2
Better Prevention and Management of Chronic Disease are Critical to Improving Health Outcomes and Lowering Healthcare Costs
Source: DeVol, R, Bedroussian, A, et al. An Unhealthy America: The Economic Burden of Chronic Disease. The Milken Institute. October 2007.
An Unsustainable Path
3
Our Leaders Agree
“In the future, when doctors can truly prescribe the right treatment, to
the right person, at the right time, we will have a new level of precision
and effectiveness that will provide the knowledge-driven power that is
necessary to achieve our highest goals in healthcare reform – including
more effective disease prevention and early disease detection.”
HHS Secretary Kathleen SebeliusSenate confirmation hearings, April 2, 2009
4
IGNITE is a unique non-profit medical research institute in the national capital area aimed at alleviating human suffering and transforming the health care system using a new strategy:
Personalized Medicine
5
Strategy
Chronic disease R&D focus – align program with market needs from outset
Deep molecular sub-classification of chronic disease (all heritable risk identified)
Identify at-risk individuals from across the population via “genetic risk factor testing”
Run distributed primary prevention trials facilitated by HIT network
Apply results rapidly back to at-risk individuals via a robust translational infrastructure – including a “captured” health care system
Integrate health information technology to allow heritable risk information to be incorporated into point-of-care with clinical decision support
Empower change across the personalized medicine ecosystem through policy, education, health economics, regulation
Outcome: Alleviate or delay the onset of chronic disease and decrease the time individuals are sick at the end of life and allow resources to care for more
8
How AD Contributes to the Crisis
In ‘Boomer’ Diseases, such as Alzheimer’s, Impact and Costs Will Escalate Dramatically Without New Interventions
2000 2010 2020 2030 2040 2050$0
$500
$1000
$1500
$2000
0
2
4
6
8
10
12
14
16
Baseline Estimate
Estim
ated N
um
ber o
f Peo
ple
With
AD
(in m
illion
s)
Delayed Onset & Slowed Progression (~6 yrs)
Adapted from The Lewin Group Report, June 2004, “Saving Lives. Saving Money: Dividends for Americans Investing in Alzheimer Research,” The Alzheimer’s Association (http://www.alz.org/Resources/FactSheets/Lewin_FullReport1.pdf)
Molecular Scanning Technologies
– Chairman of NIH Microarray Consortium (15 NIH)– 10 years of experience with Affymetrix platform– 5 years experience with Illumina– >60,000 expression profiles run– >100,000 SNP arrays run (10k, 100k, 500k, 1M)– Data warehousing – First “Genomics Collaborators” , “Center of
Excellence”, and “TransMed” site of Affymetrix– NHLBI Programs in Genomic Applications– NEI intramural contract site– NIH Neuroscience Array Consortium– NCI funded ALL catalog– NIA funded Alzheimer’s disease catalog– ADNI Consortium hub– International Autism Genome Project Genotyping Site– TCGA Biospecimen repository– High throughput sequencing (Solexa, 454, ABI,
Pacific Biosiences)
NIH Neuroscience Microarray Consortium
1650 registered users
455 proposals submitted from about 114 institutions around the country and from over 287 different investigators
Total Projects: 455455 (45,400 arrays)
Population-based Genetic Risk Factor Screening
David Agus, MD Dietrich Stephan, PhD
SAB:Isaac Kohane, MD PhDDavid Botstein, PhDSpencer Wells, PhD
Population-based Genetic Risk Factor Screening
David Agus, MD Dietrich Stephan, PhD
SAB:Isaac Kohane, MD PhDDavid Botstein, PhDSpencer Wells, PhD
Navigenics CONFIDENTIAL
Extract the Total Heritable Risk for Chronic Disease
Customer Acquisition Laboratory Bioinformatics
PersonalizedWeb Portal
OngoingService
1 52 3 4
ATACCGCTGGCCCTTTGGCATTACCTATGAAGATTGCTTCAGCCAGCGTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGAAGTCCC
FUTURE: Full genome sequencing, copy number analysis, methylation status leading to personalized exposure mitigation strategies and biomarker monitoring programs fully integrated into the established health care system.
QUALITY
CLIA and stringent QC labCaptured perfectly Per SNP algorithm checksPer SNP concordanceH-W equilibrium checks
Navigenics CONFIDENTIAL
What we do
23 Navigenics CONFIDENTIAL
Review world class academic and clinical research published in leading peer-reviewed journals…
…and provide personalized, preventative, health and wellness information
Stringent Curation Criteria Replication in the same ethnic group
– Once for GWAS, twice for candidate gene studies
– >60% independent sample sets show same statistically significant effect with same allele (after trimming underpowered samples)
Study design - An effort was made to sample controls from the same source population as the cases, e.g. ethnicity, gender, age, or other risk factors.
Reasonable sample size to detect weak effects. OR <1.5 needs 250 cases/250 controls at least.
Significance level - Exact value depends on magnitude of the study (e.g. GWAS or candidate gene) Sound statistical design - correction for multiple testing, population
stratification, confounding Sound laboratory practice - independent genotyping platforms, replicated
samples Functional data and magnitude of effect are also taken into account, but
studies are not automatically excluded if functional data is unavailable or the effect estimate is small.
Finding the Relative Risk - see full details at navigenics.com
OR (RR)
(RN)
Prevalence
• We normally get genotypic odds ratios RR/NN, RN/NN
OR (RN)
Genotype Freq
• Using genotype frequencies and prevalence, we derive a set ofquadratic equations – the solution provides the relative risks.
(RN)?
?
Distribution of effect sizes for genetic and environmental risk factors
Risk factors determined from literature using strict curation guidelines
risk factor conditioneffect size
Ex-smoker T2D 1.15PPARG
genotypeT2D
1.53HDL<35mg/dl CHD 2.08
MHC genotype RA 5APOE genotype AD 18
BMI>35 T2D 42
Google, Microsoft, MDVIP, Cisco, etc…
Distribution of fold change in lifetime risk by individual patient
• Across the entire population:– 98% of patients showed at least condition with >1.2X increase in average lifetime risk
– 45% of patients showed at least condition with >3X increase in average lifetime risk
Fol
d A
LTR
Average lifetime risk for this condition = 0.06%Individual’s estimated lifetime risk = 0.37%Fold change in ALTR= 0.37/0.06 = 6.2
Orange (>1.2X)
Gray (<1.2X)
Individual Patient Number
Conditions with >3X ALTR risk by individual patient
Fol
d A
LTR
Individual Patient NumberAlzheimer’s diseaseCeliac diseaseCrohn’s diseaseGlaucomaGrave’s diseaseMacular degenerationMultiple sclerosis
fMRI in at-risk Individuals as a Surrogate for Clinical Efficacy (BAI)
• “push” loaded patients to BAI via Navigenics• baseline imaging performed• patients go on drug and placebo• periodic functional imaging• use imaging as surrogate measure of clinical efficacy
• PROS: • hundreds of patients vs. thousands• years vs. decades• millions vs. hundreds of millions• within patent life of compound
• CONS:• imagining not endpoint for approval• no biomarker associated with imaging
Health Information Technology Accelerates Personalized Medicine
Embed the genome into the electronic medical record (EMR) Role-based access to genome data (insurance companies excluded) Connect to a consumer-facing portal (PCHR, patientslikeme,
Healthvault) Allow HIPAA-compliant messaging and interventional distributed trials Secure and authenticate transactions and data flow Undergird the clinical information system with a research database
that can connect to other regional HIT systems (MS Amalga) Build a flexible clinical decision support module that allows physicians
to understand molecularly-guided strategies Enable a “learning” CDS that constantly refines itself with the data
flows to optimize clinical care
36
Summary of Solution – Alzheimer’s
Identify genes that classify the population into “high” and “low” risk Build a broad-based CLIA genetic testing infrastructure to classify
individuals across the world (Navigenics) Incorporate pointers to push “high” risk individuals into our clinical
trial at BAI Develop functional brain imaging strategy that can detect the earliest
brain changes associated with AD that can be used as a surrogate measure of clinical efficacy in slowing AD pathology
Run a series of small trials drawing on a national base and fMRI to develop primary prevention drugs for AD in the next decade
Work with the FDA so that fMRI and associated biomarkers are robust enough for approval of primary prevention therapies
Use HIT vehicle to disseminate approved therapies back to population
37
Learning Health Care
System
38
Results of Personalized Medicine in Chronic Disease
Genomic Profile / Predisposition / Environmental Risks
Personal Health / Wellness (Disease pre-emption)
Interaction with Health Care Provider (Early diagnosis if needed)
Interventions (Targeted treatment individualized to my molecular profile and that of my disease)
Post-Disease Management
Family Members’
Health Care
39
What Does Success Look Like?
Americans living longer
without disease
American health care delivering
value at reduced cost
“Connected” information from
bench to bedside
Robust pipeline of diagnostics and targeted therapeutics
moving toward approval
Growing portfolio of emerging, innovative companies
$
$