). DRN::GFP expression persisted in the L1 layer of thedeveloping leaf during early development (Fig. 1O).

Point mutations in AuxREs alter DRN::GFPexpressionDifferences in auxin transport or signalling/perception observed in drnmutant embryos compared to wild type (Chandler et al., 2007),suggested an analysis of functional contribution of five canonicalTGTCTC AuxRE motifs, three of which are located in the DRN 4.8kb upstream region, and two downstream of the coding sequence (Fig.2A). Point mutations were introduced into each canonical AuxREmotif (TGTCTC to TGgCTC) and three classes of transgenicArabidopsis plants were raised carrying either mutations in all fiveAuxRE motifs (abcde) or mutations in the three upstream (abc) or thetwo downstream motifs (de). This T-to-G mutation in the AuxREmotif has been shown to eliminate binding of ARFs (Ulmasov et al.,1999). Point mutations in AuxRE motifs had no effect on DRNexpression during early stages of embryogenesis, based on data fromat least three independent transgenic lines (Fig. 2C,D). However, atthe torpedo (Fig. 2E) and early walking-stick stage (Fig. 2F), AuxREmutations in the upstream motifs (abcde or abc) abolished DRN::GFP

1645RESEARCH ARTICLEDORNRÖSCHEN an in vivo target of MONOPTEROS

Table 1. Primers used in this studyPrimer Sequence (5� to 3�)

AuxRE mutagenesis

Mut ARE-A GAGAGATTAGGAGCCATTTGATCAGAGCcheck mut-a AGAGTAATAGTAATAAAAGAGTAGTCMut ARE-B TAATTGCTGCTTATTGGCTCATTCAGTCATTTGCcheck mut-b CTATGGTTTCACATAGAGTTGTAACATTTCMut ARE-C CATGAAATACATATATGGCTCATACATACGTTTAGcheck mut-c GTAAGCATCGGGCGATATGGCATGATTATTTCMut ARE-D CAAAAGGCAGTGTTTGGCTCTGTCTTCTCCAACcheck mut-d GGAAAATTCCTTTGTTCAGCAATGTTGGTATCMut ARE-E GTAATTTAATCTACTGGCTCATATAAGTAGACAACcheck mut-e GTATGTTTCGTGGTTATTGCGTTGATGTAAC

ChIP analysis

RTnonAREf CCATGGTGGTTTTGGTCTTTACRTnonAREr TGTATTCAAATTTGTTTGGTTGGRT-ARE-Af TGCATACATATGAATCTGACCCTART-ARE-Ar GAAGAGGAGCAAAATGATCTGCRT-ARE-Bf CAGAATTAACGCAGGGGTTTTART-ARE-Br AAACCATCTACCATGACCATGACRT-ARE-Cf AACAAGCTTCTGATACATGAAATACART-ARE-Cr CGAAGAGGACATTTCAGGTTTGRT-ORFf AACTCTTTCAACGGCTCATCATRT-ORFr ACGACTCGTTGTTTTCGTTTTCRT-actin2f GTGTTGTTAGCAACTGGGATGART-actin2r CTCTTCAGGAGCAATACGAAGC

Genotyping

ARF5f GGCTATTGAGATATTTTGGCARF5r (+LBb1) CATTGAGGATTGAAGAAGCTMP-S319f GATTTTCCAGATAATTCTGGAMP-S319r (+LBa1) ATGAATATAGTTTCAGGTCTCDRNf (+SPM8) ATGGAAAAAGCCTTGAGAAACDRNr ATCATGATGAATATCTAGCTALBa1salk T-DNA TGGTTCACGTAGTGGGCCATCG

borderLBb1salk T-DNA GCGTGGACCGCTTGCTGCAACT

borderSpm8 GTTTTGGCCGACACTCCTTAC D

EVELO

PMENT

1646

expression in the tips of the cotyledons. Therefore, at least one, or acombination of AuxRE motifs upstream of the coding region, areessential to maintain DRN promoter activity in the tips of thecotyledons. DRN::GFP expression in the tips of the cotyledons alsocoincided with a high auxin concentration/perception maximum asmonitored by DR5::GFP (Fig. 2B). By contrast, mutations in thedownstream AuxREs alone (de) had little effect on the DRN::GFPexpression pattern in the embryo, although the restriction ofDRN::GFP activity into the apical domain during the globular stageappeared delayed relative to that in transgenic lines containing thenon-mutated promoter construct (Fig. 2D).

Canonical AuxRE motifs are not required for DRN expressionmaxima at the position of the incipient cotyledons during the lateglobular stage of embryogenesis (Fig. 2D) and the expression ofDRN::GFP in single cells extending from the SAM periphery wassimilarly not affected by mutations in upstream AuxREs. Positionalinformation relating to DRN expression is thus also perceived in theabsence of functional canonical AuxREs during cotyledonspecification and at the SAM periphery.

MONOPTEROS controls DRN::GFP expression in thetips of the cotyledonsBased on the AuxRE function in the DRN promoter, it was temptingto search for a potentially interacting ARF. Cotyledon and basaldomain defects, which are characteristic for drn mutants, are sharedwith homozygous mp embryos. We therefore crossed the DRN::GFPmarker into two mp mutant backgrounds; the mp-U55 allele (Mayeret al., 1991) and the arf5-1 T-DNA insertion allele (Okushima et al.,2005) from the SALK collection. In both mp backgrounds, whichwere propagated as heterozygotes, DRN::GFP expression in the tipsof the cotyledons was abolished in segregating homozygous mutantembryos (25% of progeny) from the heart stage onwards, whereasother DRN::GFP expression domains e.g. during early embryogenesisor in the SAM, remained unaffected. Phenotypic mp embryos at thelate torpedo stage showed no DRN::GFP expression in cotyledon tips,whereas expression in the SAM was unaffected (Fig. 3A-C). As themp mutant often has cotyledon defects, the DRN::GFP expressionpattern in mp mutant embryos was difficult to compare with wild typeor AuxRE-mutated DRN promoter versions, where it pre-patterns


Fig. 1. Dynamics of DRN expression in the embryo and germinating seedlings. (A) Schematic of the DRN::GFP transcriptional and DRN::DRN-GFP translational fusions. (B-D) DRN::GFP expression in the apical cell of the early embryo (B) and restriction to the apical cell lineage in 4-cellembryos (C) (subtending non-expressing suspensor cells are outlined in B and C) or 8-cell embryos (D). (E) Cell autonomy of the DRN-GFP fusionprotein at the 8-cell stage. (F-I) Comparison of DRN::GFP and DRN::DRN-GFP expression patterns in early (F,G) and late (H,I) globular stage embryos.The focus of the DRN-GFP fusion protein into the apical hemisphere presumably relates to the stability of the chimeric protein relative to that of theGFP marker. (J,K) Focussing of DRN::GFP expression to the prospective cotyledons at the late globular (J) and early heart (K) stage. (L,M) Expressionpatterns of the transcriptional DRN::GFP (L) and translational DRN::DRN-GFP (M) fusion in torpedo-stage embryos. Note DRN promoter activity inthe SAM, which is absent during the heart stage (compare with K). (N) Lateral expression of DRN::GFP in a single cell extending laterally from the L1layer at the position of an incipient leaf primordium in the torpedo-stage embryo. Inset, close-up of the SAM region showing a single GFP-expressing cell at the lateral flank. (O) A similar occurrence in the vegetative SAM of a two-leaf stage seedling. The frontal cotyledon has beenremoved and the first two leaf primordia are emerging on both sides of the SAM. The large cells above the leaf primordia belong to the remainingcotyledon at the back. Note DRN::GFP activity in the L1 layer of the leaf primordia (O) or the cotyledons (N). Scale bars: 20 μm.

DEVELO

PMENT

cotyledon initiation. In phenotypic heart-stage mp mutant embryos,DRN::GFP expression was highest in the L1 layer, with expressionalso found throughout the SAM (compare Fig. 3D with 3E). AlthoughDRN::GFP expression was confined to the L1 layer of the apicalembryo domain and to the prospective cotyledons, it wasdownregulated in wild type irrespective of the presence of functionalAuxREs; however, in the mp mutant background, DRN::GFPapparently remained active in the SAM.

The lack of DRN::GFP expression in the cotyledon tips in theabsence of MP activity exactly recapitulates the results obtainedfrom point mutations in upstream AuxREs of the DRN promoter.Apparently, MP provides a unique ARF function essential for DRNtranscription in the tips of the embryonic cotyledons, which is notmasked by redundancy among other members of the ARF family oftranscription factors.

MONOPTEROS interacts with the DRN promoter invivoTo test whether the regulation of DRN expression by MP involvesdirect binding of MP to the DRN promoter, we performed ChIPexperiments with a transgenic MP::MP-GFP line expressing afunctional MP-GFP fusion protein driven from the MP promoter(Fig. 3F,G). Immature siliques of transgenic MP::MP-GFP linescontaining heart-stage embryos were collected and used for ChIPexperiments, as outlined in Materials and methods. Anti-GFP

antibodies coupled to magnetic beads were used to precipitate MP-bound DNA fragments, and the enrichment of upstream ordownstream DRN promoter sequences via ChIP was analysed andquantified by real-time PCR. The position of the different PCRamplicons in the DRN upstream or coding region is indicated inFig. 3H. The bar diagram (Fig. 3I) shows the relative levels ofindividual PCR amplicons obtained in two independent ChIPexperiments according to triplicate real-time qPCR normalized toan amplicon located in the DRN ORF. A control fragment in thepromoter upstream region lacking any AuxRE (nonARE) wasamplified to a similar level to that of the most distal AuxRE A. Bycontrast, AuxRE B and AuxRE C, which are proximal to the DRNtranscription start site were selectively enriched in independentChIP experiments. Within individual experiments, the enrichmentof AuxRE B (about 12-fold) exceeded that of AuxRE C (about 5-fold), suggesting that binding of AuxRE B to MP may either bestronger or more frequent than to AuxRE C. The ChIP experimentsthus confirm the physical interaction of MP to two promoterregions spanning canonical AuxRE motifs proximal to thetranscription start in the DRN upstream promoter region. Takentogether, the combination of ChIP with the effect of pointmutations in AuxREs in the DRN promoter and the DRN::GFPexpression pattern in the mp mutant background confirms thatDRN is a direct target of MP in the tips of the cotyledons duringembryogenesis.


Fig. 2. Functional contribution of AuxREs in the DRNupstream and downstream region. (A) Position of AuxREsupstream or downstream of the DRN coding region, which isreplaced by GFP in the DRN::GFP construct. Canonical AuxREsare indicated by capital letters (A,B,C,D,E) in the wild type;mutated AuxREs are indicated by crosses in the individualconstructs depicted beneath and denoted by lowercase letters.(B) DR5::GFP expression in late heart-stage embryos showingauxin concentration/perception maxima in the tips of thecotyledons and in the embryonic root. (C-F) Comparison of GFPexpression obtained with the three AuxRE mutated constructsdepicted in A relative to the non-mutated DRN::GFPtranscriptional fusion at different stages of embryodevelopment: (C) globular stage, (D) early heart stage, (E) lateheart/early torpedo stage, (F) late torpedo stage. Note theabsence of DRN::GFP expression in cotyledon tips later thanheart stage (E or F) when upstream elements are mutated(constructs abc or abcde), which contrasts with the marking ofthe prospective cotyledons in D.

DEVELO

PMENT

1648

Genetic interaction between mp and drnTo test for genetic interactions between mp and drn, we createddouble mutants using a weak mp-S319 allele from the SALKcollection (Alonso et al., 2003). MP is located on chromosome 1(27.6 cM) in the interval between DRN (19.2 cM) and DRNL (39.0cM); this linkage necessitated a recombination event between drnand mp in order for mp to be propagated as a heterozygote in a drnmutant background. In a population segregating for mp buthomozygous for drn, double mutant progeny should comprise a25% fraction. The penetrance of seedling and inflorescencephenotypes was determined for progeny of six independent mp/MPdrn/drn lines (Fig. 4; Table 2). The mp-S319 allele either showed alowly penetrant embryonic pattern phenotype reflected in theabsence of the basal seedling domain (Berleth and Jürgens, 1993) ora pin-like inflorescence phenotype (Przemeck et al., 1996), andtogether both phenotypes were fully penetrant, corresponding to theexpected 25% fraction. In lines homozygous for drn and alsosegregating for mp, the penetrance of either the mp basal domainseedling (Fig. 4A,B) or inflorescence phenotype (Fig. 4C) was notstatistically different to that of mp single mutants, and the frequencyof the drn cotyledon phenotype was significantly reduced(P<0.001), thus confirming that the penetrance of characteristic drncotyledon defects is dependent on MP function and that the mpphenotype is epistatic to that of drn. The absence of additivity ofphenotypic penetrance or novel phenotypes together with theepistasis of mp over drn, supports the assumption that MP and DRNare in a linear pathway and that MP is a positive upstream activatorof DRN.

DISCUSSIONDRN transcription pattern and the contribution ofcanonical AuxREsThe DRN promoter is activated after the first zygotic division andDRN transcription in the apical cell coincides with acropetal auxintransport in the 2-cell Arabidopsis embryo (Friml et al., 2003),although the effect of point mutations in canonical AuxRE motifs inthe DRN promoter does not suggest that transcription is controlled byauxin before the heart stage. Canonical AuxREs are not relevant fordynamic changes in DRN expression during the globular stage whenDRN promoter activity is lost in the basal embryo domain or whenexpression maxima are established at the position of the prospectivecotyledons. These results are consistent with the genetically definedrole of DRN upstream of auxin transport or perception in the earlyArabidopsis embryo (Chandler et al., 2007). However, they by no


Fig. 3. Molecular and genetic interactions between MP and DRN. (A-C) DRN::GFP expression pattern in wild-type embryos (A) as comparedwith in the mp-U55 (B) or arf5-1 (C) mutant backgrounds. Note GFP activity in the SAM in both wild-type and mutant embryos, but the absence ofexpression in the tips of cotyledons in both mp mutant backgrounds. (D,E) Downregulation of DRN::GFP in the SAM of early heart-stage wild-typeembryos (D) as compared with a continuous stripe of DRN::GFP activity from the cotyledons through the SAM in mp-U55 mutant embryos (E).(F,G) MP::MP-GFP expression in early (F) or late (G) heart-stage embryos showing a broad expression domain in apical and basal regions, includingthe vasculature. (H) Schematic of the DRN gene showing the upstream region and transcriptional unit (box), AuxRE positions (ovals) and theposition of PCR amplicons in the promoter or coding region. (I) Results of two independent ChIP experiments performed with nuclei from immaturesiliques containing heart-stage embryos. The relative levels of PCR amplicons are depicted, as estimated by real-time PCR and normalized to theDRN ORF amplicon. AuxRE-B and AuxRE-C, which lie proximal to the DRN transcription start site, are selectively amplified. By contrast, chromatintemplates spanning the distal AuxRE-A or the noARE amplicons are present at levels similar to those for the DRN ORF. Bars indicate the variation inthree independent real-time PCR replicates performed for each ChIP experiment. Scale bars: 20 μm.

Fig. 4. Genetic interactions between mp and drn mutant alleles.(A) The mp basal domain defect, (B) the absence of the seedling rootand presence of a single cotyledon and (C) the pin-like inflorescencephenotype. For frequencies see Table 2. D

EVELO

PMENT

means exclude a contribution of non-canonical auxin response motifsto the regulation of early embryonic DRN expression, as it is still notclear how degenerate the consensus TGTCTC sequence can be toserve as a functional AuxRE in planta (Guilfoyle and Hagen, 2007).

There is also no contribution of AuxREs to the activation of DRNtranscription in the SAM at the late heart stage; DRN expression isstill absent from the SAM when meristem markers such asWUSCHEL (WUS) (Mayer et al., 1998) and SHOOTMERISTEMLESS (STM) (Long and Barton, 1998) have alreadybeen activated. The late onset of DRN activity in the SAM onlytowards the end of the heart stage implies that DRN function maynot directly contribute to SAM anlage. At the SAM periphery, theDRN::GFP marker reveals strikingly dynamic DRN promoteractivity: from the group of 6-8 L1 layer cells permanently expressingDRN::GFP in the SAM centre, expression is often observed insingle cells extending laterally from the flank of the stem cell zoneat the position of the next incipient leaf primordium. PersistingDRN::GFP expression in the L1 layer of emerging leaf primordiamakes it tempting to interpret these single DRN::GFP-expressingcells as evidence for anlagen of new leaf primordia, which in theclose Arabidopsis relative Cardamine hirsuta trace back to as fewas two cells (Barkoulas et al., 2008). The initiation of lateral organsis dependent on the polar transport of auxin into incipient primordia(Reinhardt et al., 2003), however, it remains to be determinedwhether this transport already occurs as early as the observedDRN::GFP expression in single cells lateral to the SAM in embryoor seedling. This lateral expansion of DRN::GFP transcription isalso independent of canonical AuxREs, suggesting that positionalinformation monitored by DRN promoter activity at the SAMperiphery might not rely on auxin signalling. This situation isreminiscent of the late globular embryo when two DRN::GFPexpression maxima are established at the positions of the prospectivecotyledons despite mutations in upstream AuxREs (Fig. 2D, abc orabcde). However, functional AuxREs in the DRN promoterupstream region are indispensable for the maintenance ofDRN::GFP expression in the tips of the cotyledons during the heart

and torpedo stage of embryo development. The selectivity ofindividual DRN promoter element function on the cellular level isextremely striking; they regulate only a very specific aspect of DRNtranscription in the embryo. Although DRN genetically actsupstream of auxin (Chandler et al., 2007) in the embryo, pointmutations in AuxREs provide clear evidence for a feedback controlvia auxin signalling.

The expression patterns of the promoter DRN::GFP and proteinfusion DRN::DRN-GFP constructs were essentially comparable,thus providing no evidence for intercellular trafficking of the DRNprotein, e.g. from the apical to the basal domain of the embryo.Therefore, DRN apparently acts cell-autonomously in theArabidopsis embryo. The absence of a DR5::GFP maximum in thehypophyseal region and aberrant cell divisions in the root/suspensorassociated with drn loss of function therefore either relate to defectsin auxin signalling or must be explained by another non-cell-autonomous signal downstream of DRN, as it is also discussed formp mutants (Weijers et al., 2006).

Molecular and genetic interactionsThree complementary findings support the idea that DRN is a directtarget of MP: the results of point mutations in AuxREs, theDRN::GFP expression pattern in an mp mutant background and ChIPexperiments, which confirm the physical interaction of MP with twosmall promoter fragments containing AuxREs proximal to the DRNtranscription start site. The strict dependence of DRN::GFP expressionin the tips of the cotyledons on canonical AuxREs in the promoterupstream region and a functional MP allele is notable, considering thatMP is a member of the Arabidopsis ARF gene family comprised of23 members with inherent redundancy. A functional overlap betweenMP/ARF5 and NPH4/ARF7 during cotyledon development has beenreported (Hardtke et al., 2004). However, this is incompatible with theabsence of DRN::GFP activity in the tips of the cotyledons obtainedin the mp-U55 (Mayer et al., 1991) and the arf5-1 (Okushima et al.,2005) alleles, which show that MP is unique in promotingtranscriptional activity of the DRN promoter in the tips of the


Table 2. The penetrance of seedling and inflorescence phenotypes obtained in six independent mp/MP drn/drn lines incomparison to frequencies characteristic for mp and drn single mutants

Total seedling drn cotyledon mp seedling mp inflorescence Parental genotype Line phenotype penetrance (%) phenotype penetrance (%) phenotype penetrance (%) phenotype penetrance (%)

drn drn/MP mp 1 7.04 1.53 5.51 21.592 13.27 2.81 10.46 15.323 9.55 2.59 6.96 18.524 12.63 2.55 10.08 14.295 13.91 3.08 10.83 13.466 10.40 2.17 8.23 17.62

Mean±s.d. 11.23±2.62 2.46±0.54 8.68±1.96 16.80±3.04

MP mp 1 13.68 0.50 13.18 9.892 8.60 0.27 8.33 14.173 8.93 0.19 8.74 17.004 11.06 0.00 11.06 11.135 6.31 0.08 6.23 15.406 14.39 0.26 14.13 13.30

Mean±s.d. 10.50±3.14 0.22±0.17 10.35±3.15 13.48±2.65

drn drn 1 9.86 0.122 8.80 0.103 11.53 04 9.95 05 9.54 06 9.44 0

Mean±s.d. 9.85±0.92 0.04±0.06

The mp-S319 allele is propagated heterozygously. DEVELO

PMENT

1650

cotyledons, and therefore that other ARF family members, includingNPH4/ARF7, cannot compensate for the loss of MP function withrespect to DRN::GFP transcription in a few apical cells of theemerging cotyledons in heart- or torpedo-stage embryos.

As striking as the strict dependence of DRN::GFP transcriptionon MP in the tips of the cotyledons is the fact that this is very local,comprising only a small subfraction of the DRN (Fig. 1) or MP(Hardtke and Berleth, 1998) expression domains in the embryo.Apparently, MP is not sufficient alone to activate DRN::GFP outsidethe apical tip of the cotyledons. It is known that ARFs are undercontrol of Aux/IAA proteins (Ulmasov et al., 1997b); for example,MP binds to BDL and both enter the nuclear compartment (Weijerset al., 2006). MP might bind DNA targets (Lau et al., 2008) includingAuxREs in the DRN promoter more widely as a heterodimer withBDL. However, to effect transcriptional activation, MP has to bereleased from BDL repression, which requires the nuclear SCFTIR1

complex and high auxin concentrations (Mockaitis and Estelle,2008; Tan et al., 2007), as can be reflected in DR5::GFP activity inthe tips of the cotyledons (see Fig. 2B). Apart from MP modulationby BDL and auxin, the TOPLESS co-repressor restricts MPactivity during embryogenesis (Szemenyei et al., 2008) orheterodimerization with other ARFs might result in altered DNAtarget-site specificity (Kim et al., 1997; Ulmasov et al., 1997a).Although MP is capable of forming heterodimers with NPH4/ARF7(Hardtke et al., 2004), the overlap of the MP or NPH4 expressiondomains throughout the embryonic vasculature cannot explain thelocal response of DRN::GFP in the tips of the cotyledons. Possibly,additional cis or trans elements have to converge for a positivetranscriptional read-out from the DRN promoter with the differentialresponse of AuxREs. However, the specific loss of DRN::GFPactivity at the tips of the cotyledons in mp single mutantbackgrounds unequivocally demonstrates that MP is unique amongthe ARF gene family in controlling DRN transcription.

According to point mutations and ChIP experiments, at least twoAuxREs proximal to the DRN transcriptions start site are potentialDNA target sites for the MP protein. AuxREs have been repeatedlyidentified in available genome sequences and functionally supportedby transcriptome analyses, but the descriptions of specific auxin-dependent events that depend on protein-DNA interactions betweenan individual member of the ARF family and specific target genepromoters have remained elusive in vivo (Guilfoyle and Hagen,2007; Lau et al., 2008), although NPH4/ARF7 has been shown invitro to interact with AuxRE-containing fragments of the LATERALORGAN BOUNDARIES DOMAIN16 (LBD) or LBD29 genepromoters (Okushima et al., 2007). The identification of DRN as abona fide target of MP, the unique role of MP in controlling DRNexpression at the tip of the embryonic cotyledons, possibly inresponse to auxin, and the suitability of the Arabidopsis embryo forlive imaging should now facilitate studies on the cellular andmolecular level.

The genetic epistasis of the mp mutant phenotype over that of drn,together with the absence of any additive phenotypic effects in eitherpenetrance or novel phenotypes in the double mutant supports agenetic hierarchy whereby MP is a positive regulator of DRN (Averyand Wasserman, 1992). This genetic interaction is somewhat difficultto explain relative to transcriptional control exerted by MP at theDRN promoter, which affects only a single and rather late aspect ofDRN expression involving only a minority of MP-expressing cells.More penetrant phenotypes in drn and mp single mutants are basaldomain defects; similarly to mp or bdl mutants, drn mutant embryoslack the DR5::GFP auxin concentration/perception maximum in thehypophysis (Chandler et al., 2007). Concerning basal domain defects,

MP and DRN act in different functional hierarchies; whereas mpmutant embryos exhibit reduced PIN1::PIN-GFP expression levels(Weijers et al., 2006), drn embryos show alterations in theintracellular compartmentation of the PIN1-GFP fusion protein interms of membrane polarity compared with wild type (Chandler etal., 2007). By contrast, mono- or polycotyledony or cotyledon fusion,which are characteristic for drn mutant seedlings and which arereduced in drn mp double mutants, reflect aberrant specification ofcells in the apical embryo domain.

The dependence of DRN on MP in terms of embryonic patterningmight be functionally addressed in more depth by ectopic expressionof DRN in the mp mutant background. This, however, is difficult toperform and of questionable relevance for several reasons: firstly,35S::DRN transgenic plants are inhibited in shoot formation (Bannoet al., 2001) and the dominant drn-1D allele results in a phenotypeonly late in seedling development (Kirch et al., 2003) and onlyextremely rarely exhibits cotyledon defects (Chandler et al., 2007).Additionally, redundancy between DRN and DRNL might mask partof the interaction between MP and DRN; drn drnl double mutantsexhibit cotyledon defects at 50% penetrance, but it is still unknownwhether DRNL can substitute for DRN function or whether theDRNL promoter is also under control of MP. Finally, MP maps onchromosome 1 within the 20 cM interval between DRN and DRNLand so is tightly linked to both, and we have so far failed to establisha triple mutant.

In the mp background, the DRN::GFP expression pattern isaltered such that, in contrast to wild type, transcription in the futureSAM region is not downregulated between the prospectivecotyledons (compare Fig. 3D with 3E). Similar ectopic DRNpromoter activity is not observed with point mutations in canonicalAuxREs in the DRN promoter; by contrast, DRN::GFP activityinitially marks the prospective cotyledons but is lost in both mpmutant embryos and following mutation of upstream DRN promoterARFs. This unique role of MP at the DRN promoter and at the tipsof the cotyledons coincides with a local maximum of YUCCA4monooxygenase (Cheng et al., 2007), and thus local auxinbiosynthesis, together with auxin maxima or response peak asmonitored via DR5::GFP (see Fig. 2B). Exactly how the AP2-typetranscription factor DRN functionally integrates into the embryonicpatterning programme remains elusive; however, the deficiencies inPIN1-GFP polarization in drn mutants strongly implicate auxintransport, which might be initially direct auxin into cotyledonanlagen similarly to into incipient leaf primordia (Reinhardt et al.,2003) and contribute to an MP-dependent auxin maximum at theapical tip of the developing cotyledons. Conceivably, an auxinfeedback loop here could control cotyledon outgrowth but also causecellular ambiguities in the apical embryo domain, which is manifestin cotyledon defects in drn seedlings. By contrast, the epistasis ofthe mp phenotype over that of drn could reside in an altered cellularcompetence for the functional separation of cotyledons or theirsubsequent morphogenesis, which is implied by the alteredDRN::GFP expression in mp mutants. Additional contributions tocotyledon development are suggested by cotyledon defects in pid(Bennett et al., 1995), polar transport double mutants such as pin4pin7 (Friml et al., 2003) or the cuc mutants (Aida et al., 1997; Aidaet al., 1999), most of these being lowly penetrant.

In summary, genetic and molecular evidence identify DRN as adirect target gene of MONOPTEROS in the tips of the embryoniccotyledons in the Arabidopsis embryo. All data merge on theconclusion that two canonical AuxREs proximal to the DRNtranscription start site serve as in vivo targets for MP, which nowfacilitates molecular studies on the specificity of auxin signalling on


DEVELO

PMENT

the cellular, individual ARF and target gene level. DRN, encodingan AP2 family transcription factor, is a particularly intriguing targetas it apparently acts upstream and downstream of auxin, isassociated with the apical cell fate after the first zygotic division andperceives positional information at the flank of the stem-cellpopulation, which relates to the initiation of new lateral organs.

This work was funded by the Deutsche Forschungsgemeinschaft through SFB572 (M.C., J.C., B.J., P.C. and W.W.) and by the Dutch Organisation forScientific Research (NWO; ALW-VIDI grant 864.06.012 to D.W.).

ReferencesAida, M., Ishida, T., Fukaki, H., Fujisawa, H. and Tasaka, M. (1997). Genes

involved in organ separation in Arabidopsis: an analysis of the cup-shapedcotyledon mutant. Plant Cell 9, 841-857.

Aida, M., Ishida, T. and Tasaka, M. (1999). Shoot apical meristem and cotyledonformation during Arabidopsis embryogenesis: interaction among the CUP-SHAPED COTYLEDON and SHOOT MERISTEMLESS genes. Development 126,1563-1570.

Alonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P.,Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R. et al. (2003).Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301,653-657.

Avery, L. and Wasserman, S. (1992). Ordering gene function: the interpretationof epistasis in regulatory hierarchies. Trends Genet. 8, 312-316.

Banno, H., Ikeda, Y., Niu, Q. W. and Chua, N. H. (2001). Overexpression ofArabidopsis ESR1 induces initiation of shoot regeneration. Plant Cell 13, 2609-2618.

Barkoulas, M., Hay, A., Kougioumoutzi, E. and Tsiantis, M. (2008). Adevelopmental framework for dissected leaf formation in the Arabidopsisrelative Cardamine hirsuta. Nat. Genet. 40, 1136-1141.

Bechtold, N. and Pelletier, G. (1998). In planta Agrobacterium-mediatedtransformation of adult Arabidopsis thaliana plants by vacuum infiltration.Methods Mol. Biol. 82, 259-266.

Bennett, S. R. M., Alvarez, J., Bossinger, G. and Smyth, D. R. (1995).Morphogenesis in pinoid mutants of Arabidopsis thaliana. Plant J. 8, 505-520.

Berleth, T. and Jürgens, G. (1993). The role of the monopteros gene inorganising the basal body region of the Arabidopsis embryo. Development 118,575-587.

Chandler, J. W., Cole, M., Flier, A., Grewe, B. and Werr, W. (2007). The AP2transcription factors DORNRÖSCHEN and DORNRÖSCHEN-LIKE redundantlycontrol Arabidopsis embryo patterning via interaction with PHAVOLUTA.Development 134, 1653-1662.

Chandler, J. W., Nardmann, J. and Werr, W. (2008). Plant development revolvesaround axes. Trends Plant Sci. 13, 78-84.

Chandler, J. W., Cole, M., Flier, A. and W. W. (2009). BIM1, a bHLH proteininvolved in brassinosteroid signalling, controls Arabidopsis embryonic patterningvia interaction with DORNROESCHEN and DORNROESCHEN-LIKE. Plant Mol.Biol. 69, 57-68.

Cheng, Y., Dai, X. and Zhao, Y. (2007). Auxin synthesized by the YUCCA flavinmonooxygenases is essential for embryogenesis and leaf formation inArabidopsis. Plant Cell 19, 2430-2439.

Conley, T. R., Park, S. C., Kwon, H. B., Peng, H. P. and Shih, M. C. (1994).Characterization of cis-acting elements in light regulation of the nuclear geneencoding the A subunit of chloroplast isozymes of glyceraldehyde-3-phosphatedehydrogenase from Arabidopsis thaliana. Mol. Cell. Biol. 14, 2525-2533.

Friml, J., Vieten, A., Sauer, M., Weijers, D., Schwarz, H., Hamann, T.,Offringa, R. and Jürgens, G. (2003). Efflux-dependent auxin gradientsestablish the apical-basal axis of Arabidopsis. Nature 426, 147-153.

Guilfoyle, T. J. and Hagen, G. (2007). Auxin response factors. Curr. Opin. PlantBiol. 10, 453-460.

Guilfoyle, T. J., Ulmasov, T. and Hagen, G. (1998). The ARF family oftranscription factors and their role in plant hormone-responsive transcription.Cell Mol. Life Sci. 54, 619-627.

Hamann, T., Mayer, U. and Jürgens, G. (1999). The auxin-insensitive bodenlosmutation affects primary root formation and apical-basal patterning in theArabidopsis embryo. Development 126, 1387-1395.

Hamann, T., Benkova, E., Baurle, I., Kientz, M. and Jürgens, G. (2002). TheArabidopsis BODENLOS gene encodes an auxin response protein inhibitingMONOPTEROS-mediated embryo patterning. Genes Dev. 16, 1610-1615.

Hardtke, C. S. and Berleth, T. (1998). The Arabidopsis gene MONOPTEROSencodes a transcription factor mediating embryo axis formation and vasculardevelopment. EMBO J. 17, 1405-1411.

Hardtke, C. S., Ckurshumova, W., Vidaurre, D. P., Singh, S. A., Stamatiou, G.,Tiwari, S. B., Hagen, G., Guilfoyle, T. J. and Berleth, T. (2004). Overlappingand non-redundant functions of the Arabidopsis auxin response factorsMONOPTEROS and NONPHOTOTROPIC HYPOCOTYL 4. Development 131,1089-1100.

Ikeda, Y., Banno, H., Niu, Q. W., Howell, S. H. and Chua, N. H. (2006). TheENHANCER OF SHOOT REGENERATION 2 gene in Arabidopsis regulates CUP-SHAPED COTYLEDON 1 at the transcriptional level and controls cotyledondevelopment. Plant Cell Physiol. 47, 1443-1456.

Jenik, P. D., Gillmor, S. and Lukowitz, W. (2007). Embryonic patterning inArabidopsis thaliana. Annu. Rev. Cell Dev. Biol. 23, 207-236.

Jürgens, G. (1992). Pattern formation in the flowering plant embryo. Curr. Opin.Genet. Dev. 2, 567-570.

Jürgens, G. (1995). Axis formation in plant embryogenesis: cues and clues. Cell81, 467-470.

Kim, J., Harter, K. and Theologis, A. (1997). Protein-protein interactions amongthe Aux/IAA proteins. Proc. Natl. Acad. Sci. USA 94, 11786-11791.

Kirch, T., Simon, R., Grunewald, M. and Werr, W. (2003). TheDORNRÖSCHEN/ENHANCER OF SHOOT REGENERATION1 Gene of Arabidopsisacts in the control of meristem cell fate and lateral organ development. PlantCell 15, 694-705.

Lau, S., Jürgens, G. and De Smet, I. (2008). The evolving complexity of the auxinpathway. Plant Cell 20, 1738-1746.

Long, J. A. and Barton, M. K. (1998). The development of apical embryonicpattern in Arabidopsis. Development 125, 3027-3035.

Mayer, K. F., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G. and Laux, T.(1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shootmeristem. Cell 95, 805-815.

Mayer, U., Torres Ruiz, R. A., Berleth, T., Miséra, S. and Jürgens, G. (1991).Mutations affecting body organization in the Arabidopsis embryo. Nature 353,402-407.

Mockaitis, K. and Estelle, M. (2008). Auxin receptors and plant development: anew signaling paradigm. Annu. Rev. Cell Dev. Biol. 24, 55-80.

Mulholland, D. J., Cheng, H., Reid, K., Rennie, P. S. and Nelson, C. C. (2002).The androgen receptor can promote β-catenin nuclear translocationindependently of adenomatous polyposis coli. J. Biol. Chem. 277, 17933-17943.

Nag, A., Yang, Y. and Jack, T. (2007). DORNRÖSCHEN-LIKE, an AP2 gene, isnecessary for stamen emergence in Arabidopsis. Plant Mol. Biol. 65, 219-232.

Okushima, Y., Overvoorde, P. J., Arima, K., Alonso, J. M., Chan, A., Chang,C., Ecker, J. R., Hughes, B., Lui, A., Nguyen, D. et al. (2005). Functionalgenomic analysis of the AUXIN RESPONSE FACTOR gene family members inArabidopsis thaliana: unique and overlapping functions of ARF7 and ARF19.Plant Cell 17, 444-463.

Okushima, Y., Fukaki, H., Onoda, M., Theologis, A. and Tasaka, M. (2007).ARF7 and ARF19 regulate lateral root formation via direct activation of LBD/ASLgenes in Arabidopsis. Plant Cell 19, 118-130.

Prigge, M. J., Otsuga, D., Alonso, J. M., Ecker, J. R., Drews, G. N. and Clark,S. E. (2005). Class III homeodomain-leucine zipper gene family members haveoverlapping, antagonistic, and distinct roles in Arabidopsis development. PlantCell 17, 61-76.

Przemeck, G. K., Mattsson, J., Hardtke, C. S., Sung, Z. R. and Berleth, T.(1996). Studies on the role of the Arabidopsis gene MONOPTEROS in vasculardevelopment and plant cell axialization. Planta 200, 229-237.

Reinhardt, D., Pesce, E. R., Stieger, P., Mandel, T., Baltensperger, K., Bennett,M., Traas, J., Friml, J. and Kuhlemeier, C. (2003). Regulation of phyllotaxis bypolar auxin transport. Nature 426, 255-260.

Scheres, B., Wolkenfeldt, H., Willemsen, V., Terlouw, M., Lawson, E., Dean,C. and Weisbeek, P. (1994). Embryonic origin of the Arabidopsis primary rootmeristem initials. Development 120 2475-2487.

Szemenyei, H., Hannon, M. and Long, J. A. (2008). TOPLESS mediates auxin-dependent transcriptional repression during Arabidopsis embryogenesis. Science319, 1384-1386.

Tan, X., Calderon-Villalobos, L. I., Sharon, M., Zheng, C., Robinson, C. V.,Estelle, M. and Zheng, N. (2007). Mechanism of auxin perception by the TIR1ubiquitin ligase. Nature 446, 640-645.

Überlacker, B. and Werr, W. (1996). Vectore with rare-cutter restriction enzymesites for expression of open reading frames in transgenic plants. Mol. Breed. 2,293-295.

Ulmasov, T., Hagen, G. and Guilfoyle, T. J. (1997a). ARF1: a transcription factorthat binds to auxin response elements. Science 276, 1865-1868.

Ulmasov, T., Murfett, J., Hagen, G. and Guilfoyle, T. J. (1997b). Aux/IAAproteins repress expression of reporter genes containing catural and highly activesynthetic auxin response elements. Plant Cell 9, 1963-1971.

Ulmasov, T., Hagen, G. and Guilfoyle, T. J. (1999). Activation and repression oftranscription by auxin-response factors. Proc. Natl. Acad. Sci. USA 96, 5844-5849.

Wagschal, A., Delaval, K., Pannetier, M., Arnaud, P. and Feil, R. (2007).Chromatin immunoprecipitation (ChIP) on unfixed chromatin from cells andtissues to analyze histone modifications. CSH Protoc. 3,doi:10.1101/pdb.prot4767.

Weijers, D. and Jurgens, G. (2005). Auxin and embryo axis formation: the endsin sight? Curr. Opin. Plant Biol. 8, 32-37.

Weijers, D., Schlereth, A., Ehrismann, J. S., Schwank, G., Kientz, M. andJürgens, G. (2006). Auxin triggers transient local signaling for cell specificationin Arabidopsis embryogenesis. Dev. Cell 10, 265-270.


DEVELO

PMENT

dornrÖschen is a direct target of the auxin...

Documents