![Page 1: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/1.jpg)
1
רפליקציה
טרנסקריפציה טרנסלציה
Replication
telomerase
![Page 2: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/2.jpg)
2
Mitosisחלוקת התא
DNAבתכלת כישור בירוק
בסגולצנטריול
Mitosis animation
פרופזהפרומטפזה
מטפזהאנפזהטלופזה
Eukaryotic Cell Cycle
![Page 3: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/3.jpg)
3
Phases of Mitosis
![Page 4: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/4.jpg)
4
![Page 5: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/5.jpg)
5
Semiconservativereplication
משומרת למחצה
Semiconservativereplication
משומרת למחצההכפלה
![Page 6: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/6.jpg)
6
בפרוקריוטים רפליקציה
•In E. coli only one site OriC
![Page 7: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/7.jpg)
7
Cell CycleRegulators
Replication Commitment
Cell Growth & Completion of
Replication
Cell Division
Cell Division and DNA Replication
Replication Initiation
In man 104 to 105 sites
Origins of replication
• In E. coli only one site OriC• In man 104 to 105 sites• The direction of replication is bi-directional
OriC OriC
OriC
![Page 8: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/8.jpg)
8
מבנה אתרהתחלת
רפליקציה-ORI
הליקאז
פרימאז
![Page 9: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/9.jpg)
9
5’ GCATTCAGCAA 3’3’ AGTCG 5’ RNA ריבוז
DNAדיאוקסי
י תבנית הגדיל המשלים"עפלנוקלאוטידנוקלאוטידהמוסיף אינזים–פולימראז
DNAדורשפולימראז:OH' 3עם קצה פרימאר1..2TEMPLATEגדיל קריאהנוקלאוטידים3.
'3ל' 5מכיוון יסנטזתמיד פולימראז
III
αβγ
![Page 10: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/10.jpg)
10
NTPsנוקלאוטידיםמוסיףפולימראזDNAכיצד
Nucleotide TriPosphare
DNA Polymerase
תבנית קריאה
![Page 11: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/11.jpg)
11
DNA Pol III activity
• 5’ to 3’ DNA polymerase• Very processive: Once it locks on it does
not let go• Very active: Adds 1,000 nucleotides/sec!• High fidelity (מדויק): has a 3’ to 5’
exonuclease activity that removes mismatches
How good is Pol III?
• 1 in 10,000 bases added are mismatched.• Of these, all but 1 in 1,000 are corrected by
Pol III• E. coli genome 4,000,000 bp
– 400 mismatches– Probably all will be corrected by Pol III
בדיקת קריאה
3’ to 5’
רק כאשר לא הוסיף את הבאהנוקלאוטיד
![Page 12: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/12.jpg)
12
Fidelity of Replication
• Complexity of replication apparatus helps insure almost perfect fidelity of DNA replication
• Only 1 mispairing event occurs per every 108 to 1010 base pairs replicated in E. coli
• Accuracy due to:– Balanced levels of dNTPs– 3’ 5’ Exonuclease functions of Pol I and
Pol III – Use of RNA primers– DNA repair systems
![Page 13: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/13.jpg)
13
בהפסקות
![Page 14: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/14.jpg)
14
הרפליקציהמזלג
אוקזקיפרגמנט
![Page 15: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/15.jpg)
15
ליגאז
![Page 16: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/16.jpg)
16
Replication fork
![Page 17: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/17.jpg)
17
Leading and Lagging strands
topoisomerase
![Page 18: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/18.jpg)
18
Etoposide – topo II inhibitorכמוטרפיה
טופואיזומראז
How are the synthesis of the leading and lagging strands coordinated?• Most of the details are not clear but the problem is
daunting• Priming the lagging strand• Synthesizing, releasing and picking up the lagging
strand• And all this has to be done while adding 1,000
bp/sec
![Page 19: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/19.jpg)
19
Elongation in E. coli, part I
• Leading strand synthesis is continuous• Primosome intermittently primes lagging strand synthesis• Lagging strand template looped to permit simultaneous
replication of the leading and lagging strands• Collision looming with previous Okazaki fragment
3’5’
![Page 20: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/20.jpg)
20
Elongation in E. coli, part II
• Pol III complex released from lagging strand template upon encountering previously synthesized Okazaki fragment
• Primosome synthesizes new primer
5’3’
Elongation in E. coli, part III
• Pol III rebinds the lagging strand template• RNA primer is extended to form a new Okazaki
fragment• Leading strand synthesis is always ahead of lagging
strand synthesis• Result of this sequence is a series of RNA-primed
fragments separated by nicks on the lagging strand
5’3’
Termination
• Ter (terminus) sites create a trap that replication forks cannot exit
• Ter sequences bind the Tus protein, which inhibits DnaB helicase
• Tus-Ter complex arrests a replication fork from only one direction – prevents overreplication by one replication fork
• Final step of DNA replication in E. coli is the unlinking of catenatedDNA strands by a topoisomerase
oriC
TerGTerF
TerB TerC TerATerD
TerE
Clockwisefork trap
Counterclockwisefork trap
Counterclock-wise fork Clockwise
fork
![Page 21: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/21.jpg)
21
Replication Movie
Replication summery
![Page 22: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/22.jpg)
22
The Major DNA Polymerases
BACTERIAL
Enzyme Primary function
DNA Pol I (PolA) Major DNA repair enzymeDNA Pol II DNA repairDNA Pol III De novo synthesis of new DNA
_______________________________________________
MAMMALIAN
Enzyme Primary function Location
DNA Pol I (α) Strand synthesis initiation NucleusDNA Pol II (ε) DNA repair NucleusDNA Pol III (δ) Strand extension NucleusDNA Pol β DNA repair NucleusDNA Pol γ De novo synthesis of new DNA Mitochon.
![Page 23: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/23.jpg)
23
![Page 24: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/24.jpg)
24
Eukaryotic DNA Polymerases• Replication of nuclear chromosomes involves
polymerase α and polymerase δ• Polymerase α (lagging strand replicase)
– Contains primase activity – Has no proofreading 3’ 5’ exonuclease activity
• Polymerase δ (leading strand replicase) – Lacks primase activity – Has 3’ 5’ exonuclease activity – Proliferating cell nuclear antigen
enhances processivity• Other polymerases (β, ε, γ) with
different roles also exist
Elongation
• DnaB helicase unwinds double helix ahead of the advancing replication fork and SSB protein prevents re-annealing of single stranded regions
• RNA primer is synthesized at the replication fork by primase for the leading strand, then for the lagging strand
• Two Pol III complexes carry out DNA elongation, one for the leading strand and one for the lagging strand
• The lagging strand template is looped so that the replisome moves as a unit in the 5’ 3’ direction
DNA Polymerase III (Pol III)• Pol III is the principal E. coli
replication enzyme • Absence of Pol III is lethal • 5’ 3’ Exonuclease activity not
present • Composed of ten different kinds of
subunits that increase the activity and processivity of the core polymeraseο β subunit clamps around the
DNA and attaches to the core polymerase, greatly increasing the processivity of the enzyme
ο γ subunit opens the β clamp to load and unload the core polymerase onto the DNA template
![Page 25: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/25.jpg)
25
DNA Polymerase I (Pol I)
• First DNA polymerase discovered (Kornberg, 1957)• Isolated based on its ability to incorporate
[14C]thymidine into DNA• Consists of a single 928 amino acid polypeptide• Possesses 5’ 3’ and 3’ 5’ exonuclease activity
Exonuclease Activity of Pol I
• The 3’ 5’exonuclease activity serves a proofreading function
• Pol I’s most important function is not replication, but replacement of RNA primers in lagging strand synthesis
• Pol I is used to repair damaged DNA and is also used in the lab to prepare radiolabeledDNA
DNA Ligase
• RNA primers removed and gaps filled by Pol I
• DNA ligase seals nicks between a 3’-OH and a 5’-phosphate
• Ligase from E. coli requires NAD+, eukaryotic ligases require ATP
• Reaction mechanism involves a phosphoamide intermediate between the ligase and the adenyl group
![Page 26: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/26.jpg)
26
If this shoelace were a chromosome,
then these two protective tips would be its
קצוות חשופים של הכרומוזומים–תיאור הבעיה
CHROMOSOME
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
AATCCCAATCCC5’
3’
TELOMERE
הרפליקציה הוספת רצפים חוזרים לקצוות בסיום –פיתרון הבעיה
TTAGGG to plants
Ornithogalum umbellatum, Sykorova et al. 2003
![Page 27: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/27.jpg)
27
TnAmGo type of minisatellite repeat
TTAGGG – human
TTTAGGG – Arabidopsis
TTGGGG - Tetrahymena
TTAGG – Bombyx
TTTTAGGG – Chlamydomonas
TTTTGGGG – Oxytricha
TTAGGC - Ascaris
(TG)1-3 - Saccharomyces cereviceae
Rabl configuration
Telomere• senescent cells have shorter telomeres• קצריםטלומריםתאים מזדקנים בעלי • length differs between species• משתנה בין מינים שוניםהטלומראורך • in humans 8-14kb long• 8-14באדם אורכו בין • telomere replication occurs late in the cell
cycle• עד 40- בהטלומאריםבכל חלוקת תא הומאני מתקצרים
.נוקלאוטידים 200
![Page 28: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/28.jpg)
28
• Provide protection from enzymatic degradation and maintain chromosome stability
• ושומר על הכרומוזומיםאינזימטימונע פרוק • Organization of the cellular nucleus by
serving as attaching points to the nuclear matrix
• משמש נקודות מעגן למערך רשת הגרעין• Allows end of linear DNA to be replicated
completely• של הכרומוזומיםהרפליקציהמאפשר את סיום
Functions
End-to-end fusion
טלומרים
![Page 29: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/29.jpg)
29
Template RNA
Telomeres and Telomerase
• DNA polymerases cannot replicate the extreme 5’-ends of chromosomes due to RNA priming (primer gap)
• Telomerase maintains the length of chromosome ends (telomeres) – RNA-dependent DNA
polymerase – Contains an RNA
component that acts as a template for nucleotide addition
טלומראז
![Page 30: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/30.jpg)
30
טלומראז
Telomerase
pseudoknot
Template domain
Important for function
![Page 31: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/31.jpg)
31
How doth it worketh?
Commandeered from Brock Biology of Microorganisms, Ninth Ed.
1)RNA portion of enzyme recognizes telomeric repeats
2)Binds and begins adding repeats to overhanging 3’end
3)Eventually the overhang is long enough and primase can work its magic and there we have a functional lagging strand Okazaki fragment.
4)Hurrah!
The telomere region before telomerase acts
![Page 32: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/32.jpg)
32
Telomerase binds to the template strand
The template strand is extended with repetitive DNA
Primase starts synthesis of the lagging strand
Primase
![Page 33: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/33.jpg)
33
The lagging strand is extended
DNA polymerase
Ligase seals the nick
Ligase
The RNA primer is removed
![Page 34: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/34.jpg)
34
Telomerase
ConcTel
בשמריםטלומר
![Page 35: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/35.jpg)
35
Telomerase is not active in most somatic cells
![Page 36: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/36.jpg)
36
Cancer cells have telomerase
Telomerase
Dolly is aging too rapidly?….or was born 6 years oldDolly has developed pre-mature arthritis
6א נולדה שהיא בת " ז– מזה של כבש רגיל שנולד 80% של טלומאריםלדולי היה אורך !שנים
. בכל חלוקת תאנוקלאוטידים 200—50 מתקצרים בקצב של הטלומארים
![Page 37: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/37.jpg)
37
Loss of telomeres in humans: loss of adult stem cell divisions
Loss of telomeres in humans: loss of adult stem cell divisions
Very similar to chemotherapy
![Page 38: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/38.jpg)
38
Telomerase, the Aging Process, and Cancer
• Inactive telomerase in Tetrahymena leads to shortened telomeres and eventual cell death
• In human germ-line cells, telomere lengths are maintained and telomerase is active
• Somatic cells lack telomerase and telomeres grow shorter with time
• In fibroblast cultures, a linear, inverse relationship exists between telomere length and the age of the donor
• Elimination of telomerase activity in somatic cells could protect multicellular organisms from cancer – Malignant cancer cells contain high levels of telomerase – Telomerase is being investigated as a target for cancer
chemotherapy
![Page 39: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/39.jpg)
39
• Expressed by both benign (שפיר) and malignant tumors
• 50% 0f the tumors have no detectable telomerase activity
• Expressed by >90% of neuroblastoma, skin, colon breast and uterine tumors
• Positivity less for brain, renal and hematologic neoplasms
Telomerse activity in various tumors
telomerase activity in tumors
High telomerase activity in tumors is due to– Reactivation of telomerase– Telomerase failed to switch off during
development – Tumor arises from a pre-existing
telomerase positive stem cell
A Japanese-American W erner patient as a teenager (left), and at age 48 (Case #1 Epstein et al,1966, Medicine 45:177). She had eight children, two of whom were also affected. At 48, she hadhair loss and greying, thin extremities, chronic ulcerations of the ankles, atrophy of the skin and herthe right eye had been enucleated several years earlier due to acute glaucoma resulting from bilat-eral cateract extraction at the age of 27. She lived longer than many W erner patients, dying at 57.
Werner Patient
Teenager Age 48
![Page 40: 03 replication.ppt [Read-Only]gilast/course2009/pdf/03replication.pdf · 20 Elongation in E. coli, part II • Pol III complex released from lagging strand template upon encountering](https://reader034.vdocument.in/reader034/viewer/2022052016/602f02add2cd3a69850ea7d8/html5/thumbnails/40.jpg)
40
Reverse Transcriptase
• Essential enzyme of RNA containing viruses such as HIV virus
• Synthesizes DNA in 5’3’ direction from an RNA template
• Viral RNA is degraded by RNase H domain of the protein, then complementary DNA is synthesized
• DNA integrated into host cell chromosome
from Molecular Biology of the Cell, Alberts, Bray, Lewis, Raff, Roberts, and Watson, Garland Publishing, New York 1994.